Marker for efficiently identifying alfalfa chromosome and application thereof

Abstract

The invention discloses a marker for efficiently identifying alfalfa chromosomes and application thereof, belongs to the field of bioinformatics and molecular cytogenetics, and solves the problems that alfalfa is high in ploidy, large in number of chromosomes, small in chromosomes, lack of obvious symbolic characteristics and high in identification difficulty. The marker for efficiently identifying the alfalfa chromosome is used for identifying chromosomes 1-8 of alfalfa, the marker of the alfalfa chromosome is located on the chromosomes 1-8 of the alfalfa, and the marker of the alfalfa chromosome is composed of six pairs of alfalfa specific sequence amplification primers; the marker for efficiently identifying the alfalfa chromosomes can efficiently and accurately identify the 1-8 chromosomes of the alfalfa, can identify the 1-8 chromosomes in the alfalfa at one time, can quickly distinguish different chromosomes, greatly shortens the identification time, improves the working efficiency, is beneficial to understanding the genetic diversity of the alfalfa, and has good application prospects. Individuals with excellent characters can be conveniently selected for hybridization.

Description

Technical Field

[0001] The invention belongs to the field of bioinformatics and molecular cytogenetics, and in particular relates to a marker for efficiently identifying alfalfa chromosomes and an application thereof. Background Art

[0002] Alfalfa (Medicago sativa L.) is a perennial herbaceous leguminous plant, widely used in livestock feed, edible vegetables and medicinal herbs, and is one of the most important economic crops in the world. Due to its strong adaptability, high yield and good nutritional value, it is known as the "king of forage" in animal husbandry production. With the increasing demand for meat, eggs and dairy products, the animal husbandry industry faces higher development requirements. Alfalfa, as a plant with extremely high protein content, is crucial to the development of animal husbandry. Therefore, cultivating high-yield and high-quality new alfalfa varieties is of great significance to increasing the yield of alfalfa and promoting the development of forage and animal husbandry. Cultivated alfalfa is usually a complex autotetraploid with small chromosomes and similar morphology, which hinders the study of alfalfa chromosomes.

[0003] Fluorescence in situ hybridization (FISH) is one of the important techniques in plant molecular cytogenetics. Its principle is to prepare a known sequence into a labeled probe, use the base complementary pairing principle to hybridize the probe with the nucleic acid sequence in the cell or tissue, and use a microscope to display the distribution of the required sequence on the chromosome in a fluorescent colorimetric manner, and finally achieve precise positioning on the chromosome. FISH technology has been widely used in plant chromosome research, but chromosome identification is still a challenge for plants with high ploidy, a large number of chromosomes, and small chromosomes. Alfalfa has a high ploidy, a large number of chromosomes, small chromosomes, and lacks obvious landmark features, such as the location of the centromere and arm ratio, making it difficult to identify alfalfa. In response to the above problems, we proposed a marker for efficient identification of alfalfa chromosomes and its application. Summary of the invention

[0004] The purpose of the present invention is to provide a marker for efficiently identifying alfalfa chromosomes and its application in view of the shortcomings of the prior art, so as to solve the problems of high ploidy, large number of chromosomes, small chromosomes, lack of obvious landmark features and great difficulty in identification of alfalfa.

[0005] At present, alfalfa has high ploidy, many chromosomes, small chromosomes, and lacks obvious hallmark characteristics, making identification difficult. In order to solve the above problems, we proposed a marker for efficiently identifying alfalfa chromosomes, which is used to identify chromosomes 1-8 of alfalfa. The marker of alfalfa chromosomes is located on chromosomes 1-8 of alfalfa. The marker of alfalfa chromosomes consists of 6 pairs of alfalfa-specific sequence amplification primers, and the 6 pairs of primers of alfalfa chromosomes include: MF5 / MR5, MF16 / MR16, MF17 / MR17, MF18 / MR18, MF19 / MR19, and MF28 / MR28. The marker for efficiently identifying alfalfa chromosomes provided by the embodiment of the present invention can efficiently and accurately identify the markers of alfalfa chromosomes 1-8, can identify chromosomes 1-8 in alfalfa at one time, can quickly distinguish different chromosomes, greatly shortens the identification time, improves work efficiency, helps to understand the genetic diversity of alfalfa, facilitates the selection of individuals with excellent traits for hybridization, and cultivates new varieties that are more suitable for market demand. It is a favorable tool for chromosome identification, karyotype research, evolution and diversity research of alfalfa.

