Application of SNP molecular markers in identifying dairy cows with high lactoferrin content in milk

Abstract

The present invention discloses the application of SNP molecular markers in identifying dairy cows with high lactoferrin content in milk, wherein the SNP molecular markers are located at the 223rd and 483rd positions of the nucleotide sequence of the dairy cow LTF gene as shown in SEQ ID NO.1, wherein the 223rd position polymorphism is C or T, and the 483rd position polymorphism is C or T. The above two SNP molecular markers can significantly affect the lactoferrin promoter activity, thereby affecting the lactoferrin expression amount, and the genetic traits are stable, and the final changes in the lactoferrin content in the milk produced by the dairy cow after future development and maturity can be more accurately judged, and high-quality genotype dairy cow individuals can be screened at an early stage, greatly reducing the screening cost and improving the breeding efficiency.

Description

Technical Field

[0001] The invention relates to the fields of dairy cow molecular biology and animal genetic breeding, and in particular to the application of SNP molecular markers in identifying dairy cows with high lactoferrin content in milk. Background Art

[0002] Lactoferrin (LTF), as an important multifunctional glycoprotein, plays an important role in the immune defense, anti-oxidative stress, growth and development, and milk quality of dairy cows. In terms of immune defense, LTF can regulate the immune system through multiple pathways, such as promoting the proliferation and differentiation of immune cells, enhancing the phagocytic activity of macrophages and neutrophils, etc. It can regulate the expression of immune-related genes in the mammary epithelial cells of dairy cows, thereby enhancing the resistance of the mammary gland to pathogens. By binding to iron ions, it limits the acquisition of iron by bacteria, thereby inhibiting bacterial growth. It can also directly act on the bacterial cell membrane, destroy the integrity of the membrane, and cause bacterial death. In terms of anti-oxidative stress, LTF can remove excessive free radicals in the body and reduce oxidative damage; under heat stress conditions, supplementation of LTF can reduce the level of oxidative stress indicators in the blood of dairy cows and improve the production performance and health of dairy cows.

[0003] In recent years, research on SNPs of the lactoferrin gene in dairy cows has made significant progress. These studies have mainly focused on the association between SNPs of the lactoferrin gene and susceptibility to mastitis in dairy cows. However, there are fewer studies on dairy cow breeding and increasing the lactoferrin content in milk, making it more difficult to implement artificial intervention in improving the nutritional value and health functions of milk. Summary of the invention

[0004] The purpose of the present invention is to provide two SNP sites significantly associated with the lactoferrin content in milk produced by dairy cows, whose polymorphism significantly affects the activity of the lactoferrin promoter and further affects the expression of lactoferrin, and can be used as molecular markers to identify high-quality dairy cows and assist genetic breeding.

[0005] The technical solution of the present invention is described in detail as follows:

[0006] In the first aspect, the present invention provides the use of SNP molecular markers in identifying cows with high lactoferrin content in milk, wherein the SNP molecular markers are located at positions 223 and 483 of the nucleotide sequence of the cow LTF gene as shown in SEQ ID NO.1, wherein the polymorphism at position 223 is C or T, and the polymorphism at position 483 is C or T.

[0007] The partial fragment of the dairy cow LTF gene containing the above two SNP molecular markers is shown below, and the bases at the underlined positions are the 223rd and 483rd SNP molecular markers.

