SNP (Single Nucleotide Polymorphism) molecular marker related to 12-week-old weight of chicken and application of SNP molecular marker

Abstract

The invention discloses an SNP (Single Nucleotide Polymorphism) molecular marker related to the weight of a chicken at the age of 12 weeks and application of the SNP molecular marker. SNP loci in a genome are nucleotides at the 26th site, the 907th site and the 478th site of a chromosome 5 and are located on 3 'UTR of an RGS6 gene. A GWAS result shows that the SNP site presents G / C polymorphism, and G has a positive effect on the body weight of 12 weeks old. For the site, genotype statistical analysis is carried out in other high-weight and low-weight groups to further verify that the dominant genotype of the GG genotype in high-weight chickens, and the proportion of the GG genotype in the high-weight chickens is obviously higher than that of the low-weight chickens. Therefore, the chicken of which the site is GG genotype can be preferably selected, and early selection of high-weight chickens is expected to be carried out, so that genetic breeding of the chickens is accelerated.

Description

Technical Field

[0001] The invention belongs to the field of molecular biology, and in particular relates to a SNP molecular marker associated with the weight of a chicken at 12 weeks of age and an application thereof. Background Art

[0002] Broiler farming is the most scaled, best managed and most well-developed industry in animal husbandry. Corresponding to it are breeding chickens, animal husbandry equipment, feed processing, veterinary drugs, vaccines, animal health, slaughtering and food processing. In recent years, the scale of broiler farming has continued to expand. Large-scale breeding companies and small farmers coexist, but large-scale and intensive breeding has become the mainstream. In order to improve efficiency and reduce costs, breeding companies generally adopt advanced breeding technologies and management models, which has enabled the scale of breeding to continue to grow.

[0003] In the field of broiler farming, technological progress and innovation are important driving forces for the development of the industry. Modern breeding equipment, intelligent management systems, and the application of biotechnology are constantly improving the efficiency and quality of broiler farming. At the same time, with the increase in scientific research investment, the application of new varieties and new technologies is also constantly emerging, providing strong support for the sustainable development of the broiler farming industry.

[0004] With the rapid growth of demand, increasing production and improving quality have become the key directions in the breeding field. The traditional breeding method of selecting chicken varieties with excellent traits is labor-intensive, cumbersome and inefficient. With the advancement of genomic research and the development of genetic marker technology, breeding scientists can select genotypes with excellent traits for breeding, thereby promoting further improvement in chicken production and quality.

[0005] SNP (single nucleotide polymorphism) is an important form of genetic variation, which is characterized by abundant quantity, wide distribution and high stability. It is widely used in molecular breeding and genetic research. However, in the molecular breeding practice of broiler chickens, markers that can clearly define functions and significantly affect traits are still scarce. Therefore, in-depth exploration of molecular markers with strong effects and high applicability has become a current research hotspot.

[0006] The weekly weight of chickens is a core trait. By discovering SNP molecular markers that are significantly correlated with the weekly weight of chickens and selecting chicken breeds with fast growth and large weight through molecular markers, the production efficiency of the group can be significantly improved. Summary of the invention

[0007] The technical problem to be solved by the present invention is to provide a SNP molecular marker related to chicken body weight traits and its application.

[0008] The technical solution of the present invention is: a method for breeding chickens with high weight traits, extracting genomic DNA from chicken samples, detecting the genotype at position 26,907,478 of chromosome 5 of the chicken samples, and selecting individuals with a genotype of GG at the site as having a higher weight trait than other genotypes, and the reference genome version is GRCg6a.

[0009] The invention discloses an application of a material for detecting SNP site polymorphism or genotype in auxiliary breeding of chicken weight traits. The SNP site is located at position 26,907,478 of chromosome 5 of chicken and has G / C polymorphism. Individuals with a genotype of GG at this site have a higher weight trait than those with other genotypes. The reference genome version is GRCg6a.

[0010] Furthermore, the substance is a primer pair, and the nucleotide sequences of the primer pair are shown as SEQ ID No.1 and SEQ ID No.2.

[0011] The invention discloses an application of a substance for detecting polymorphism or genotype of a SNP site in preparing a chicken weight trait assisted breeding kit, wherein the SNP site is located at the 498th position of the nucleotide sequence shown in SEQ ID No.3.

[0012] Furthermore, the substance is a primer pair, and the nucleotide sequences of the primer pair are shown as SEQ ID No.1 and SEQ ID No.2.

[0013] A kit comprises a primer pair as shown in SEQ ID No.1 and SEQ ID No.2.

[0014] Compared with the prior art, the present invention has the following beneficial effects:

[0015] The SNP molecular marker of the present invention is significantly correlated with the weight of chickens at 12 weeks of age, the GG genotype is the dominant genotype in high-weight chickens, and the proportion of the GG genotype in high-weight chickens is significantly higher than that in low-weight chickens. Therefore, chickens with the GG genotype at this site can be preferred, and it is expected that early selection of high-weight chickens can be carried out, thereby accelerating the genetic breeding of chickens. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 Association of chromosome 5 SNP with body weight of chickens at 12 weeks of age;

[0017] Figure 2 Genotype distribution of high and low body weight chickens. DETAILED DESCRIPTION

[0018] The experimental methods in the following examples are conventional methods unless otherwise specified. The experimental materials used in the following examples are purchased from commercial channels unless otherwise specified.