[0006] The present invention is achieved by providing a marker for efficiently identifying alfalfa chromosomes, wherein the marker for efficiently identifying alfalfa chromosomes is used to identify chromosomes 1 to 8 of alfalfa, the marker for alfalfa chromosomes is located on chromosomes 1 to 8 of alfalfa, the marker for alfalfa chromosomes is composed of 6 pairs of alfalfa-specific sequence amplification primers, and the 6 pairs of primers for alfalfa chromosomes include:

[0007] MF5 / MR5, MF16 / MR16, MF17 / MR17, MF18 / MR18, MF19 / MR19, MF28 / MR28;

[0008] Among them, the markers of alfalfa chromosomes are 21 single copy sequences distributed in specific regions of 8 alfalfa chromosomes. A total of 21 regions were selected in the 8 alfalfa chromosomes, each containing 4,800 oligonucleotides. The selected 21 regions were region 1, region 2, region 3, region 4, region 5, region 6, region 7, region 8, region 9, region 10, region 11, region 12, region 13, region 14, region 15, region 16, region 17, region 18, region 19, region 20, and region 21.

[0009] The sequence amplification primer pair MF5 / MR5 sequence is:

[0010] MF5:CAACCACTTCATCAGTTGGA;

[0011] MR5:TGTTTTGAAGGTGACAAACC;

[0012] The sequence of the primer pair MF16 / MR16 for sequence amplification is:

[0013] MF16: ACACCATGGACCAAAACCAT;

[0014] MR16:CGTTTACGAGGTTCACGGAT;

[0015] The sequence amplification primer pair MF17 / MR17 sequence is:

[0016] MF17:AAAGTGCCCGAGAGCATAGA;

[0017] MR17:TTCCTTCCTAATGATCGCAA;

[0018] The sequence of the primer pair MF18 / MR18 for sequence amplification is:

[0019] MF18:AAATCCACGTTCTTCAACCG;

[0020] MR18: AAGGAGCCAAACACATCGTC;

[0021] The sequence of the sequence amplification primer pair MF19 / MR19 is:

[0022] MF19: ACACTCAACCGTGTCATTGG;

[0023] MR19:TACATGATGGAATGCGAGGA;

[0024] The sequence of the primer pair MF28 / MR28 for sequence amplification is:

[0025] MF28:TGGTTTGAGAGGGAAAGAAC;

[0026] MR28: GGCTGCTCTGGATACATTTT.

[0027] Primers were added left and right to the oligonucleotide sequences of the 21 selected regions;

[0028] Among them, the oligo sequences of region 1, region 3, region 5, region 8, region 11, region 13, region 16, and region 19 used primers MF5 / MR5;

[0029] The oligo sequences of region 2, region 4, region 7, region 10, region 12, region 15, region 18, and region 21 used primers MF28 / MR28;

[0030] The primers used in region 6 are MF17 / MR17, the primers used in region 9 are MF19 / MR19, the primers used in region 14 are MF16 / MR16, and the primers used in regions 17 and 20 are MF18 / MR18.

[0031] The present invention also provides a method for developing a marker for an alfalfa chromosome, the method comprising:

[0032] S101, based on the Xinjiang Daye genome, used Repeat Masker to remove the repetitive sequences of the Xinjiang Daye genome, divided the remaining genome sequences into 45 bp oligonucleotide sequences, aligned each oligonucleotide sequence back to the Xinjiang Daye genome, and removed oligo sequences with multiple alignment sites;

[0033] S102, using Primer to calculate the melting temperature and hairpin melting temperature of each oligonucleotide, and retaining oligonucleotide sequences with dTm>10°C;

[0034] S103, 21 regions were selected on chromosomes 1-8 of alfalfa, the selected 21 regions were region 1, region 2, region 3, region 4, region 5, region 6, region 7, region 8, region 9, region 10, region 11, region 12, region 13, region 14, region 15, region 16, region 17, region 18, region 19, region 20, and region 21, each region contained 4800 oligonucleotides, different regions in the same chromosome were spaced 3.8-5.0 Mb apart, left and right primers were added to these 21 regions;

[0035] S104, using the oligonucleotide sequence pool as a template, using the synthesized specific primers to perform PCR to amplify the oligonucleotide sequence of the selected region of each chromosome into an oligo probe with fluorescent modification.

