A primer combination, kit and method for detecting Aeromonas equi

Abstract

The present invention relates to the field of microbial detection, and specifically to a primer combination, a kit and a method for detecting Cynomolgus equinus. The primer combination includes an upstream primer and a downstream primer, the nucleotide sequence of the upstream primer is shown in SEQ ID No. 2, and the nucleotide sequence of the downstream primer is shown in SEQ ID No. 3. Cynomolgus equinus and green aerosols can be distinguished by using the primer combination, the kit and the PCR detection method provided by the present invention, and the PCR detection method provided by the present invention can detect Cynomolgus equinus efficiently, quickly and specifically.

Description

Technical Field

[0001] The invention belongs to the field of microbial detection, and specifically relates to a primer combination, a kit and a method for detecting Aeromonas equi Background Art

[0002] Aerococcus is a gram-positive coccus with grass-green hemolytic colonies and negative catalase. Currently, there are 11 species in this genus, namely Aerococcus viridans, Aerococcus urinaeequi, Aerococcus urinae, Aerococcus sanguinicola, Aerococcus christensenii, Aerococcus vaginalis, Aerococcus suis, and three newly isolated species from Aerococcus urinae, Aerococcus loyolae, Aerococcus mictus, and Aerococcus tenax. This genus is widely present in the air, soil, plants, and medical environments. It is an important pathogen of opportunistic infections and can cause clinical urinary tract infections, bloodstream infections, endocarditis, and bone and joint infections.

[0003] Balloons of the genus Aeromonas are a Gram-positive cocci that exist in pairs, quadruplets or clusters. Studies have shown that Balloons are pathogenic to animals and can be isolated from laying hens with podoconiosis, frozen milk of cows, liver and spleen of dead ducks, and urine of dogs and pigs with urethritis. In addition, in 2016, some scholars isolated Balloons from the ascites of patients with chronic kidney disease, indicating that the bacteria are also pathogenic to humans. Therefore, the development of accurate and efficient detection methods for Balloons is crucial for the treatment and prevention of pathogens.

[0004] The whole genome sequencing method has been applied to the species identification of E. equinus. Although this method is efficient and relatively accurate, it requires certain instruments and equipment and is relatively expensive. Due to defects in the database of biochemical identification and mass spectrometry identification systems, accurate identification of E. equinus cannot be achieved. PCR technology has been widely used in microbial detection due to its high efficiency and reliability. In PCR detection technology, primers play a vital role and determine the specificity and efficiency of PCR detection. The currently developed PCR method has certain limitations because of defects in primers and detection conditions, and the detection specificity of E. equinus is not strong, and it is impossible to accurately identify whether the sample to be tested is E. equinus. Summary of the invention

[0005] In view of the technical problems existing in the prior art, the purpose of the present invention is to provide a primer combination, a kit and a method for detecting Aerococcus equinus. By using the primer combination, the kit or the detection method provided by the present invention, Aerococcus equinus can be quickly and specifically identified, and Aerococcus equinus and green Aerococcus can be distinguished.

[0006] The first aspect of the present invention provides a primer combination for detecting Aeromonas equinus, wherein the primer combination comprises an upstream primer and a downstream primer, and the specific sequence is:

[0007] Upstream primer: 5'-AAAGCTTACGAAAAGCAGCA-3',

[0008] Downstream primer: 5′-CCAATTTGTAAGTGAGCGC-3′.

[0009] A second aspect of the present invention provides a kit for detecting Aeromonas equinus, the kit comprising the primer combination described above.

[0010] Furthermore, the kit also includes dNTP, PCR stabilizer, Taq DNA polymerase and PCR buffer.

[0011] The third aspect of the present invention provides an application of the above primer combination or the above kit in detecting Aeromonas equinus.

[0012] Furthermore, the application is used to distinguish between Aeromonas aurea and Aeromonas viridis.

[0013] The fourth aspect of the present invention provides a method for detecting Aeromonas equinus, which requires using the primer combination provided by the first aspect of the present invention or the kit provided by the second aspect of the present invention to detect the sample to be tested.

