Application of YTHDC1 gene as a detection target and application of SNP molecular marker related to single ovulation multiple birth trait of sheep

By using the YTHDC1 gene as a detection target and SNP molecular marker associated with the singleton and multiple birth traits in sheep, the challenges of detecting singleton and multiple birth traits and genetic breeding in sheep have been solved, thereby improving the reproductive capacity of sheep populations and improving breeds.

CN119570949BActive Publication Date: 2025-11-04INSTITUTE OF ANIMAL SCIENCES OF CHINESE ACADEMY OF AGRICULTURAL SCIENCES +2
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202411980737.4
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-12-31
Publication Date
2025-11-04
Estimated Expiration
2044-12-31

AI Technical Summary

Technical Problem

The lack of effective methods in the current technology for detecting and genetically breeding the trait of single birth and multiple lambing in sheep has limited the development of the meat sheep industry.

Method used

By using the YTHDC1 gene as a detection target and combining it with SNP molecular markers associated with the singleton and multiple birth traits in sheep, specific primers and kits can be designed to enable the selection, early prediction, strain identification, and genetic improvement of the singleton and multiple birth traits in sheep.

Benefits of technology

It improves the accuracy of identification and genetic improvement efficiency of the single-birth multiple-lamb trait in sheep, significantly enhances the reproductive capacity of sheep populations, and provides a reliable tool for sheep breed selection.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119570949B_ABST
    Figure CN119570949B_ABST
Patent Text Reader

Abstract

The application provides application of YTHDC1 gene as a detection target and application of a SNP molecular marker related to a single-twin multiple-lamb trait of sheep, and belongs to the technical field of molecular markers and genetic breeding. The application provides application of YTHDC1 gene as a detection target. The lambing performance of a to-be-tested sheep can be determined by rapidly typing the YTHDC1 genotype of a newborn sheep, and the breeding of a ewe is facilitated. The application also provides application of a SNP molecular marker related to a single-twin multiple-lamb trait of sheep. Based on sheep genome sequence information (Oar_v3.1), the SNP molecular marker is located at a 84064404bp site on a 6th chromosome of sheep, and A / G polymorphism exists. The SNP molecular marker is significantly related to the single-twin high-lamb-number trait of sheep, and in the production process of sheep, individuals with the GG type of the polymorphic site can be selected and bred, so that the reproductive capacity of a sheep population is improved.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of molecular markers and genetic breeding, and particularly relates to application of YTHDC1 gene as a detection target and application of a SNP molecular marker related to a single-twin multiple-lamb trait of sheep. BACKGROUND

[0002] Sheep (Ovis aries) is a mammal of the order Artiodactyla, family Bovidae and genus Ovis. Sheep meat is favored due to its unique flavor and high protein content. The production of single-lamb greatly restricts the development of the mutton sheep industry. Therefore, increasing the number of lambs per pregnancy of ewes is an important measure to improve the efficiency of mutton sheep breeding. At present, there is no related report on the application of YTHDC1 gene as a detection target in sheep molecular marker and genetic breeding. SUMMARY

[0003] The application aims to provide application of YTHDC1 gene as a detection target and application of a SNP molecular marker related to a single-twin multiple-lamb trait of sheep. The YTHDC1 gene as a detection target can be used for identification of a single-twin multiple-lamb trait of sheep.

[0004] The application provides any one of the following applications of YTHDC1 gene as a detection target:

[0005] (1) for selection of a single-twin multiple-lamb trait of sheep;

[0006] (2) for early prediction of a single-twin multiple-lamb trait of sheep individuals;

[0007] (3) for identification of a single-twin multiple-lamb trait of sheep strains;

[0008] (4) for genetic improvement of sheep breeds;

[0009] The YTHDC1 gene is located at the 84,064,253-84,064,556 site on the 6th chromosome of sheep, and the version number of the sheep genome sequence information is Oar_v3.1, and the NCBI accession number is XM_012180084.1.

[0010] The application also provides any one of the following applications of a SNP molecular marker related to a single-twin multiple-lamb trait of sheep:

[0011] (1) for selection of a single-twin multiple-lamb trait of sheep;

[0012] (2) for early prediction of a single-twin multiple-lamb trait of sheep individuals;

[0013] (3) for identification of a single-twin multiple-lamb trait of sheep strains;

[0014] (4) for genetic improvement of sheep breeds;

[0015] (5) for YTHDC1 genotyping; the YTHDC1 gene is located at the site from 84,064,253 to 84,064,556 on the 6th chromosome of sheep, and the version number of sheep genome sequence information is Oar_v3.1, NCBI Accession No: XM_012180084.1;

[0016] The nucleotide sequence of the SNP molecular marker related to the single-multiple lambing trait of sheep is shown in SEQ ID NO. 1, and there is an A / G polymorphism at position 52; the genotype of the site with the polymorphism is GG, which corresponds to the single-multiple lambing trait, and the genotype of the site with the polymorphism is AA, which corresponds to no single-multiple lambing trait.