[0036] The selected 21 regional oligonucleotide sequence probes with fluorescent modification are Ms1.1, Ms1.2, Ms2.1, Ms2.2, Ms3.1, Ms3.2, Ms3.3, Ms4.1, Ms4.2, Ms4.3, Ms5.1, Ms5.2, Ms6.1, Ms6.2, Ms6.3, Ms7.1, Ms7.2, Ms7.3, Ms8.1, Ms8.2, Ms8.3;

[0037] Among them, probes Ms1.1, Ms1.2, Ms3.1, Ms3.2, Ms3.3, Ms4.2, Ms4.3, Ms5.2, Ms6.2, Ms7.1, Ms7.3, and Ms8.1 were modified with TAMRA;

[0038] Probes Ms2.1, Ms2.2, Ms4.1, Ms5.1, Ms6.1, Ms6.3, Ms7.2, Ms8.2, and Ms8.3 are modified with FAM.

[0039] The present invention also provides a fluorescence in situ hybridization identification method for efficiently identifying alfalfa chromosomes, and the fluorescence in situ hybridization identification method for efficiently identifying alfalfa chromosomes comprises:

[0040] S201, preparation of metaphase chromosomes: young root tips of Xinjiang Daye, Zhongmu No. 1, and Leiting were selected and pretreated in actinomycin for 2 hours to enrich metaphase chromosomes, and then fixed with a fixative, wherein the fixative was a mixture of anhydrous ethanol and acetic acid in a volume ratio of 3:1. After that, the root cap and elongation zone were removed, and the cell walls were removed with 4% R-10 cellulase, 2% pect pectinase, 2% RS cellulase, and 1% Y-23 pectinase, and the slices were prepared by the "liquid nitrogen freezing and knocking method";

[0041] S202, hybridization: prepare a hybridization solution containing 3ul of 50% dextran sulfate, 7.5ul of deionized formamide, 1.5ul / 20×SSC, and 400ng of oligo probe. Denature the slides at 85°C for 5min, dehydrate them in a gradient of 70% and 100% ethanol at -20°C, drop the hybridization solution on the slides, and hybridize them at 37°C overnight.

[0042] S203, elution: Elute the slide in 2×SSC solution for 3 times and in 1×PBS solution once, with the elution time being 5 min each time. Rinse with distilled water, add DAPI after the slide is dry, and cover with a coverslip for chromosome re-staining.

[0043] S204, image acquisition: using a fluorescence microscope to acquire images to present the distribution of the oligo probes on the chromosomes.

[0044] Another aspect of the present invention further provides the use of the above-mentioned marker for efficiently identifying alfalfa chromosomes in any of the following items.

[0045] (1) Alfalfa chromosome identification;

[0046] (2) Alfalfa staining karyotype study;

[0047] (3) Alfalfa breeding;

[0048] (4) Molecular marker-assisted breeding of alfalfa.

[0049] Compared with the prior art, the embodiments of the present application have the following beneficial effects:

[0050] The marker for efficiently identifying alfalfa chromosomes provided by the present invention can efficiently and accurately identify the markers of alfalfa chromosomes 1-8, can identify chromosomes 1-8 in alfalfa at one time, can quickly distinguish different chromosomes, greatly shortens the identification time, improves work efficiency, helps to understand the genetic diversity of alfalfa, facilitates hybridization by selecting individuals with excellent traits, and cultivates new varieties that are more suitable for market demand. The marker is a favorable tool for chromosome identification, karyotype research, evolution and diversity research of alfalfa.

