Method capable of highly sensitively detecting proportion of chimeric cells after bone marrow transplantation

Abstract

The invention relates to the field of chimeric cell proportion detection, in particular to a method for highly sensitively detecting the proportion of chimeric cells after bone marrow transplantation. Aiming at the condition that a bone marrow transplantation donor and a patient are heterosexual, the method comprises the following steps: firstly, selecting a gender specific gene as a target, then analyzing the transcriptional level of the gender specific expression gene in a blood sample of the patient before and after transplantation through a real-time fluorescence quantification method, and finally calculating to obtain the residual proportion of the patient cells. The detection method provided by the invention can be used for evaluating the chimeric state of a heterologous hematopoietic stem cell transplantation patient and monitoring the implantation state, relapse or MRD of donor stem cells in a receptor so as to guide clinics to take corresponding treatment measures in time.

Description

Technical Field

[0001] The present invention relates to the field of chimeric cell ratio detection, and in particular to a method for highly sensitively detecting the chimeric cell ratio after bone marrow transplantation. Background Art

[0002] Allogeneic hematopoietic stem cell transplantation (HSCT) refers to replacing the patient's (recipient's) damaged hematopoietic system with a new hematopoietic system from a healthy donor. This treatment method can have a significant effect on the treatment and prognosis of blood diseases, achieving the goal of prolonging survival or even curing the disease. With the continuous improvement of medical standards, hematopoietic stem cell transplantation (HSCT) is still one of the main means of curing various blood diseases.

[0003] After bone marrow transplantation, the patient's hematopoietic stem cells will appear in a chimera state where the patient and donor cells coexist. The proportion of donor-derived cells in the chimera varies at different times after transplantation. The complete donor-derived state and mixed chimera can also transform into each other as the disease evolves and over time. By monitoring the allogeneic chimera of patients before and after transplantation, not only can the implantation of the graft be identified at an early stage and the transplantation effect be predicted, but it will also guide the clinic to take appropriate treatment measures in a timely manner in many aspects such as detecting residual microlesions.

[0004] The STR-PCR monitoring method has been used to monitor the status before and after allogeneic hematopoietic stem cell transplantation. DNA samples extracted from the recipient and donor blood specimens before and after transplantation are collected for STR locus detection. The results are compared and analyzed by capillary electrophoresis and supporting analysis software, which can intuitively, reliably, and clearly observe the chimerism of the patient after transplantation. STR-PCR has good quantitative ability and is more suitable for early monitoring after transplantation, but its sensitivity is only 1-5% (Leukemia. 2012; 26: 1821–1828). It is almost undetectable when the patient's cell ratio is less than 1%. Therefore, it has no advantage in the detection of minimal residual lesions or minor changes in status after transplantation. If you want to achieve higher sensitivity monitoring, other methods need to be evaluated. Summary of the invention

[0005] In view of the problems existing in the background technology, a method for highly sensitively detecting the proportion of chimeric cells after bone marrow transplantation is proposed, which can not only detect the engraftment status of patients after transplantation, but also detect tiny residual lesions with high sensitivity.

[0006] The present invention proposes a method for highly sensitively detecting the proportion of chimeric cells after bone marrow transplantation. The method is aimed at the situation where the bone marrow transplant donor and the patient are of opposite sexes. First, sex-specific genes are selected as targets. Then, the transcription levels of sex-specific expression genes in the patient's blood samples before and after transplantation are analyzed by real-time fluorescence quantitative method. Finally, the residual proportion of the patient's cells is obtained by calculation.

[0007] Preferably, ABL1 and XIST genes are selected for residual ratio detection of female patient cells; ABL1 and RPS4Y1 genes are selected for residual ratio detection of male patient cells.