[0017] The application also provides any of the following applications of the primer for amplifying the SNP molecular marker related to the single-multiple lambing trait of sheep:

[0018] (1) for breeding of the single-multiple lambing trait of sheep;

[0019] (2) for early prediction of a sheep individual with the single-multiple lambing trait;

[0020] (3) for identification of a sheep strain with the single-multiple lambing trait;

[0021] (4) for genetic improvement of a sheep breed;

[0022] (5) for YTHDC1 genotyping; the YTHDC1 gene is located at the site from 84,064,253 to 84,064,556 on the 6th chromosome of sheep, and the version number of sheep genome sequence information is Oar_v3.1;

[0023] The nucleotide sequence of the SNP molecular marker related to the single-multiple lambing trait of sheep is shown in SEQ ID NO. 1, and there is an A / G polymorphism at position 52; the genotype of the site with the polymorphism is GG, which corresponds to the single-multiple lambing trait, and the genotype of the site with the polymorphism is AA, which corresponds to no single-multiple lambing trait.

[0024] The application also provides any of the following applications of the reagent or kit containing the primer for amplifying the SNP molecular marker related to the single-multiple lambing trait of sheep:

[0025] (1) for breeding of the single-multiple lambing trait of sheep;

[0026] (2) for early prediction of a sheep individual with the single-multiple lambing trait;

[0027] (3) for identification of a sheep strain with the single-multiple lambing trait;

[0028] (4) for genetic improvement of sheep breeds;

[0029] (5) for YTHDC1 genotyping; the YTHDC1 gene is located at the site of 84,064,253-84,064,556 on the 6th chromosome of sheep, and the version number of sheep genome sequence information is Oar_v3.1;

[0030] The nucleotide sequence of the SNP molecular marker related to the single-multiple lambing trait of sheep is shown in SEQ ID NO. 1, and there is A / G polymorphism at position 52; the genotype of the site with the polymorphism is GG, which corresponds to the single-multiple lambing trait, and the genotype of the site with the polymorphism is AA, which corresponds to no single-multiple lambing trait.

[0031] Preferably, the SNP molecular marker related to the single-multiple lambing trait of sheep is located at the site of 84064404bp on the 6th chromosome of sheep, and the version number of sheep genome sequence information is Oar_v3.1.

[0032] Preferably, the primer comprises an upstream primer with the nucleotide sequence shown in SEQ ID NO. 2, a downstream primer with the nucleotide sequence shown in SEQ ID NO. 3, and an extension primer with the nucleotide sequence shown in SEQ ID NO. 4.

[0033] The application also provides a breeding method for the single-multiple lambing trait of sheep, comprising the following steps:

[0034] 1) detecting the SNP molecular marker related to the single-multiple lambing trait of sheep in the sheep to be tested;

[0035] 2) selecting and keeping the individual with genotype GG in step 1), and eliminating the individual with genotype GA or AA;

[0036] The nucleotide sequence of the SNP molecular marker related to the single-multiple lambing trait of sheep is shown in SEQ ID NO. 1, and there is A / G polymorphism at position 52; the genotype of the site with the polymorphism is GG, which corresponds to the single-multiple lambing trait, and the genotype of the site with the polymorphism is AA, which corresponds to no single-multiple lambing trait.

[0037] The application also provides a method for breeding a sheep strain with the single-multiple lambing trait, comprising the following steps:

[0038] 1) detecting the SNP molecular marker related to the single-multiple lambing trait of sheep in the sheep to be tested;

[0039] 2) selecting and keeping the individual with genotype GG in step 1) as a breeding ewe, and mating the breeding ewe;

[0040] 3) Detect SNP molecular markers related to the singleton and multiple birth traits in the sheep born from mating in step 2). Keep individuals with the GG genotype and cull individuals with the GA or AA genotypes. Then breed them to obtain sheep breeds with the singleton and multiple birth traits.

[0041] The nucleotide sequence of the SNP molecular marker associated with the trait of singleton and multiple births in sheep is shown in SEQ ID NO.1, and there is an A / G polymorphism at position 52; the genotype of the site with the polymorphism is GG, which corresponds to the trait of singleton and multiple births, and the genotype of the site with the polymorphism is AA, which corresponds to the absence of the trait of singleton and multiple births.

[0042] This invention also provides a method for genetic improvement of sheep, comprising the following steps:

[0043] 1) Detect SNP molecular markers associated with the singleton / multiple-lamb trait in sheep to be tested;

[0044] 2) Select individuals with the genotype GG from step 1), and eliminate individuals with the genotype GA or AA;

[0045] 3) Use individuals with the genotype GG from step 2) as breeding ewes for breeding. Continue to select sheep individuals with the genotype GG from the offspring and eliminate individuals with the genotype GA or AA. This will increase the frequency of the allele G in the offspring sheep population generation by generation, thereby increasing the proportion of single-birth multiple lambs in the offspring sheep population.