[0051] The invention provides a marker development method for alfalfa chromosomes. Repeat Masker is used to remove Xinjiang bigleaf genome repetitive sequences, and the remaining genome sequences are divided into 45bp oligonucleotide sequences. 21 regions are selected on alfalfa chromosomes 1 to 8, and a PCR is performed using an oligonucleotide sequence pool as a template and synthesized specific primers to amplify the oligonucleotide sequences of the selected regions of each chromosome into oligo probes with fluorescence modification, so that only the oligonucleotide sequences of the target regions can be amplified under different environments, thereby improving the specificity of the marker, being able to clearly display the specific regions of the chromosomes at the cytological level, and being helpful to more accurately identify chromosome aberrations and variations. A large amount of genetic information can be obtained by marking and analyzing multiple chromosome regions, and being helpful to deeply understand the genetic diversity, evolutionary history and kinship of alfalfa.

[0052] The six pairs of primers provided by the present invention obtain 21 marker sites based on different amplification templates, and these marker sites are relatively stable and can be used for the identification of high-yield and high-protein alfalfa materials. Therefore, the markers developed above for efficiently identifying alfalfa chromosomes can be combined with traditional breeding methods to accelerate the cultivation of new high-yield and high-quality alfalfa varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0053] Figure 1 The present invention provides a schematic diagram of the implementation process of the marker development method for alfalfa chromosomes provided in an embodiment of the present invention.

[0054] Figure 2 A schematic diagram of a fluorescently modified oligo probe provided in an embodiment of the present invention is shown.

[0055] Figure 3 The present invention is a schematic diagram of the implementation process of the fluorescence in situ hybridization identification method for efficiently identifying alfalfa chromosomes.

[0056] Figure 4 A schematic diagram showing the hybridization results of alfalfa chromosome markers in tetraploid alfalfa Xinjiang Daye, Lei Ting, and Zhongmu No. 1. DETAILED DESCRIPTION

[0057] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those commonly understood by technicians in the technical field of this application; the terms used in the specification of the application herein are only for the purpose of describing specific embodiments and are not intended to limit this application; the terms "including" and "having" and any variations thereof in the specification and claims of this application and the above-mentioned drawings are intended to cover non-exclusive inclusions. The terms "first", "second", etc. in the specification and claims of this application or the above-mentioned drawings are used to distinguish different objects, not to describe a specific order.

[0058] Reference to "embodiments" herein means that a particular feature, structure, or characteristic described in conjunction with the embodiments may be included in at least one embodiment of the present application. The appearance of the phrase in various locations in the specification does not necessarily refer to the same embodiment, nor is it an independent or alternative embodiment that is mutually exclusive with other embodiments. It is explicitly and implicitly understood by those skilled in the art that the embodiments described herein may be combined with other embodiments.

[0059] At present, alfalfa has high ploidy, many chromosomes, small chromosomes, and lacks obvious hallmark characteristics, making identification difficult. In order to solve the above problems, we proposed a marker for efficiently identifying alfalfa chromosomes and its application, the marker for efficiently identifying alfalfa chromosomes is used to identify chromosomes 1-8 of alfalfa, the marker for alfalfa chromosomes is located on chromosomes 1-8 of alfalfa, the marker for alfalfa chromosomes consists of 6 pairs of alfalfa-specific sequence amplification primers, and the 6 pairs of primers for alfalfa chromosomes include: MF5 / MR5, MF16 / MR16, MF17 / MR17, MF18 / MR18, MF19 / MR19, MF28 / MR28. The marker for efficiently identifying alfalfa chromosomes provided by the embodiment of the present invention can efficiently and accurately identify the markers of alfalfa chromosomes 1-8, can identify chromosomes 1-8 in alfalfa at one time, can quickly distinguish different chromosomes, greatly shortens the identification time, improves work efficiency, helps to understand the genetic diversity of alfalfa, facilitates the selection of individuals with excellent traits for hybridization, and cultivates new varieties that are more suitable for market demand. It is a favorable tool for chromosome identification, karyotype research, evolution and diversity research of alfalfa.