[0008] Preferably, the steps are as follows:

[0009] S1. Nucleic acid extraction: 5 mL of venous blood was collected from the patient before and after transplantation, and whole blood RNA was extracted;

[0010] S2. Reverse transcription: Take no less than 1 μg of extracted RNA for reverse transcription. The reaction system includes: 5XReactionMix 4 μL, Maxima Enzyme Mix 2 μL, Template RNA 1-5 μg, nuclease-free Water 20 μL and Total volume 20 μL; the reaction conditions are: 25℃10 min, 50℃15 min, 85℃5 min and 4℃Hold;

[0011] S3, PCR: Take 1uL of cDNA of the reverse transcription product of blood samples before and after transplantation for gene quantification; if the patient is a female, quantify the ABL1 and XIST genes; if the patient is a male, quantify the ABL1 and RPS4Y1 genes. The reaction system is as follows:

[0012] Quantification of ABL1 gene: cDNA 1 μL, ABL1 primer mixture (2 μM) 2 μL, ABL1 probe (1 μM) 2 μL, KAPAPROBE FAST qPCR Kit Master Mix (2X) Universal 10 μL, nuclease-free Water 5 μL, and Total volume 20 μL;

[0013] XIST or RPS4Y1 gene quantification: cDNA 1μL, KAPA PROBE FAST qPCR Kit Master Mix (2X) Universal 10μL, nuclease-free Water 5μL and Total volume 20μL;

[0014] After vortexing the prepared reaction system, place it in the 7500 fluorescence quantitative instrument, set the fluorescent group of each well to FAM, and start the program according to the following conditions:

[0015] Pre-denaturation: temperature 95°C, time 3 min, cycle number 1;

[0016] Denaturation: temperature 95°C, time 10s, cycle number 45;

[0017] Annealing and extension: temperature 62°C, time 30S, cycle number 45; temperature 4°C, time Hold, cycle number 1;

[0018] S4. Result analysis: The CT value of gene quantification was derived, and the difference in XIST gene expression before and after transplantation (△CT) was calculated to obtain the residual proportion of patient cells. The calculation formula is as follows;

[0019] For female patients (males are donors in bone marrow transplantation), the chimerism ratio is calculated as follows:

[0020] For male patients (females are donors in bone marrow transplantation), the chimerism ratio is calculated as follows:

[0021] △Ct=Ct (移植后) -Ct (移植前) .

[0022] Preferably, in S4, the threshold value automatically calculated by the quantitative PCR instrument is used. If the baseline phase, exponential amplification phase and plateau phase of the obtained amplification curve are not typical, the cycle number for calculating the threshold value is manually adjusted or the threshold value is manually adjusted.

[0023] Preferably, if there is a third party donor, both donors should be of the same gender.

[0024] Preferably, a probe method is used for real-time fluorescence quantitative analysis.

[0025] Preferably, the primer and probe sequences of the XIST gene are as follows:

[0026] XIST-F: TGGGATGTCAAGATACTTTCCTGGTCCCAG;

[0027] XIST-R: AAGCAACTCAGCTCTCTGCACTGCTTG;

[0028] Probe-XIST:CTGCCAAATCATTATACTTC.

[0029] Preferably, the primer and probe sequences of the RPS4Y1 gene are as follows:

[0030] RPS4Y1-F: ATCCACGATGGCAAGGTTCGAGTGGATG;

[0031] RPS4Y1-R:CTCTTCCACTGTGATGCGGTG;

[0032] Probe-RPS4Y1: CAGGTGAACATTTCC.

[0033] Preferably, XIST-F, XIST-R and RPS4Y1-F all have 5-6 oligo sequences added to the 5' end.

[0034] Compared with the prior art, the present invention has the following beneficial technical effects: for the case where the bone marrow transplant donor and the patient are of opposite sex, the present invention first selects sex-specific genes as targets, then uses real-time fluorescence quantitative methods to analyze the transcription levels of sex-specifically expressed genes in the patient's blood samples before and after transplantation, and finally calculates the residual proportion of the patient's cells. The test results can be used to evaluate the chimerism of patients with opposite-sex hematopoietic stem cell transplantation, monitor the implantation status, recurrence or MRD of donor stem cells in the recipient, and then guide the clinic to take corresponding treatment measures in a timely manner. Not only can the implantation status of the patient after transplantation be detected, but also tiny residual lesions can be detected with high sensitivity. In addition, in terms of the operating process, STR-PCR takes 4-5 hours, while real-time fluorescence quantification can obtain the test results in 1-2 hours. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] Figure 1 The CT value standard curve of each gradient of the female cell line in Example 1;