[0046] The nucleotide sequence of the SNP molecular marker associated with the trait of singleton and multiple births in sheep is shown in SEQ ID NO.1, and there is an A / G polymorphism at position 52; the genotype of the site with the polymorphism is GG, which corresponds to the trait of singleton and multiple births, and the genotype of the site with the polymorphism is AA, which corresponds to the absence of the trait of singleton and multiple births.

[0047] The present invention also provides a method for screening sheep with the trait of singleton and multiple births, comprising the following steps:

[0048] 1) Detect SNP molecular markers associated with the singleton / multiple-lamb trait in sheep to be tested;

[0049] 2) When the genotype of the SNP molecular marker detected in step 1) is GG, the sheep to be screened has the genetic trait of singleton birth with multiple lambs and is retained; when the genotype detected is GA or AA, the sheep to be screened does not have the trait of singleton birth with multiple lambs and is culled.

[0050] The nucleotide sequence of the SNP molecular marker associated with the trait of singleton and multiple births in sheep is shown in SEQ ID NO.1, and there is an A / G polymorphism at position 52; the genotype of the site with the polymorphism is GG, which corresponds to the trait of singleton and multiple births, and the genotype of the site with the polymorphism is AA, which corresponds to the absence of the trait of singleton and multiple births.

[0051] This invention provides the following applications for the YTHDC1 gene as a detection target: (1) for breeding sheep with the trait of singleton and multiple births; (2) for early prediction of sheep individuals with the trait of singleton and multiple births; (3) for identification of sheep breeds with the trait of singleton and multiple births; and (4) for genetic improvement of sheep breeds. In this invention, the YTHDC1 gene can be used as a detection target for the identification of sheep with the trait of singleton and multiple births. By rapidly typing the YTHDC1 genotype of newborn sheep, the lambing performance of the sheep to be tested can be determined, which facilitates the selection of breeding ewes.

[0052] This invention also provides any of the following applications of SNP molecular markers associated with the singleton and multiple birth trait in sheep: (1) for breeding sheep with the singleton and multiple birth trait; (2) for early prediction of sheep individuals with the singleton and multiple birth trait; (3) for identification of sheep breeds with the singleton and multiple birth trait; (4) for genetic improvement of sheep breeds; (5) for YTHDC1 genotyping; the nucleotide sequence of the SNP molecular markers associated with the singleton and multiple birth trait in sheep is shown in SEQ ID NO.1, and there is an A / G polymorphism at position 52; the genotype of the site with the polymorphism is GG, corresponding to the singleton and multiple birth trait, and the genotype of the site with the polymorphism is AA, corresponding to the absence of the singleton and multiple birth trait. The SNP molecular markers of this invention are significantly associated with the high singleton and multiple birth trait in sheep. In sheep production, individuals with the GG polymorphism can be selected to improve the reproductive capacity of the sheep population. Statistical data on the number of lambs born in triplets of Small-tailed Han sheep showed that the number of lambs born in the homozygous (GG) genotype at the aforementioned polymorphic site was significantly higher than that of the wild-type homozygous AA and heterozygous genotypes (P<0.01). This indicates that the mutation at this site increases the lambing capacity of Small-tailed Han sheep. Therefore, subsequent genotyping of individuals with the GG genotype using the aforementioned SNP molecular marker can screen for sheep carrying the multiple-lambing trait, providing a reliable tool for breeding single-lambing, multiple-lambing sheep breeds and improving the reproductive performance of the flock. Attached Figure Description

[0053] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0054] Figure 1 This is the flight mass spectrometry detection diagram of the product after amplification and extension in Example 1. Detailed Implementation

[0055] This invention provides any of the following applications of the YTHDC1 gene as a detection target:

[0056] (1) Used for breeding of the trait of single birth and multiple lambing in sheep;

[0057] (2) Used for early prediction of sheep individuals with the trait of singleton and multiple lambs;

[0058] (3) Used for the identification of sheep breeds with the trait of single birth and multiple lambing;

[0059] (4) Used for the genetic improvement of sheep breeds;

[0060] The YTHDC1 gene is located at positions 84,064,253 to 84,064,556 on sheep chromosome 6. The sheep genome sequence information version number is Oar_v3.1, and the NCBI accession number is XM_012180084.1.

[0061] This invention can determine the lambing performance of sheep by rapidly typing the YTHDC1 genotype of newborn sheep, which facilitates the selection of breeding sheep.

