A functional marker for identifying resistance to fusarium wilt in cucumis melo and uses thereof
By cloning the melon vine blight resistance gene CmGSBWY and developing InDel molecular markers, the problems of melon vine blight resistance identification and breeding were solved, an efficient and environmentally friendly breeding method was achieved, and breeding efficiency and accuracy were improved.
Patent Information
- Application Number
- CN202411694761.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-25
- Publication Date
- 2025-10-24
- Estimated Expiration
- 2044-11-25
AI Technical Summary
Existing technologies make it difficult to efficiently and economically identify and breed melon vine blight resistance. Traditional breeding methods are time-consuming, labor-intensive, and cause serious environmental pollution.
Using high-throughput sequencing technology and bioinformatics analysis, combined with BSA and fine mapping methods, the melon vine blight resistance gene CmGSBWY was cloned, and InDel molecular markers and primers were developed for the precise identification of melon vine blight resistance phenotypes and variety selection.
It has achieved precise selection of melon vine blight resistance, shortened the breeding cycle, improved breeding efficiency, reduced costs and reduced environmental pollution.
Smart Images

Figure CN119570968B_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of molecular marker-assisted breeding, and particularly relates to an InDel molecular marker for identifying resistance to melon vine blight and an application thereof. Background Art
[0002] melon( Cucumismelo L.) belongs to the Cucurbitaceae family (Cucurbitaceae) Cucumis ), an annual climbing herb in the Chinese horticultural sector, is an important horticultural cash crop in my country and is widely cultivated around the world. According to the Food and Agriculture Organization of the United Nations (FAOSTAT), from 2016 to 2022, my country's melon planting area accounted for 36.87% of the global melon planting area. In 2022, my country's melon production reached 14.253 million tons, accounting for 49.9% of the global total.
[0003] Gummy stem blight (GSB) is one of the main fungal diseases that harm melons. Didymella bryoniae ), which occurs widely in both open-field and greenhouse melon cultivation, and becomes increasingly serious with the expansion of greenhouse cultivation areas. Vine blight can harm all organs of the above-ground melon. In the early stages of leaf infection, yellow-brown "V"-shaped lesions with inconspicuous whorls appear on the leaf margins, and in the later stages, the entire leaf dies. When the disease first occurs at the base of the stem, oval sunken lesions appear. In the later stages, the diseased part gradually dries up and shrinks, the epidermis turns grayish white, and the diseased part is prone to cracking. In severe cases, the entire plant loses water, wilts, and dies. Vine blight seriously affects the yield and quality of melons, significantly reduces the planting benefits of melons, and restricts the development of the melon industry.
[0004] Chemical pesticides are currently the primary method for controlling melon vine blight, but they are costly and environmentally harmful. Excessive use of fungicides not only significantly pollutes the environment but also accelerates mutations in pathogenic bacteria, leading to drug resistance. Understanding the mechanisms of resistance to melon vine blight, identifying resistance genes, and utilizing these genes to breed vine blight-resistant varieties is the safest, most economical, and most environmentally friendly approach to controlling melon vine blight.
[0005] With the development of molecular biology and sequencing technology, the development of molecular marker technology is very rapid. The efficiency of breeding disease resistance traits by using traditional breeding methods is low, and the breeding period of disease resistance is long. However, the use of functional marker assisted selection breeding technology can overcome the limitations of traditional breeding methods, significantly improve the breeding efficiency, realize the precise selection of disease resistance genes, and greatly reduce the breeding cost. As a genetic marker, InDel marker can detect the insertion or deletion of bases by PCR amplification and sequencing, and the technology is mature and the operation is relatively simple. In contrast, SSR marker is prone to replication slippage during PCR amplification, so it is more likely to cause amplification failure or produce non-specific products. At the same time, the physical distance of SSR linkage marker and disease resistance gene is far, and the linkage relationship is easily broken, thereby causing the uncertainty of assisted selection. SUMMARY
[0006] In view of the problems that the phenotype identification in the breeding of melon Gummy stem blight resistance is easily affected by the environment, and the selection of disease-resistant materials is time-consuming and laborious, the application provides a molecular marker and method for identifying the phenotype of melon Gummy stem blight resistance.