[0036] Figure 2 The standard curve diagram of CT values ​​of each gradient of the male cell line in Example 1;

[0037] Figure 3 It is a standard curve diagram of CT values ​​of each gradient of the female cell line in Example 2;

[0038] Figure 4 This is a standard curve diagram of the CT values ​​of each gradient of the male cell line in Example 2. DETAILED DESCRIPTION

[0039] The present invention proposes a method for highly sensitively detecting the proportion of chimeric cells after bone marrow transplantation. In the case where the bone marrow transplant donor and the patient are of opposite sexes, the method selects ABL1 and XIST genes for detecting the residual proportion of female patient cells; and selects ABL1 and RPS4Y1 genes for detecting the residual proportion of male patient cells. The specific detection steps are as follows:

[0040] S1. Nucleic acid extraction: 5 mL of venous blood was collected from the patient before and after transplantation, and whole blood RNA was extracted. The extraction kit used in the present invention includes but is not limited to a blood RNA extraction kit (Kangwei Century, CW0582S);

[0041] S2. Reverse transcription: Take no less than 1 μg of the extracted RNA for reverse transcription. The kit used in the present invention is the Maxima First-Strand cDNA Synthesis Kit for RT-qPCR (ThermolFisher Scientific, K1641). The reaction system includes: 5X Reaction Mix 4 μL, Maxima Enzyme Mix 2 μL, Template RNA 1-5 μg, nuclease-free Water 20 μL and Total volume 20 μL; the reaction conditions are: 25°C for 10 min, 50°C for 15 min, 85°C for 5 min and 4°C Hold;

[0042] S3, PCR: Take 1uL of cDNA of the reverse transcription product of blood samples before and after transplantation for gene quantification; if the patient is a female, quantify the ABL1 and XIST genes; if the patient is a male, quantify the ABL1 and RPS4Y1 genes. The reaction system is as follows:

[0043] Quantification of ABL1 gene: cDNA 1 μL, ABL1 primer mixture (2 μM) 2 μL, ABL1 probe (1 μM) 2 μL, KAPAPROBE FAST qPCR Kit Master Mix (2X) Universal 10 μL, nuclease-free Water 5 μL, and Total volume 20 μL;

[0044] XIST or RPS4Y1 gene quantification: cDNA 1μL, XIST or RPS4Y1 primer mixture (2uM) 2μL, XIST or RPS4Y1 probe (1uM) 2μL, KAPA PROBE FAST qPCR Kit Master Mix (2X) Universal 10μL, nuclease-free Water 5μL and Total volume 20μL;

[0045] After vortexing the prepared reaction system, place it in the 7500 fluorescence quantitative instrument, set the fluorescent group of each well to FAM, and start the program according to the following conditions:

[0046] Pre-denaturation: temperature 95°C, time 3 min, cycle number 1;

[0047] Denaturation: temperature 95°C, time 10s, cycle number 45;

[0048] Annealing and extension: temperature 62°C, time 30S, cycle number 45; temperature 4°C, time Hold, cycle number 1;

[0049] S4. Result analysis: If the baseline phase, exponential amplification phase, and plateau phase of the amplification curve obtained by using the quantitative PCR instrument are not typical, manually adjust the number of cycles for calculating the threshold or manually adjust the threshold. Export the CT value of gene quantification, calculate the difference in XIST gene expression before and after transplantation (△CT), and obtain the residual proportion of patient cells. The calculation formula is as follows;

[0050] For female patients (males are donors in bone marrow transplantation), the chimerism ratio is calculated as follows:

[0051] For male patients (females are donors in bone marrow transplantation), the chimerism ratio is calculated as follows:

[0052] △Ct=Ct (移植后) -Ct (移植前) .

[0053] It should be further explained that if there is a third-party donor, the two donors are required to be of the same gender.

[0054] It should be further explained that the probe method is preferably used for real-time fluorescence quantitative analysis.