[0062] This invention also provides any of the following applications of SNP molecular markers associated with the trait of singleton multiple births in sheep:

[0063] (1) Used for breeding of the trait of single birth and multiple lambing in sheep;

[0064] (2) Used for early prediction of sheep individuals with the trait of singleton and multiple lambs;

[0065] (3) Used for the identification of sheep breeds with the trait of single birth and multiple lambing;

[0066] (4) Used for the genetic improvement of sheep breeds;

[0067] (5) Used for YTHDC1 genotyping; the YTHDC1 gene is located at position 84,064,253 to 84,064,556 on sheep chromosome 6, the sheep genome sequence information version number is Oar_v3.1, and the NCBI accession number is XM_012180084.1;

[0068] The nucleotide sequence of the SNP molecular marker associated with the trait of singleton and multiple births in sheep is shown in SEQ ID NO.1, and there is an A / G polymorphism at position 52; the genotype of the site with the polymorphism is GG, which corresponds to the trait of singleton and multiple births, and the genotype of the site with the polymorphism is AA, which corresponds to the absence of the trait of singleton and multiple births.

[0069] In this invention, the nucleotide sequence shown in SEQ ID NO.1 is specifically (5'~3').

[0070] GACGTTTCTCCCTTTTTTCATTTTGTAAATTACTGCTTTCTTATTCCAGG AR(A / G)ATTGAACTTGAATGTGGAACCCAGCTTTGTCTTCTATTTCCCCCTGATGAAA.

[0071] In this invention, the 52nd bit is the 52nd bit starting from the 5' end.

[0072] In the specific implementation of this invention, the SNP molecular marker associated with the trait of single birth and multiple lambs in sheep is located at the 84064404bp site on chromosome 6 of sheep, and the sheep genome sequence information version number is Oar_v3.1; the SNP molecular marker is significantly associated with the trait of high single birth and multiple lambs in sheep, and can be used for the breeding of new breeds of single birth and multiple lambs and the improvement of sheep population fertility.

[0073] This invention also provides for any of the following applications of primers for amplifying SNP molecular markers associated with the singleton-multiple lambing trait in sheep:

[0074] (1) Used for breeding of the trait of single birth and multiple lambing in sheep;

[0075] (2) Used for early prediction of sheep individuals with the trait of singleton and multiple lambs;

[0076] (3) Used for the identification of sheep breeds with the trait of single birth and multiple lambing;

[0077] (4) Used for the genetic improvement of sheep breeds;

[0078] (5) Used for YTHDC1 genotyping; the YTHDC1 gene is located at position 84,064,253 to 84,064,556 on sheep chromosome 6 (NC_019463.1), and the sheep genome sequence information version number is Oar_v3.1;

[0079] The nucleotide sequence of the SNP molecular marker associated with the trait of singleton and multiple births in sheep is shown in SEQ ID NO.1, and there is an A / G polymorphism at position 52; the genotype of the site with the polymorphism is GG, which corresponds to the trait of singleton and multiple births, and the genotype of the site with the polymorphism is AA, which corresponds to the absence of the trait of singleton and multiple births.

[0080] In this invention, the primers are based on Sequenom. Primers for SNP technology to amplify SNP molecular markers associated with the trait of singleton and multiple births in sheep.

[0081] In the specific implementation of this invention, the primers include an upstream primer (F) of the nucleotide sequence shown in SEQ ID NO.2, a downstream primer (R) of the nucleotide sequence shown in SEQ ID NO.3, and an extension primer (E) of the nucleotide sequence shown in SEQ ID NO.4. The primers provided by this invention for amplifying SNP molecular markers associated with the trait of singleton and multiple lambing in sheep have high detection sensitivity, accuracy, stability, and cost-effectiveness. They enable automated detection of the SNP molecular markers, allowing simultaneous detection of dozens to hundreds of SNP sites in hundreds to thousands of samples, making the operation more convenient and the detection results more reliable.

[0082] In the specific implementation of this invention, the primers were synthesized by Beijing Compson Biotechnology Co., Ltd.

[0083] This invention also provides any of the following applications of reagents or kits containing primers for amplifying SNP molecular markers associated with the trait of singleton-multiple lambing in sheep:

[0084] (1) Used for breeding of the trait of single birth and multiple lambing in sheep;

[0085] (2) Used for early prediction of sheep individuals with the trait of singleton and multiple lambs;

[0086] (3) Used for the identification of sheep breeds with the trait of single birth and multiple lambing;

[0087] (4) Used for the genetic improvement of sheep breeds;

[0088] (5) Used for YTHDC1 genotyping; the YTHDC1 gene is located at position 84,064,253 to 84,064,556 on sheep chromosome 6, and the sheep genome sequence information version number is Oar_v3.1;

[0089] The nucleotide sequence of the SNP molecular marker associated with the trait of singleton and multiple births in sheep is shown in SEQ ID NO.1, and there is an A / G polymorphism at position 52; the genotype of the site with the polymorphism is GG, which corresponds to the trait of singleton and multiple births, and the genotype of the site with the polymorphism is AA, which corresponds to the absence of the trait of singleton and multiple births.