[0014] Furthermore, the specific steps of detecting Aeromonas aureus are as follows:

[0015] Extracting DNA from the sample to be tested;

[0016] Performing PCR amplification on the extracted DNA using the primer combination or the kit to obtain a PCR product;

[0017] The PCR products were analyzed by electrophoresis;

[0018] When the amplified product contains a 401 bp fragment, it indicates that the sample to be tested contains the Aeromonas equinus gene.

[0019] Furthermore, the PCR amplification system is: 2 to 5 μL of the test sample DNA template, 2 to 3 μL, 2 to 3 μL of downstream primers, 25 to 27 μL of PCR Mix, and sterile deionized water is added to 50 μL.

[0020] Preferably, the PCR amplification system is: 2 μL of the DNA template of the sample to be tested, 2 μL of the upstream primer, 2 μL of the downstream primer, 25 μL of PCR Mix, and sterile deionized water to make up to 50 μL.

[0021] Furthermore, the reaction procedure of the PCR amplification is: (1) preliminary denaturation; (2) denaturation; annealing: 52-56°C, 30s; extension; a total of 30-32 cycles; (3) terminal extension.

[0022] Preferably, the reaction procedure of the PCR amplification is: (1) preliminary denaturation; (2) denaturation; annealing: 54°C, 30s; extension; a total of 30 cycles; (3) terminal extension.

[0023] In summary, compared with the prior art, the present invention has the following advantages and effects:

[0024] (1) The present invention provides a primer combination for detecting Echinops equinus, which has high specificity and can be used to detect Echinops equinus. The PCR detection method provided by the present invention is simple to operate, low in cost, highly specific, and fast in detection speed, and has important practical significance for the detection and research of Echinops equinus.

[0025] (2) Although Aerococcus equinus and Aerococcus viride belong to the genus Aerococcus, there are only 1 to 2 base differences in the 16S rRNA gene between Aerococcus equinus and Aerococcus viride. Conventional PCR methods and primers cannot distinguish Aerococcus equinus and Aerococcus viride. The specific primer combination provided by the present invention can be used to identify Aerococcus equinus and distinguish Aerococcus equinus and Aerococcus viride. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 This is the comparison result of the unique fragment of Aerococcus equi in the database.

[0027] Figure 2 It is a PCR electrophoresis diagram, lane M is DNA Marker, and lanes 1 to 12 are the electrophoresis results of Aeromonas equinus, Aeromonas viridans, Proteus mirabilis, Clostridium perfringens, Enterococcus faecalis, Salmonella, Staphylococcus aureus, Bacillus subtilis, Pasteurella multocida and Escherichia coli, respectively.

[0028] Figure 3 This is the alignment result after sequencing of Aeromonas equina. DETAILED DESCRIPTION

[0029] In order to enable those skilled in the art to better understand and implement the technical solution of the present invention, the present invention is further described below in conjunction with specific embodiments and drawings.

[0030] In the description of the present invention, unless otherwise specified, all reagents used are commercially available and all methods used are conventional techniques in the art.

[0031] The genus Aeromonas is an important class of opportunistic pathogens. With the deepening of research, it is currently found that Aeromonas equinus of the genus Aeromonas is opportunistically pathogenic to animals and humans. Therefore, the development of an accurate and efficient detection method for Aeromonas equinus is crucial for the treatment and prevention of this pathogen. PCR technology has been widely used in microbial detection due to its high efficiency and reliability. In PCR detection technology, primers play a vital role and determine the specificity and efficiency of PCR detection. The currently developed PCR method has defects in primers and detection conditions, and its detection specificity for Aeromonas equinus is not strong. It is impossible to accurately identify whether the sample to be tested is Aeromonas equinus, so it has certain limitations.

[0032] The present invention compares and analyzes the whole genome sequences of Cynomolgus equi and Cynomolgus chlororaphis by referring to the NCBI database, then selects a fragment that only exists in the complete sequence of Cynomolgus equi, designs a specific primer combination for the fragment, establishes a PCR method, and finally verifies the specificity of the primers and the feasibility of the detection method through electrophoresis experiments. Cynomolgus equi and Cynomolgus chlororaphis can be distinguished by using the primer combination and the kit provided by the present invention, and Cynomolgus equi can be detected efficiently, quickly and specifically by using the PCR detection method provided by the present invention.