[0007] The disease-resistant material 'MG016' carries a dominant gene for Gummy stem blight resistance , However, the gene has not been cloned and no molecular marker co-segregated with it has been developed. Based on this, the applicant uses high-throughput sequencing technology and bioinformatics analysis, combined with BSA and fine mapping, to clone the melon Gummy stem blight resistance candidate gene for the first time, which is named CmGSBWY Gene by the applicant. The size of the gene fragment is about 3kb, which contains a complete open reading frame (ORF). When the gene is silenced in the disease-resistant material 'MG016' by using the virus-induced gene silencing (VIGS) technology, the disease-resistant material shows disease, which further proves that the gene is a Gummy stem blight resistance gene of melon. At present, the sequence of the gene has not been published, and the applicant is carrying out stable overexpression experiment and further functional verification analysis.
[0008] One of the purposes of the application is to provide a functional marker located in the coding region sequence of the Gummy stem blight resistance gene CmGSBWY of melon, which is an InDel molecular marker, and the nucleotide sequence is shown as SEQ ID NO. 1, which is 102bp. In the marker sequence, 6bp of base insertion mutation occurs in the disease parent relative to the disease-resistant parent. Specifically, the InDel molecular marker is a marker in the sequence of the Gummy stem blight resistance gene of melon, which is co-segregated with the gene. The use of the molecular marker can effectively distinguish the Gummy stem blight resistance of the strain in the segregating population, thereby providing an efficient genetic tool for the molecular breeding of disease-resistant melons. CmGSBWY
[0009] The second object of the present application is to provide a primer for amplifying the InDel molecular marker, which comprises an upstream primer and a downstream primer, and the nucleotide sequences of the primer are shown in SEQ ID NO. 2 and SEQ ID NO. 3, and the primer can be used for identifying the resistance of melon germplasm to gummy stem and wilt.
[0010] The third object of the present application is to provide an application of the InDel molecular marker or the primer thereof in phenotype identification and variety selection of melon gummy stem and wilt.
[0011] The fourth object of the present application is to provide a kit for phenotype identification and variety selection of melon gummy stem and wilt, wherein the kit comprises the primer.
[0012] The fifth object of the present application is to provide a method for phenotype identification and variety selection of melon gummy stem and wilt, which comprises the following steps:
[0013] (1) extracting genomic DNA of melon;
[0014] (2) using the genomic DNA extracted in step (1) as a template, and performing PCR amplification by using the primer;
[0015] (3) performing gel electrophoresis detection on the amplification product of step (2), and identifying the resistance of melon gummy stem and wilt according to the band size.
[0016] The PCR amplification system is 1 µL, upstream and downstream primers (10 µmol / L), 1 µL DNA template (50-150 ng / µL), 2 × TaqMasterMix (DyePlus) 4 µL, and ddH2O is supplemented to 10 µL.
[0017] The PCR reaction program is as follows: 94℃ pre-denaturation for 3 min, 94℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 45 s, a total of 34 cycles, 72℃ extension for 10 min, and storage at 4℃.
[0018] Specifically, the band type of the PCR amplification product is recorded, and the resistance of melon gummy stem and wilt is determined according to the fragment size, and the determination principle is as follows:
[0019] (1) the band size amplified by the molecular marker primer in the disease-resistant parent and the disease-susceptible parent is significantly different;
[0020] (2) when the molecular marker primer is used for amplification of melon germplasm, if a specific band with the same size as the disease-resistant parent appears, that is, a fragment with a size of 102 bp is amplified, then the strain shows disease resistance;
[0021] (3) the molecular marker primer, when amplifying the melon germplasm, if only specific bands with the same size as the susceptible parent appear, i.e. only a fragment with a size of 108 bp is amplified, the strain shows susceptibility.
[0022] The beneficial effects of the present application are:
[0023] The present application clones the gummy stem blight resistance gene by using the BSA method combined with fine mapping method CmGSBWY , according to CmGSBWY the sequence difference of the gene between the resistant and susceptible parents, a new molecular marker of the melon gummy stem blight resistance gene is developed, which can effectively distinguish the resistance phenotype of the melon gummy stem blight. At the same time, the marker is the first functional marker from the coding region of the gummy stem blight resistance gene CmGSBWY , which can directly select the disease resistance gene, so as to realize the accurate selection of the disease resistance phenotype.