[0090] In the specific implementation of this invention, the reagents or kits further include dNTPs, Taq DNA polymerase, and Mg. 2+ PCR reaction buffer, SAP enzyme, and SNP molecular marker standard positive template.

[0091] This invention also provides a method for breeding sheep with the trait of single birth and multiple lambing, comprising the following steps:

[0092] 1) Detect SNP molecular markers associated with the singleton / multiple-lamb trait in sheep to be tested;

[0093] 2) Select individuals with the genotype GG from step 1), and eliminate individuals with the genotype GA or AA;

[0094] The nucleotide sequence of the SNP molecular marker associated with the trait of singleton and multiple births in sheep is shown in SEQ ID NO.1, and there is an A / G polymorphism at position 52; the genotype of the site with the polymorphism is GG, which corresponds to the trait of singleton and multiple births, and the genotype of the site with the polymorphism is AA, which corresponds to the absence of the trait of singleton and multiple births.

[0095] In sheep production, this invention allows for the selection and retention of individuals with the GG genotype at the polymorphic locus, thereby improving the reproductive capacity of the sheep population.

[0096] This invention also provides a method for breeding sheep breeds with the trait of singletons and multiple lambs, comprising the following steps:

[0097] 1) Detect SNP molecular markers associated with the singleton / multiple-lamb trait in sheep to be tested;

[0098] 2) Select individuals with genotype GG from step 1) and use them as breeding ewes;

[0099] 3) Detect SNP molecular markers related to the singleton and multiple birth traits in the sheep born from mating in step 2). Keep individuals with the GG genotype and cull individuals with the GA or AA genotypes. Then breed them to obtain sheep breeds with the singleton and multiple birth traits.

[0100] The nucleotide sequence of the SNP molecular marker associated with the trait of singleton and multiple births in sheep is shown in SEQ ID NO.1, and there is an A / G polymorphism at position 52; the genotype of the site with the polymorphism is GG, which corresponds to the trait of singleton and multiple births, and the genotype of the site with the polymorphism is AA, which corresponds to the absence of the trait of singleton and multiple births.

[0101] This invention also provides a method for genetic improvement of sheep, comprising the following steps:

[0102] 1) Detect SNP molecular markers associated with the singleton / multiple-lamb trait in sheep to be tested;

[0103] 2) Select individuals with the genotype GG from step 1), and eliminate individuals with the genotype GA or AA;

[0104] 3) Use individuals with the genotype GG from step 2) as breeding ewes for breeding. Continue to select sheep individuals with the genotype GG from the offspring and eliminate individuals with the genotype GA or AA. This will increase the frequency of the allele G in the offspring sheep population generation by generation, thereby increasing the proportion of single-birth multiple lambs in the offspring sheep population.

[0105] The nucleotide sequence of the SNP molecular marker associated with the trait of singleton and multiple births in sheep is shown in SEQ ID NO.1, and there is an A / G polymorphism at position 52; the genotype of the site with the polymorphism is GG, which corresponds to the trait of singleton and multiple births, and the genotype of the site with the polymorphism is AA, which corresponds to the absence of the trait of singleton and multiple births.

[0106] The present invention also provides a method for screening sheep with the trait of singleton and multiple births, comprising the following steps:

[0107] 1) Detect SNP molecular markers associated with the singleton / multiple-lamb trait in sheep to be tested;

[0108] 2) When the genotype of the SNP molecular marker detected in step 1) is GG, the sheep to be screened has the genetic trait of singleton birth with multiple lambs and is retained; when the genotype detected is GA or AA, the sheep to be screened does not have the trait of singleton birth with multiple lambs and is culled.

[0109] The nucleotide sequence of the SNP molecular marker associated with the trait of singleton and multiple births in sheep is shown in SEQ ID NO.1, and there is an A / G polymorphism at position 52; the genotype of the site with the polymorphism is GG, which corresponds to the trait of singleton and multiple births, and the genotype of the site with the polymorphism is AA, which corresponds to the absence of the trait of singleton and multiple births.

[0110] In the specific implementation of this invention, the detection of SNP molecular markers related to the trait of singleton or multiple births in sheep includes the following steps:

[0111] Genomic DNA was extracted from the sheep to be tested. Using the genomic DNA as a template, PCR was performed using the upstream and downstream primers described in the above-described primer scheme to obtain PCR products. The PCR products were digested with SAP enzyme to obtain digestion products. Using the digestion products as a template, an extension reaction was performed using the extension primers described in the above-described primer scheme to obtain extension products. The extension products were analyzed using matrix-assisted laser desorption / ionization time-of-flight mass spectrometry to determine the genotypes of SNP molecular markers associated with the singleton-multiple-lambing trait in sheep.