[0033] Example 1: Design of PCR primer combination

[0034] 1. Specific primer design and synthesis

[0035] The MAFFT version 7 online software was used to compare the whole genome sequences of Aeromonas equinus and Aeromonas viridis with reference to the NCBI database, and a fragment that only exists in Aeromonas equinus was selected. The sequence of this fragment is shown in SEQ ID NO.1. SEQ ID NO.1:

[0036] AAAGCTTACGAAAAGCAGCAAGAAGAGATCGCCAAATTAGAAGACTATGTAGCACGTAATATTGTGCGCGCCTCAACGACAAAAATGGCACAGTCACGTCGTAAGCAATTAGAGAAAATGACCAAAATTGAAAAGCCATTAAACGATGAAAAATCCGCACGCATTCAGTTCTCCGTTGCTGAAAGTTCTGGGAATGATGTTTTACAAACCAATAACTTAGCCGTCGGGTATAGTCCAGATAAAGTTTTGGCTGAACCTATCTCATTCCAGCTACGCAAGCAGGAAGCAATTGCAATTGTTGGACCAAATGGTGTAGGTAAATCAACCTTACTCAAAACAATTATTAAACAAATTCCAGCTATACGCGGCACTATCGAATATGGCGCTCACTTACAAATTGG (401 bp). Figure 1 As shown, the results showed that the sequence only existed in the complete sequence of A. equine.

[0037] Then, a pair of primer combinations was designed using the NCBI online tool. The upstream primer sequence is shown in SEQ ID NO.2, and the downstream primer sequence is shown in SEQ ID NO.3, as follows:

[0038] SEQ ID NO.2: 5'-AAAGCTTACGAAAAGCAGCA-3',

[0039] SEQ ID NO. 3: 5'-CCAATTTGTAAGTGAGCGC-3'.

[0040] Implementation 2: Construction and validation of detection methods

[0041] In this embodiment, the information of each strain is as follows:

[0042] For information on the strain of Aerococcus urinaequi, please refer to "Zhang Han, Shu Jingchao, Zhang Xiaojing, et al. Identification and whole genome sequencing analysis of Aerococcus urinaequi from ducks[J]. Chinese Journal of Preventive Veterinary Medicine, 2024, 46(02): 128-139.";

[0043] For information on the strain of Aerococcus viridans, see "Isolation and identification of Aerococcus viridans from pigs[J]. Advances in Veterinary Medicine, 2023, 44(02): 141-144.";

[0044] For information on Proteus mirabilis, please refer to “Lu Zhenxiang, Chen Xiaopeng, Wu Dongqi, et al. Goose Zhouqian, Zhang Wuyin, Cao Xuejie, et al. Isolation, identification and drug sensitivity test of Proteus mirabilis in geese [J]. Animal Husbandry and Veterinary Science and Technology Information, 2019, (05): 28-29.”;

[0045] For information on Pasteurella multocida, please refer to "Guo Weina, Zhao Xia, Lu Zhenxiang. Isolation, identification and drug resistance analysis of Pasteurella multocida from rabbits[J]. Chinese Journal of Veterinary Medicine, 2023, 59(04): 59-62.";

[0046] For information on Enterococcus faecalis, please refer to "Lu Zhenxiang, Chen Xiaopeng, Wu Dongqi, et al. Isolation and identification of Enterococcus faecalis from geese and detection of drug resistance and virulence genes[J]. Journal of Beijing Agricultural College, 2022, 37(4): 86-90.";

[0047] For the strain information of Salmonella, Staphylococcus aureus, Bacillus subtilis, Clostridium perfringens and Escherichia coli, please refer to "Zhang Xun, Lu Zhenxiang, Zhu Yuanzhao, et al. Isolation of bacteriocin-producing enterococci and screening of their antibacterial spectra [J]. Journal of Anhui University of Science and Technology, 2019, 33(06): 6-11.".