[0008] CATGTCTAACTCTCTGCAATCCCATGGACTGCAGCATGCCAGGCATCCCCTGTCCTTTGGTATCTCCCGGAGTTGGCCCAAACTCATGTCCATTGAGTCGGTGATGCCATCCAACCATCTCATCCTCCCCAGGGCTGTGGATTATTTCTCTCTTCTCTAAGGCAGGACTGGACCTGGCCAGGACCACCAGCTCACGACTACCCTTCCTTCTGCTCCCTGACC C GTGGCCTGCTGGGCCCATAGCACAGGGTCGGGGCCACCTAGGAGAGGCCGGAGGGGCAGGAAGCCTTGCTTTCTTAGAAGTGGTCATGGGCTGTGGTCTGGGATCTGGCTCAGAGTTGCATCACTGGGT TCCATTCTCACTTGAATCTTTGGTTGTCTTGACCCCCACTGAGGTCTGCAGTTTAAATCCTGCTGTCCATGGGATGGTGGCCAACGTCCCAAAGTATCACTGAATCCCTTGTCCTACCCAGTGGAAGGAC C GGCCACTGGCCTAGGGGGTCCTGCCCTGCTCCCCATGGGTGTCGTGGCAGGAAGAGGCTGGGTGGGCCGAGAAGAGTAACTCCACCCCAGCCCCTGCCTTTGAGAGACGGGCACTGTGTGTCCACACAGAAGGAATCTGAGCACATGTCCTTTCAGGAGGG (SEQ ID NO. 1).

[0009] In a second aspect, the present invention provides a method for identifying a cow with high lactoferrin content. The cow genomic DNA is extracted as a template, and PCR amplification is performed using a forward primer with a nucleotide sequence as shown in SEQ ID NO.2 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO.3. If the polymorphism at position 223 and the polymorphism at position 483 in the amplified product are C and C, the cow is a cow with high lactoferrin content.

[0010] Forward primer: 5'CCCCTGTCCTTTGGTATCTCCC3' (SEQ ID NO. 2),

[0011] Reverse primer: 5'CACACAGTGCCCGTCTCTCAAA3' (SEQ ID NO. 3).

[0012] Optionally or preferably, in the above method, the PCR amplification conditions are:

[0013] 94℃ 7min;

[0014] 94°C for 30 s, 60°C for 30 s, 72°C for 1 min, 35 cycles;

[0015] 72℃ 8min.

[0016] In a third aspect, the present invention provides the use of a reagent for detecting SNP molecular markers in identifying cows with high lactoferrin content in milk, wherein the SNP molecular markers are located at positions 223 and 483 of the nucleotide sequence of the cow LTF gene as shown in SEQ ID NO.1, wherein the polymorphism at position 223 is C or T, and the polymorphism at position 483 is C or T.

[0017] Optionally or preferably, in the above application, the reagent includes a forward primer having a nucleotide sequence as shown in SEQ ID NO.2 and a reverse primer having a nucleotide sequence as shown in SEQ ID NO.3.

[0018] In a fourth aspect, the present invention provides an application of SNP molecular markers in assisted breeding of dairy cows, wherein the SNP molecular markers are located at positions 223 and 483 of the nucleotide sequence of the LTF gene of the dairy cow as shown in SEQ ID NO.1, wherein when the polymorphism at position 223 is C and the polymorphism at position 483 is C, the milk produced by the dairy cow has a higher lactoferrin content.

[0019] Compared with the prior art, the present invention has the following beneficial effects:

[0020] The two SNP molecular markers provided by the present invention can significantly affect the activity of the lactoferrin promoter and further affect the expression level of lactoferrin. The genetic traits of the two SNP molecular markers are stable, and the final changes of the lactoferrin content in the milk produced by dairy cows after they mature in the future can be more accurately judged. The screening of high-quality genotype dairy cows can be carried out at an early stage, which greatly reduces the screening cost and improves the breeding efficiency. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 It shows the gene sequencing peak diagram with the 223rd SNP molecular marker;

[0022] Figure 2 It shows the gene sequencing peak diagram with the 483rd SNP molecular marker. DETAILED DESCRIPTION

[0023] In order to make the technical personnel in this field better understand the present application scheme, the present application will be clearly and completely described below in conjunction with the embodiments and drawings. Obviously, the described embodiments are only embodiments of a part of the present application, rather than all embodiments. Based on the embodiments in the present application, all other embodiments obtained by ordinary technicians in this field without making creative work should belong to the scope of protection of this application. The instruments and reagents used in the embodiments are all derived from commercial channels unless otherwise specified.

[0024] Example 1 SNP molecular marker screening and identification

[0025] 301 lactating Holstein cows without clinical mastitis were selected from a standardized ranch in Shandong Province. Blood samples were collected to extract genomic DNA for gene SNP identification. Fresh milk from each cow was collected and the lactoferrin content in the milk was tested using an Elisa kit.