[0112] This invention does not impose any special restrictions on the method for extracting genomic DNA from sheep to be tested. In the specific implementation of this invention, the phenol-chloroform method is used to extract genomic DNA.

[0113] In the specific implementation of this invention, the PCR reaction system is 5 μL, including 1 μL of genomic DNA with a concentration of 10 ng / μL, 0.5 μL of 10× PCR reaction buffer, 0.4 μL of 25 mmol / L MgCl2 solution, 0.1 μL of 25 μmol / L dNTPs, 0.2 μL of 5 U / μL Taq DNA polymerase, 0.5 μL each of 10 pmol / L upstream and downstream primers, and 1.8 μL of deionized water; the PCR reaction program is as follows: pre-denaturation at 95℃ for 2 min; 95℃ for 20 s, annealing at 58℃ for 30 s, extension at 72℃ for 60 s, 40 cycles; and extension at 72℃ for 5 min.

[0114] In the specific implementation of this invention, the reaction system of the extension reaction is 2 μL, including 0.2 μL of 10×iplexBufferPlus, 0.2 μL of iplex Terminator, 0.94 μL of 0.6~1.3 μmol / L primermix, and 0.041 μL of iplexEnzyme; the reaction program of the extension reaction is: 95℃, 30s; 95℃, 5s, (52℃, 5s, 80℃, 5s, 5 cycles), 40 cycles; 72℃, 3min.

[0115] In the specific implementation of this invention, the breed of sheep is the Small-tailed Han sheep.

[0116] The above-mentioned scheme in this invention can achieve automated detection of the SNP loci. In sheep breeding and practical production, GG homozygous individuals can be selected and retained, thereby improving the fertility of sheep and having potential application value for large-scale molecular breeding of sheep.

[0117] To further illustrate the present invention, the application of the YTHDC1 gene as a detection target and the application of SNP molecular markers related to the singleton-multiple-lambing trait in sheep are described in detail below with reference to the accompanying drawings and embodiments. However, these descriptions should not be construed as limiting the scope of protection of the present invention.

[0118] Example 1

[0119] A method using Sequenom A method for detecting the YTHDC1 genotype in sheep and predicting the average number of lambs per litter in ewes using SNP technology.

[0120] 1. Experimental materials

[0121] The study used 380 small-tailed Han sheep with lambing records as the subjects of the test.

[0122] 2. Reagents and Instruments

[0123] Reagents: 10×PCR reaction buffer, 25 mmol / L MgCl2 solution, 25 μmol / L dNTPs, 5 U / μL Taq DNA polymerase, amplification primers F and R, 10× iplex Buffer Plus, iplex Terminator, 1 μmol / L primer mix, iplex Enzyme, deionized water, etc.

[0124] Gene amplification: ABI 9700384Dual;

[0125] Mass spectrometry spotting: MassARRAY Nanodispenser RS1000;

[0126] Mass spectrometry analysis: MassARRAY Compact System;

[0127] All reagents and instruments were purchased from Beijing Compass Biotechnology Co., Ltd.

[0128] 3. Extraction of genomic DNA

[0129] Take 1 mL of sheep blood treated with EDTA-K2 anticoagulant, lyse and remove red blood cells using red blood cell lysis buffer, then lyse other cells using lysis buffer to release genomic DNA, and then extract genomic DNA using the phenol-chloroform method.

[0130] 4. Use Sequenom SNP technology for genotyping

[0131] Primer combinations were designed targeting the 84064404bp site on sheep chromosome 6 (YTHDC1,NC_019463.1: 84,064,253~84,064,556) based on the sheep genome sequence information version number Oar_v3.1 (August 2012).

[0132] The nucleotide sequences of the PCR amplification primers are as follows:

[0133] SEQ ID NO.2(F): ACGTTGGATGGTCTATCAGACGTTTCTCCC;

[0134] SEQ ID NO.3(R): ACGTTGGATGAGCTGGGTTCCACATTCAAG;

[0135] SEQ ID NO. 4(E): TTCCAATTCAAGTTCAAT.

[0136] The primers mentioned above were synthesized by Beijing Compson Biotechnology Co., Ltd.

[0137] The testing process is as follows:

[0138] 1. Extract genomic DNA from the sheep to be tested;

[0139] 2. Using the genomic DNA of the sheep to be tested as a template, PCR amplification was performed using the primers F and R mentioned above;

[0140] 3. Digest the PCR amplification products with SAP enzyme;

[0141] 4. Using the digested PCR amplification product as a template, perform an extension reaction using the aforementioned extension primer E;

[0142] 5. Analyze the extended products to determine the sheep ESR1 genotype.