[0055] It should be further explained that the primer and probe sequences of the XIST gene are as follows:

[0056] XIST-F: TGGGA TGTCAAGATACTTTCCTGGTCCCAG;

[0057] XIST-R: AAGCA ACTCAGCTCTCTGCACTGCTTG;

[0058] Probe-XIST:CTGCCAAATCATTATACTTC.

[0059] The primer and probe sequences for the RPS4Y1 gene are as follows:

[0060] RPS4Y1-F: ATCCAC GATGGCAAGGTTCGAGTGGATG;

[0061] RPS4Y1-R:CTCTTCCACTGTGATGCGGTG;

[0062] Probe-RPS4Y1: CAGGTGAACATTTCC.

[0063] It should be further explained that XIST-F, XIST-R and RPS4Y1-F all add 5-6 oligo sequences (underlined part) at the 5' end. This sequence can complementarily pair with the 3' end of the primer. During primer annealing, the primer that is not paired to the target sequence will preferentially form its own hairpin instead of generating primer dimers, thereby improving the sensitivity of detection.

[0064] Based on the above-mentioned method for highly sensitively detecting the proportion of chimeric cells after bone marrow transplantation, some sample embodiments are proposed below.

[0065] Embodiment 1

[0066] Using the above method for highly sensitive detection of chimeric cell ratio after bone marrow transplantation, female cell line 293T and male cell line Raji were mixed in different proportions. After RNA was extracted from cell line samples of each proportion, 1 μg RNA was taken for reverse transcription, and quantitative analysis of the two genes XIST and Raji was performed at the same time. The analysis results are shown in Tables 1 and Figure 1-Figure 2 .

[0067]

[0068] Table 1

[0069] From the above test results, we can see that the XIST gene is weakly expressed in the male cell line Raji, while RPS4Y1 is not expressed in the female cell line 293T. In this experiment, as low as 0.1% of female cells can be detected in male cell lines, and as low as 0.01% of male cells can be detected in female cell lines.

[0070] The standard curve was drawn by taking the CT value data of 0.01%, 0.1%, 1%, and 10% of the two genes, and the linear correlation coefficient R 2 All were above 0.99, and the amplification efficiency was above 95% (amplification efficiency = 10^(-1 / slope)-1).

[0071] Embodiment 2

[0072] The above-mentioned method for highly sensitive detection of the proportion of chimeric cells after bone marrow transplantation was used to collect peripheral blood samples from normal women and men, and the two blood samples were mixed in different proportions. After RNA was extracted from the blood samples of each proportion, 1 μg RNA was taken for reverse transcription, and quantitative analysis of the two genes XIST and Raji was performed at the same time. The analysis results are shown in Tables 2 and Figure 3-Figure 4 .

[0073]

[0074] Table 2

[0075] Similar to the results of cell lines, XIST gene was weakly expressed in male blood, while RPS4Y1 was not expressed in female blood. In this experiment, female cells were detected as low as 0.1% in male blood, and male cells were detected as low as 0.01% in female blood.

[0076] The standard curve was drawn by taking the CT value data of 0.01%, 0.1%, 1%, and 10% of the two genes, and the linear correlation coefficient R 2 All were above 0.99, and the amplification efficiency was above 95% (amplification efficiency = 10^(-1 / slope)-1).

[0077] Embodiment 3

[0078] The above-mentioned method capable of highly sensitively detecting the proportion of chimeric cells after bone marrow transplantation was used, and the STR-PCR test results of real patient samples were used as a control. The blood samples of female patients before and after transplantation were quantitatively tested for XIST and ABL1 genes, and the blood samples of male patients before and after transplantation were quantitatively tested for RPS4Y1 and ABL1 genes. The test results of the two methods were compared at low chimeric ratios. The analysis results are shown in Table 3.

[0079]

[0080] Table 3

[0081] When the STR detection ratio is less than 1%, it is recorded as completely donor cells, and the patient cells remain at 0%. When the qPCR method is used, the sensitivity can be detected to 0.1% or 0.01%, so even if the STR detection ratio is completely donor cells, the method involved in the invention can still detect a small proportion of patient cells remaining.