[0026] Specific PCR amplification primers were designed, and PCR amplification and sequencing were performed on the lactoferrin promoter region of the above 301 Holstein cows. Two new SNPs sites were identified. Association analysis was performed between SNPs and lactoferrin content in milk, and a significant correlation was found between the two.

[0027] SnapGene software was used to compare the sequencing results of different samples; Excel software was used to calculate gene frequency, genotype frequency and allele frequency, and SPSS 23.0 software was used to perform association analysis on LTF gene polymorphism. The experimental results are expressed as "mean ± standard error". P When <0.01, it means the difference is extremely significant. P When the value is less than 0.05, it indicates significant difference.

[0028] The results are shown in the following table:

[0029]

[0030] Note: Different letters in the same column indicate significant differences ( P <0.05); the same letter or no letter on the shoulder indicates no significant difference ( P >0.05). The gene sequencing peak diagram is as follows Figure 1-2 As shown, arrows mark two SNPs sites.

[0031] Example 2 Detection of SNP Molecular Markers

[0032] Design the detection primers as follows:

[0033] 1F: 5' CCCCTGTCCTTTGGTATCTCCC 3',

[0034] 1R: 5' CACACAGTGCCCGTCTCTCAAA 3'.

[0035] Three genotypes of dairy cows were selected, genomic DNA was extracted, and PCR amplification was performed using the TransDirect Blood PCR Kit as the reaction system. The amplification conditions were as follows:

[0036] 94℃ 7min;

[0037] 94°C for 30 s, 60°C for 30 s, 72°C for 1 min, 35 cycles;

[0038] 72℃ 8min.

[0039] The total length of the PCR amplification product was 558 bp.

[0040] The results showed that each genotype had a corresponding relationship with the LTF content in the milk produced.

[0041] The invention concept is described in detail using specific examples herein, and the description of the above embodiments is only used to help understand the core idea of ​​the invention. It should be pointed out that any obvious modification, equivalent substitution or other improvement made by a person of ordinary skill in the art without departing from the invention concept should be included in the protection scope of the present invention.

Claims

1. Application of SNP molecular markers in identifying dairy cows with high lactoferrin content in milk, characterized in that: The SNP molecular marker is located at the 223rd and 483rd positions of the nucleotide sequence of the dairy cow LTF gene as shown in SEQ ID NO.1, wherein the polymorphism at the 223rd position is C or T, and the polymorphism at the 483rd position is C or T.

2. A method for identifying cows with high lactoferrin content in milk, characterized in that: Extract cow genomic DNA as a template, use the nucleotide sequence as SEQ ID NO.2 as the forward primer and the nucleotide sequence as SEQ ID NO.3 as the reverse primer for PCR amplification, if the 223rd polymorphism is C and the 483rd polymorphism is C in the amplified product, the cow is a high lactoferrin content cow.

3. The method according to claim 2, characterized in that PCR amplification conditions are: 94℃ 7min; 94°C for 30 s, 60°C for 30 s, 72°C for 1 min, 35 cycles; 72℃ 8min.

4. The use of a reagent for detecting SNP molecular markers in identifying cows with high lactoferrin content in milk, characterized in that: The SNP molecular marker is located at the 223rd and 483rd positions of the nucleotide sequence of the dairy cow LTF gene as shown in SEQ ID NO.1, wherein the polymorphism at the 223rd position is C or T, and the polymorphism at the 483rd position is C or T.

5. The use according to claim 4, characterized in that: The reagents include a forward primer having a nucleotide sequence as shown in SEQ ID NO.2 and a reverse primer having a nucleotide sequence as shown in SEQ ID NO.

3.

6. Application of SNP molecular markers in assisted breeding of dairy cows, characterized in that: The SNP molecular marker is located at the 223rd and 483rd positions of the nucleotide sequence of the cow LTF gene as shown in SEQ ID NO.1, wherein when the polymorphism at the 223rd position is C and the polymorphism at the 483rd position is C, the milk produced by the cow has a higher lactoferrin content.

Images