[0048] First, DNA of Aeromonas equinus, Aeromonas viridis, Proteus mirabilis, Clostridium perfringens, Enterococcus faecalis, Salmonella, Staphylococcus aureus, Bacillus subtilis, Pasteurella multocida and Escherichia coli were extracted, and the DNA was amplified using the primer combination designed in Example 1 according to the following PCR reaction system and reaction procedure, and the amplified products were analyzed by agarose gel electrophoresis.

[0049] PCR reaction system: DNA template 2 μL, upstream primer 2 μL, downstream primer 2 μL, PCRMix 25 μL, and sterile deionized water to 50 μL.

[0050] The reaction procedure of PCR amplification was as follows: (1) pre-denaturation: 95°C, 5 min; (2) denaturation: 95°C, 30 s; annealing: 54°C, 30 s; extension: 72°C, 1 min; 30 cycles in total; (3) terminal extension: 72°C, 10 min; (4) cooling to 4°C to terminate the reaction.

[0051] The electrophoresis results are as follows Figure 2 As shown, lane 1 is the amplified product of Aeromonas equinus, and only lane 1 has an amplified band, and the band size is in line with expectations, indicating that the primer combination provided by the present invention is specific and the PCR method is feasible. It can not only detect Aeromonas equinus, but also distinguish Aeromonas equinus from Green Aeromonas.

[0052] The band in lane 1 was sent to General Biotechnology Co., Ltd. for sequencing. The sequencing result is shown in SEQ ID NO.4. SEQ ID NO.4:

[0053] AAAGCTTACGAAAAGCAGCAAGAAGAGATCGCCAAATTAGAAGACTATGTAGCACGTAATATTGTGCGCGCCTCAACGACAAAAATGGCACAGTCACGTCGTAAGCAATTAGAGAAAATGACCAAAATTGAAAAGCCATTAAACGATGAAAAATCCGCACGCATTCAGTTCTCCGTTGCTGAAAGTTCTGGGAATGATGTTTTA CAAACCAATAACTTAGCCGTCGGGTATAGTCCAGATAAAGTTTTGGCTGAACCTATCTCATTCCAGCTACGCAAGCAGGAAGCAATTGCAATTGTTGGACCAAATGGTGTAGGTAAATCAACCTTACTCAAAACAATTAAACAAATTCCAGCTATACGCGGCACTATCGAATATGGCGCTCACTTACAAATTGG(401bp).

[0054] The SEQ ID NO.4 sequence was compared in the NCBI database. The comparison results are shown in Figure 3 As shown, this fragment exists in all the complete sequences of Aeromonas aureus uploaded by NCBI, is identical to the fragment sequence of SEQ ID NO.1 and does not contain green Aeromonas.

Claims

1. A primer combination for detecting Aeromonas equinus, characterized in that: The primer combination comprises an upstream primer and a downstream primer, and the specific sequence is: Upstream primer: 5'-AAAGCTTACGAAAAGCAGCA-3', Downstream primer: 5′-CCAATTTGTAAGTGAGCGC-3′.

2. A kit for detecting Aeromonas equinus, characterized in that: The kit comprises the primer combination according to claim 1.

3. The kit according to claim 2, characterized in that The kit also includes: dNTP, PCR stabilizer, Taq DNA polymerase and PCR buffer.

4. The kit according to claim 2, characterized in that The method of using the kit in the non-diagnostic detection of Aeromonas equinus is as follows: Extracting DNA from the sample to be tested; Performing PCR amplification on the extracted DNA using the primer combination to obtain a PCR product; The PCR products were analyzed by electrophoresis; When the PCR product contains a 401 bp fragment, it means that the sample to be tested contains the Aeruginosa gene.

5. The kit according to claim 4, characterized in that The PCR amplification system is: 2~5 μL of DNA template of the sample to be tested, 2~3 μL of upstream primer, 2~3 μL of downstream primer, 25~27 μL of PCR Mix, and sterile deionized water is added to 50 μL.

6. The kit according to claim 4, characterized in that The reaction procedure of the PCR amplification is: (1) pre-denaturation; (2) denaturation; annealing: 52-56°C, 30s; extension; a total of 30-32 cycles; (3) terminal extension.

Images