[0024] The identification result of the present application is accurate and reliable, which can be used for early screening of melon gummy stem blight resistance germplasm, shortens the breeding period, improves the breeding efficiency, and has the advantages of convenient and rapid detection, not affected by environmental factors, etc. BRIEF DESCRIPTION OF DRAWINGS
[0025] Figure 1 is the PCR amplification result of the molecular marker primer in the F2 population; wherein Marker, melon gummy stem blight resistant parent 'MG016', melon gummy stem blight susceptible parent 'S28', F1 generation single plant, and F2 population single plant with determined phenotype are marked respectively. The band with the same size as the resistant parent or the F1 generation single plant is the phenotype of the resistant single plant; the band with the same size as the susceptible parent is the phenotype of the susceptible single plant. Among them, R represents the single plant with the phenotype of resistance, and S represents the single plant with the phenotype of susceptibility.
[0026] Figure 2 is part of the phenotype of the F2 resistant single plant and the susceptible single plant. Among them, R represents the single plant with the phenotype of resistance, and S represents the single plant with the phenotype of susceptibility. DETAILED DESCRIPTION
[0027] The present application will be further described in detail below in combination with specific embodiments. The following examples only have an illustrative effect on the present application, but do not have a limiting effect. The various experimental operations involved in the examples are conventional operations in the art, and the parts not specifically described in the text can be implemented by referring to various common tool books, scientific and technical literature or related instructions, manuals, etc. by those skilled in the art. The resistant parent 'MG016' in the present study is a germplasm resource introduced from abroad, and the susceptible parent 'S28' is a domestic local variety, which is now preserved in the College of Horticulture and Forestry, Huazhong Agricultural University and can be provided to the outside.
[0028] Example 1 InDel molecular marker co-segregated with melon gummy stem blight resistance gene CmGSBWY Sequence difference in resistant and susceptible materials to develop InDel molecular marker
[0029] This example provides an InDel molecular marker co-segregated with melon gummy stem blight resistance gene, the primer sequence of which is shown in SEQ ID NO. 2 and SEQ ID NO. 3.
[0030] Forward primer: 5'-GGGAACAGAGACGTAGAAGA-3' (SEQ ID NO. 2)
[0031] Reverse primer: 5'-ATCCCTACCTCTGTCTCTGT-3' (SEQ ID NO. 3)
[0032] The design method of the primer is as follows: according to CmGSBWY Sequence difference in resistant and susceptible materials to develop InDel molecular marker In this study, at the InDel site, the susceptible parent had a 6 bp base insertion mutation relative to the resistant parent.
[0033] Resistant parent InDel marker sequence:
[0034] >MG016
[0035] GGGAACAGAGACGTAGAAGATGATCGATATAGGGACAGGGCAGGGGACAGAGGAAGAGACAGAGATAGAGACAGAGACAGAGACAGAGACAGAGGTAGGGAT
[0036] Susceptible parent InDel marker sequence:
[0037] >S28
[0038]
[0039] GGGAACAGAGACGTAGAAGATGATCGATATAGGGACAGGGCAGGGGACAGAGGAAGAGACAGAGATAGAGA TAGAGA CAGAGACAGAGACAGAGACAGAGGTAGGGAT
[0040] Example 2 Screening of melon resources with resistance to gummy stem blight by InDel molecular markers of coding region CmGSBWY Example 2 Screening of melon resources with resistance to gummy stem blight by InDel molecular markers of coding region
[0041] The melon resources with resistance to gummy stem blight were screened by the molecular markers in Example 1, and the specific implementation method is as follows:
[0042] I. PCR amplification and electrophoresis detection
[0043] (1) The genomic DNA of the sample to be tested was extracted by CTAB method;
[0044] (2) The genomic DNA obtained in step (1) was used as a template, and the molecular marker specific primers in Example 1 were used for PCR amplification. The PCR amplification system was 1 μL of upstream and downstream primers (10 μmol / L), 1 μL of DNA template (50-150 ng / μL), 2 × TaqMasterMix (DyePlus) 4 μL, and ddH2O was added to 10 μL. The PCR reaction program was 94°C pre-denaturation for 3 min, 94°C denaturation for 30 s, 55°C annealing for 30 s, 72°C extension for 45 s, a total of 34 cycles, 72°C extension for 10 min, and storage at 4°C. The obtained amplification product was detected by electrophoresis using 8% polyacrylamide gel, the voltage was 200 V, the current was 200 mA, the power was 36 W, the electrophoresis time was 80 min, and finally the color was developed by 2% AgNO3 solution silver staining. The preparation method of 8% polyacrylamide gel is as follows: 24 mL of 30% Acr-Bis (acrylamide-methylene bisacrylamide), 16 mL of 5 × TBE, 800 μL of 10% APS (ammonium persulfate), 64 μL of accelerator TEMED, and ultrapure water to 80 mL.