[0082] The present invention selects two genes, XIST and RPS4Y1, for analysis of cell residual ratios in female patients and male patients, respectively. XIST (X Inactive Specific Transcript) is a long non-coding RNA (lncRNA) involved in X chromosome inactivation (XCI). The process of X chromosome inactivation causes one of the two X chromosomes in females to be randomly silenced, thereby producing an active X and an inactive X, making the dosage of X chromosomes equivalent in males and females. Because there is no dosage compensation in males, this makes XIST expression female-specific. However, a study aimed at studying the sex-biased expression of X-linked immune genes has convincingly and repeatedly found low levels of XIST expression in male leukocytes (DOI: 10.4049 / Jimmunol.210.supp.167.37), which may also slightly limit the sensitivity of cell detection in female patients. Most male-specific genes are located on the Y chromosome, such as SMCY, UTY, RPS4Y, DBY, USP9Y, etc. The RPS4Y1 gene has the highest expression level in blood samples, and a lower detection sensitivity can be obtained by detecting this gene. However, most male-specific genes have homologous repeat sequences or pseudogenes on the X chromosome, so the specificity of primer design largely determines the detection sensitivity of the invention.

[0083] Through the above examples, the applicant believes that compared with the STR-PCR method using DNA samples for detection, using RNA samples to analyze changes in gene transcription levels may achieve higher detection sensitivity. The present invention intends to analyze the transcription levels of sex-specifically expressed genes in blood samples of patients before and after transplantation by a real-time fluorescence quantitative method in the case where the donor and the patient are of opposite sex. This can not only detect the implantation status of the patient after transplantation, but also detect tiny residual lesions with high sensitivity. Because the detection target of the invention is the expression level detection of sex-specific genes, it is crucial to determine highly sex-specific genes, and their specificity also determines the sensitivity of the detection method.

[0084] In addition, in terms of the operational process, STR-PCR takes 4-5 hours, while real-time fluorescence quantification can obtain test results in 1-2 hours.

[0085] In summary, by detecting the expression levels of sex-specific genes XIST and RPS4Y1 in blood samples of patients before and after transplantation, the test results can be used to evaluate the chimerism of patients undergoing heterosexual hematopoietic stem cell transplantation, monitor the implantation status, relapse or MRD of donor stem cells in the recipient, and thus guide the clinic to take appropriate treatment measures in a timely manner.

[0086] The XIST gene and RPS4Y1 gene can specifically detect the proportion of female and male cells in chimeric blood samples, with the lowest detection lines of 0.1% and 0.01%, respectively; however, the proportion of patient cells in early blood samples after transplantation is high, and the deviation is large when using fluorescent quantitative methods for detection. Therefore, this method is more suitable for small residual cells in late patients after transplantation or regular detection to prevent disease recurrence. It is recommended that for patients with STR results <5%, qPCR testing can be added as a supplement in subsequent monitoring to evaluate low-proportion chimerism and monitor small residual lesions or disease recurrence.

[0087] The embodiments of the present invention are described in detail above with reference to the accompanying drawings, but the present invention is not limited thereto, and various changes can be made within the knowledge scope of technicians in the relevant technical field without departing from the purpose of the present invention.

Claims

1. A method for highly sensitively detecting the proportion of chimeric cells after bone marrow transplantation, characterized in that: Methods: In the case where the bone marrow transplant donor and patient are of opposite sex, sex-specific genes were first selected as targets. Then, the transcription levels of sex-specifically expressed genes in the patient's blood samples before and after transplantation were analyzed by real-time fluorescence quantitative method. Finally, the residual proportion of patient cells was calculated.

2. The method for highly sensitively detecting the proportion of chimeric cells after bone marrow transplantation according to claim 1, characterized in that: ABL1 and XIST genes were selected for residual ratio detection in female patient cells; ABL1 and RPS4Y1 genes were selected for residual ratio detection in male patient cells.