[0019] Example 1 Mining of SNP Molecular Markers

[0020] The resequencing technology was used to sequence the individuals of the hybrid population of chickens, and the identified SNPs were quality-controlled and filtered, from which a SNP site significantly associated with the weight of chickens at 12 weeks of age was selected ( Figure 1 ).

[0021] The SNP is located at position 26,907,478 on chromosome 5 of the genome version GRCg6a (https: / / ftp.ensembl.org / pub / release-106 / fasta / gallus_gallus / dna / Gallus_gallus.GRCg6a.dna.chromosome.1.fa.gz) (SNP name is rs315692422). This site was observed in 1073 chickens and passed the quality filter. Its effect and significant P value are shown in Table 1. The C allele is strongly negatively correlated with body weight (BETA = -40.1152), so the G allele is dominant in high-weight chickens.

[0022] Table 1 Allele frequencies and effect sizes

[0023]

[0024] According to the chicken gene annotation, the site was found to be located on the 3'UTR of the chicken RGS6 gene. This site may affect the expression and function of the gene by affecting the activity of the 3'UTR.

[0025] Example 2 Validation of SNP Molecular Markers

[0026] 1. Experimental Materials

[0027] Low-weight chicken breeds: Daweishan small chicken (n=8), Jiangxi silk-feather chicken (n=20), Tibetan chicken (n=1), Tibetan chicken (Aba, n=5), Tibetan chicken (Haiyan, n=6), Tibetan chicken (Lhasa, n=26), Tibetan chicken (Shigatse, n=36), Tibetan chicken (Shannan, n=27).

[0028] High-weight chicken breeds: Luxi fighting chicken (n=9), Nanjiang fighting chicken (n=8), Cornish chicken (n=1), Langshan chicken (n=9), White Plymouth chicken (n=1), Guangxi chicken (n=6), Miyi chicken (n=5), Yuanbao chicken (n=24).

[0029] 2. Test methods

[0030] The genotype data of 928 chickens were downloaded from Galbase (http: / / animal.omics.pro / code / index.php / ChickenVar). The genotypes of the rs315692422 locus in 63 high-weight chicken breeds and 129 low-weight chicken breeds were extracted using a self-written script, and the genotype distribution of each chicken breed was statistically analyzed (Table 2).

[0031] Table 2 Genotype distribution of each chicken breed

[0032]

[0033] 3. Results Analysis

[0034] The frequency of the allele G of chr5:26,907,478 in high-weight chickens is 0.81, which is 1.49 times that of low-weight chickens, and the P value is 0.00065. Therefore, the G genotype is the dominant genotype for high-weight chickens. Genotype analysis found that the proportion of the GG genotype in high-weight chickens was 0.68, and the proportion of the GG genotype in low-weight chickens was 0.38. The GG genotype of high-weight chickens is significantly higher than that of low-weight chickens, with a P value of 0.00011. Therefore, by comparing the SNP frequency and genotype distribution of groups of higher-weight and low-weight chickens, the SNP molecular marker was confirmed. By selecting individuals with the GG allele at this site, the weight of the breeding population can be increased.

[0035] Example 3 Detection of SNP Molecular Markers

[0036] (1) Based on the upstream and downstream sequence information of the SNP molecular marker, primers were designed to amplify the fragment containing the SNP site; forward primer F: CTTATTACTAGCACACCTTGTGTTG (SEQ ID No. 1)

[0037] Reverse primer R: TTCTCTGAGACAAACATCATGAGAG (SEQ ID No. 2)

[0038] (2) The genomic DNA of the chicken sample to be tested was extracted as a template, and PCR amplification was performed using the primer pair designed in (1) to obtain an amplification product of 869 bp in size containing the SNP site, the sequence of which is shown in SEQ ID No. 3. The SNP site is located at position 498 of the sequence shown in SEQ ID No. 3.

[0039] (3) The amplified product is subjected to Sanger sequencing to obtain the genotype of the SNP site.

Claims

1. A method for breeding high-weight chickens, characterized in that: The genomic DNA of the chicken samples was extracted, and the genotype of position 26,907,478 of chromosome 5 of the chicken samples was tested. The individuals with the genotype of GG at this site were selected to have a higher body weight trait than other genotypes. The reference genome version was GRCg6a.

2. Application of materials for detecting SNP site polymorphism or genotype in auxiliary breeding of chicken weight traits, wherein the SNP site is located at position 26,907,478 of chromosome 5 of chicken and has G / C polymorphism. Individuals with the genotype GG at this site have a higher weight trait than those with other genotypes, and the reference genome version is GRCg6a.

3. The use according to claim 2, characterized in that: The substance is a primer pair, and the nucleotide sequences of the primer pair are shown as SEQ ID No.1 and SEQ ID No.

2.

4. Use of a substance for detecting SNP site polymorphism or genotype in the preparation of a chicken weight trait assisted breeding kit, wherein the SNP site is located at position 498 of the nucleotide sequence shown in SEQ ID No.

3.

5. The use according to claim 4, characterized in that: The substance is a primer pair, and the nucleotide sequences of the primer pair are shown as SEQ ID No.1 and SEQ ID No.

2.

6. A kit comprising the primer pair shown as SEQ ID No.1 and SEQ ID No.2.

Images