[0045] II. F2 population construction
[0046] The selected susceptible material 'S28' is a local characteristic variety in China, with strong growth, large fruit, and good quality, but it is susceptible to gummy stem blight; the resistant material melon wild species 'MG016' has small fruit, sour flavor, and low edible value, but it carries the resistance gene to gummy stem blight CmGSBWY The F1 was obtained by crossing 'S28' as the female parent and 'MG016' as the male parent in the early stage of the experiment, and multiple F2 populations were obtained by selfing the F1.
[0047] III. Phenotyping of F2 population for resistance to gummy stem blight
[0048] In order to verify the accuracy of the developed InDel molecular marker in identifying the resistance phenotype of melon to gummy stem blight, the marker was verified by population analysis using the constructed F2 population. Figure 1 It was found that the genotypes of all the strains phenotyped as resistant in the population were consistent with the resistant parent or the F1 strain, i.e., a fragment of 102 bp was present, and the genotypes of all the strains phenotyped as susceptible were consistent with the susceptible parent, i.e., only a fragment of 108 bp was present. The population was an F2 population, and the result indicates that the functional marker is a co-dominant marker, which can distinguish resistant materials from susceptible materials, and is targeted at the resistance gene CmGSBWY to gummy stem blight of melon. The functional marker screened by the present application can be applied to the auxiliary screening of melon seedling-stage resistant and susceptible strains, and the deficiencies of conventional disease-resistant breeding can be overcome, the phenotyping method is simplified, a genetic tool is provided for functional marker-assisted breeding of resistance to gummy stem blight, and the process of breeding of varieties resistant to gummy stem blight is further accelerated.
Claims
1. A functional marker for identifying resistance to gummy stem blight in Cucumis melo, which is located in the CDS region of the C. melo resistance gene to gummy stem blight, and is an InDel molecular marker, characterized in that: The functional marker sequence is shown as SEQ ID NO: 1 and SEQ ID NO: 4; the nucleotide sequence fragment shown in SEQ ID NO: 1 is co-segregated with the melon bacterial wilt resistance gene. 2. Use of the functional marker of claim 1 in melon bacterial wilt resistance identification.
3. A method for identifying resistance to gummy stem blight in Cucumis melo, comprising The method comprises the following steps: (1) extracting genomic DNA of the sample to be tested; (2) using the genomic DNA extracted in step (1) as a template, and performing PCR amplification with primers shown as nucleotide sequences of SEQ ID NO: 2 and SEQ ID NO: 3; (3) performing electrophoresis detection on the amplification product of step (2), and identifying melon bacterial wilt resistance according to the band size; if a specific band with the same size as the disease-resistant parent appears, i.e. a fragment with a size of 102 bp is amplified, then the phenotype of the melon single plant is disease-resistant; if only a specific band with the same size as the disease-susceptible parent appears, i.e. only a fragment with a size of 108 bp is amplified, then the phenotype of the melon single plant is disease-susceptible.
4. The method for identifying resistance to gummy stem and wood disease in C. melo according to claim 3, wherein, The PCR amplification system is as follows: 10 µmol / L upper and lower primers 1 µL, 50-150 ng / µL DNA template 1 µL, 2×TaqMasterMix 4 µL, and ddH2O is supplemented to 10 µL.
5. The method of identifying resistance to gummy stem and wood disease in C. melo according to claim 3, wherein, The PCR reaction program is as follows: 94℃ pre-denaturation for 3 min, 94℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 45 s, a total of 34 cycles, 72℃ extension for 10 min, and storage at 4℃.