[0143] The PCR amplification reaction system used was as follows (5 μL): 10 ng / μL genomic DNA 1 μL, 10× PCR reaction buffer 0.5 μL, 25 mmol / L MgCl2 0.4 μL, 25 μmol / L dNTPs 0.1 μL, 0.5 μmol / L PCR primer mixture 1 μL (of which primers F and R are each 0.5 μL, and the concentrations of primers F and R are 10 pmol / L), 5 U / μL Taq DNA polymerase 0.2 μL, and deionized water 1.8 μL;

[0144] The PCR amplification program was as follows: 95℃ for 2 min; 95℃ for 20 s, 56℃ for 30 s, 72℃ for 60 s, 40 cycles; 72℃ for 5 min; and stored at 4℃.

[0145] The PCR amplification products were digested using the following SAP enzyme digestion system (2 μL): 0.17 μL of 10×SAPBuffer, 0.3 μL of 1.7 U / μL SAP Enzyme, and 1.53 μL of deionized water.

[0146] The reaction conditions were: 37℃ for 40 min, 85℃ for 5 min, and stored at 4℃.

[0147] The extended reaction system consisted of (2 μL): 0.2 μL of 10×iplex Buffer Plus, 0.2 μL of iplex Terminator, 0.94 μL of 0.6–1.3 μmol / L primer mix, and 0.041 μL of iplex Enzyme.

[0148] The reaction conditions were: 95℃ for 30s; [95℃ for 5s, (52℃ for 5s, 80℃ for 5s, 5 cycles), 40 cycles]; 72℃ for 3min; stored at 4℃.

[0149] The resin-purified extension products were transferred to a 384-well Spectro CHIP (Sequenom) chip for MALDI-TOF-MS (matrix-assisted laser desorption / ionization time-of-flight mass spectrometry) reaction. The mass spectral peaks were detected using Typer 4.0 software, and the genotype of each target site was determined based on the mass spectral peak diagram.

[0150] Mass spectrometry analysis revealed that the PCR amplification product was 106 bp in size. The mass spectrometry results of the extension product are as follows: Figure 1 As shown.

[0151] Statistical results:

[0152] The statistical results of the analysis of different genotypes at the 84064404bp locus on chromosome 6 of the sheep to be tested, and the association analysis between different genotypes and the number of lambs born in small-tailed Han sheep are shown in Table 1.

[0153] Table 1. Association analysis between different genotypes at locus 84064404bp on sheep chromosome 6 and lambing number in Small-tailed Han sheep.

[0154]

[0155] Note: Different lowercase letters in the same column's header indicate highly significant differences (P < 0.01).

[0156] Therefore, it can be seen that the lambing performance of the sheep to be tested can be determined by typing the locus at 84064404bp on chromosome 6 of sheep provided by the present invention. In practice, GG homozygous individuals can be selected and retained, which can significantly improve the fertility of sheep and has potential application value for large-scale molecular breeding of sheep and large-scale production of meat sheep.

[0157] As can be seen from the above embodiments, the present invention provides an SNP molecular marker related to the trait of singleton and multiple lambing in sheep and its detection kit application, and specifically provides a method using Sequenom. The method for detecting the genotype of SNP loci in sheep using SNP technology has the advantages of higher sensitivity and accuracy.

[0158] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. Any of the following applications of SNP molecular markers associated with the trait of singleton multiple births in sheep: (1) Used for breeding of the trait of single birth and multiple lambing in sheep; (2) Used for early prediction of sheep individuals with the trait of singletons and multiple births; (3) Used for the identification of sheep breeds with the trait of single birth and multiple lambing; in, The nucleotide sequence of the SNP molecular marker associated with the singleton-multiple birth trait in sheep is shown in SEQ ID NO.1, and an A / G polymorphism exists at position 52; the genotype of the site with the polymorphism is GG, corresponding to the singleton-multiple birth trait, and the genotype of the site with the polymorphism is AA, corresponding to the absence of the singleton-multiple birth trait. The breed of sheep in question is the Small-tailed Han sheep.

2. Any of the following applications of primers used to amplify SNP molecular markers associated with the trait of singleton-multiple lambing in sheep: (1) Used for breeding of the trait of single birth and multiple lambing in sheep; (2) Used for early prediction of sheep individuals with the trait of singletons and multiple lambs; (3) Used for the identification of sheep breeds with the trait of single birth and multiple lambing; in, The nucleotide sequence of the SNP molecular marker associated with the singleton-multiple birth trait in sheep is shown in SEQ ID NO.1, and an A / G polymorphism exists at position 52; the genotype of the site with the polymorphism is GG, corresponding to the singleton-multiple birth trait, and the genotype of the site with the polymorphism is AA, corresponding to the absence of the singleton-multiple birth trait. The breed of sheep in question is the Small-tailed Han sheep.