3. The method for highly sensitively detecting the proportion of chimeric cells after bone marrow transplantation according to claim 2, characterized in that: Here are the steps: S1. Nucleic acid extraction: 5 mL of venous blood was collected from the patient before and after transplantation, and whole blood RNA was extracted; S2. Reverse transcription: Take no less than 1 μg of extracted RNA for reverse transcription. The reaction system includes: 5X Reaction Mix 4 μL, Maxima Enzyme Mix 2 μL, Template RNA 1-5 μg, nuclease-free Water 20 μL and Total volume 20 μL; the reaction conditions are: 25℃10 min, 50℃15 min, 85℃5 min and 4℃Hold; S3, PCR: Take 1uL of cDNA of the reverse transcription product of blood samples before and after transplantation for gene quantification; if the patient is a female, quantify the ABL1 and XIST genes; if the patient is a male, quantify the ABL1 and RPS4Y1 genes. The reaction system is as follows: Quantification of ABL1 gene: cDNA 1 μL, ABL1 primer mixture (2 μM) 2 μL, ABL1 probe (1 μM) 2 μL, KAPAPROBE FAST qPCR Kit Master Mix (2X) Universal 10 μL, nuclease-free Water 5 μL, and Total volume 20 μL; XIST or RPS4Y1 gene quantification: cDNA 1μL, XIST or RPS4Y1 primer mixture (2uM) 2μL, XIST or RPS4Y1 probe (1uM) 2μL, KAPA PROBE FAST qPCR Kit Master Mix (2X) Universal 10μL, nuclease-free Water 5μL and Total volume 20μL; After vortexing the prepared reaction system, place it in the 7500 fluorescence quantitative instrument, set the fluorescent group of each well to FAM, and start the program according to the following conditions: Pre-denaturation: temperature 95°C, time 3 min, cycle number 1; Denaturation: temperature 95°C, time 10s, cycle number 45; Annealing and extension: temperature 62°C, time 30S, cycle number 45; temperature 4°C, time Hold, cycle number 1; S4. Result analysis: The CT value of gene quantification was derived, and the difference in XIST gene expression before and after transplantation (△CT) was calculated to obtain the residual proportion of patient cells. The calculation formula is as follows; For female patients (males are donors in bone marrow transplantation), the chimerism ratio is calculated as follows: For male patients (females are donors in bone marrow transplantation), the chimerism ratio is calculated as follows: △Ct=Ct (移植后) -Ct (移植前) 。 4. The method for highly sensitively detecting the proportion of chimeric cells after bone marrow transplantation according to claim 3, characterized in that: In S4, the threshold value automatically calculated by the quantitative PCR instrument is used. If the baseline phase, exponential amplification phase, and plateau phase of the amplification curve obtained are not typical, the cycle number for calculating the threshold value or the threshold value is manually adjusted.

5. The method for highly sensitively detecting the proportion of chimeric cells after bone marrow transplantation according to claim 3, characterized in that: If there is a third-party donor, both donors must be of the same gender.

6. The method for highly sensitively detecting the proportion of chimeric cells after bone marrow transplantation according to claim 3, characterized in that: Real-time fluorescence quantitative analysis was performed using the probe method.

7. The method for highly sensitively detecting the proportion of chimeric cells after bone marrow transplantation according to claim 3, characterized in that: The primer and probe sequences for the XIST gene are as follows: XIST-F: TGGGATGTCAAGATACTTTCCTGGTCCCAG; XIST-R: AAGCAACTCAGCTCTCTGCACTGCTTG; Probe-XIST:CTGCCAAATCATTATACTTC.

8. The method for highly sensitively detecting the proportion of chimeric cells after bone marrow transplantation according to claim 7, characterized in that: The primer and probe sequences for the RPS4Y1 gene are as follows: RPS4Y1-F: ATCCACGATGGCAAGGTTCGAGTGGATG; RPS4Y1-R:CTCTTCCACTGTGATGCGGTG; Probe-RPS4Y1: CAGGTGAACATTTCC.

9. The method for highly sensitively detecting the proportion of chimeric cells after bone marrow transplantation according to claim 8, characterized in that: XIST-F, XIST-R and RPS4Y1-F all added 5-6 oligo sequences at the 5' end.

Images