3. Any of the following applications of reagents or kits containing primers for amplifying SNP molecular markers associated with the trait of singleton-multiple lambing in sheep: (1) Used for breeding of the trait of single birth and multiple lambing in sheep; (2) Used for early prediction of sheep individuals with the trait of singletons and multiple births; (3) Used for the identification of sheep breeds with the trait of single birth and multiple lambing; in, The nucleotide sequence of the SNP molecular marker associated with the singleton-multiple birth trait in sheep is shown in SEQ ID NO.1, and an A / G polymorphism exists at position 52; the genotype of the site with the polymorphism is GG, corresponding to the singleton-multiple birth trait, and the genotype of the site with the polymorphism is AA, corresponding to the absence of the singleton-multiple birth trait. The breed of sheep in question is the Small-tailed Han sheep.

4. The application according to any one of claims 1 to 3, characterized in that, The SNP molecular marker associated with the singleton-multiple-lambing trait in sheep is located at position 84064404 bp on sheep chromosome 6, and the sheep genome sequence information version number is Oar_v3.

1.

5. The application according to claim 2 or 3, characterized in that, The primers consist of an upstream primer, a downstream primer, and an extension primer; the nucleotide sequence of the upstream primer is shown in SEQ ID NO.2; the nucleotide sequence of the downstream primer is shown in SEQ ID NO.3; and the nucleotide sequence of the extension primer is shown in SEQ ID NO.

4.

6. A method for breeding sheep with the trait of single birth and multiple lambing, characterized in that, Includes the following steps: 1) Detect SNP molecular markers associated with the singleton / multiple-lambing trait in sheep to be tested; 2) Select individuals with the genotype GG from step 1), and eliminate individuals with the genotype GA or AA; The nucleotide sequence of the SNP molecular marker associated with the trait of singleton and multiple births in sheep is shown in SEQ ID NO.1, and there is an A / G polymorphism at position 52; the genotype of the site with the polymorphism is GG, which corresponds to the trait of singleton and multiple births, and the genotype of the site with the polymorphism is AA, which corresponds to the absence of the trait of singleton and multiple births. The breed of sheep in question is the Small-tailed Han sheep.

7. A method for breeding sheep breeds with the trait of singleton birth and multiple lambing, characterized in that, Includes the following steps: 1) Detect SNP molecular markers associated with the singleton / multiple-lambing trait in sheep to be tested; 2) Select individuals with genotype GG from step 1) and use them as breeding ewes; 3) Detect SNP molecular markers related to the singleton multiple birth trait in sheep born from mating in step 2). Keep individuals with the GG genotype and cull individuals with the GA or AA genotypes. Then breed them to obtain sheep breeds with the singleton multiple birth trait. The nucleotide sequence of the SNP molecular marker associated with the trait of singleton and multiple births in sheep is shown in SEQ ID NO.1, and there is an A / G polymorphism at position 52; the genotype of the site with the polymorphism is GG, which corresponds to the trait of singleton and multiple births, and the genotype of the site with the polymorphism is AA, which corresponds to the absence of the trait of singleton and multiple births. The breed of sheep in question is the Small-tailed Han sheep.

8. A method for genetic improvement of sheep, characterized in that, Includes the following steps: 1) Detect SNP molecular markers associated with the singleton / multiple-lambing trait in sheep to be tested; 2) Select individuals with the genotype GG from step 1), and eliminate individuals with the genotype GA or AA; 3) Use individuals with genotype GG from step 2) as breeding ewes for breeding. Continue to select sheep individuals with genotype GG from the offspring and eliminate individuals with genotype GA or AA. This will increase the frequency of allele G in the offspring sheep population generation by generation, thereby increasing the proportion of single-birth multiple lambs in the offspring sheep population. The nucleotide sequence of the SNP molecular marker associated with the trait of singleton and multiple births in sheep is shown in SEQ ID NO.1, and there is an A / G polymorphism at position 52; the genotype of the site with the polymorphism is GG, which corresponds to the trait of singleton and multiple births, and the genotype of the site with the polymorphism is AA, which corresponds to the absence of the trait of singleton and multiple births. The breed of sheep in question is the Small-tailed Han sheep.

9. A method for screening sheep with the trait of singleton multiple births, characterized in that, Includes the following steps: 1) Detect SNP molecular markers associated with the singleton / multiple-lambing trait in sheep to be tested; 2) When the genotype of the SNP molecular marker detected in step 1) is GG, the sheep to be screened has the genetic trait of singleton birth with multiple lambs and should be retained; when the genotype detected is GA or AA, the sheep to be screened does not have the trait of singleton birth with multiple lambs and should be culled. The nucleotide sequence of the SNP molecular marker associated with the trait of singleton and multiple births in sheep is shown in SEQ ID NO.1, and there is an A / G polymorphism at position 52; the genotype of the site with the polymorphism is GG, which corresponds to the trait of singleton and multiple births, and the genotype of the site with the polymorphism is AA, which corresponds to the absence of the trait of singleton and multiple births. The breed of sheep in question is the Small-tailed Han sheep.