[0060] Example 1

[0061] The embodiment of the present invention provides a marker for efficiently identifying alfalfa chromosomes, wherein the marker for efficiently identifying alfalfa chromosomes is used to identify chromosomes 1-8 of alfalfa, the marker for the alfalfa chromosome is located on chromosomes 1-8 of alfalfa, the marker for the alfalfa chromosome is developed and designed using bioinformatics, the marker for the alfalfa chromosome is composed of 6 pairs of alfalfa-specific sequence amplification primers, and the 6 pairs of primers for the alfalfa chromosome include:

[0062] MF5 / MR5, MF16 / MR16, MF17 / MR17, MF18 / MR18, MF19 / MR19, MF28 / MR28;

[0063] Among them, the markers of alfalfa chromosomes are 21 single copy sequences distributed in specific regions of 8 alfalfa chromosomes. A total of 21 regions were selected in the 8 alfalfa chromosomes, each containing 4,800 oligonucleotides. The selected 21 regions were region 1, region 2, region 3, region 4, region 5, region 6, region 7, region 8, region 9, region 10, region 11, region 12, region 13, region 14, region 15, region 16, region 17, region 18, region 19, region 20, and region 21.

[0064] In this embodiment, the sequence of the sequence amplification primer pair MF5 / MR5 is:

[0065] MF5:CAACCACTTCATCAGTTGGA;

[0066] MR5:TGTTTTGAAGGTGACAAACC;

[0067] The sequence of the primer pair MF16 / MR16 for sequence amplification is:

[0068] MF16: ACACCATGGACCAAAACCAT;

[0069] MR16:CGTTTACGAGGTTCACGGAT;

[0070] The sequence amplification primer pair MF17 / MR17 sequence is:

[0071] MF17:AAAGTGCCCGAGAGCATAGA;

[0072] MR17:TTCCTTCCTAATGATCGCAA;

[0073] The sequence of the primer pair MF18 / MR18 for sequence amplification is:

[0074] MF18:AAATCCACGTTCTTCAACCG;

[0075] MR18: AAGGAGCCAAACACATCGTC;

[0076] The sequence of the sequence amplification primer pair MF19 / MR19 is:

[0077] MF19: ACACTCAACCGTGTCATTGG;

[0078] MR19:TACATGATGGAATGCGAGGA;

[0079] The sequence of the primer pair MF28 / MR28 for sequence amplification is:

[0080] MF28:TGGTTTGAGAGGGAAAGAAC;

[0081] MR28: GGCTGCTCTGGATACATTTT.

[0082] It should be noted that Table 1 shows a sequence list of primers for alfalfa-specific sequence amplification.

[0083] Table 1

[0084] Primers sequence MF5 CAACCACTTCATCAGTTGGA MR5 TGTTTTGAAGGTGACAAACC MF16 ACACCATGGACCAAAACCAT MR16 CGTTTACGAGGTTCACGGAT MF17 AAAGTGCCCGAGAGCATAGA MR17 TTCCTTCCTAATGATCGCAA MF18 AAATCCACGTTCTTCAACCG MR18 AAGGAGCCAAACACATCGTC MF19 ACACTCAACCGTGTCATTGG MR19 TACATGATGGAATGCGAGGA MF28 TGGTTTGAGAGGGAAAGAAC MR28 GGCTGCTCTGGATACATTTT

[0085] In this example, primers were added to the left and right oligonucleotide sequences of the 21 selected regions;

[0086] Among them, the oligo sequences of region 1, region 3, region 5, region 8, region 11, region 13, region 16, and region 19 used primers MF5 / MR5;

[0087] The oligo sequences of region 2, region 4, region 7, region 10, region 12, region 15, region 18, and region 21 use primers MF28 / MR28, while the primers used for region 6 are MF17 / MR17, the primers used for region 9 are MF19 / MR19, the primers used for region 14 are MF16 / MR16, and the primers used for regions 17 and 20 are MF18 / MR18.

[0088] It should be noted that MF5 / MR5, MF16 / MR16, MF17 / MR17, MF18 / MR18, MF19 / MR19, and MF28 / MR28 were synthesized by Suzhou Hongxun Biotechnology Co., Ltd.

[0089] Example 2

[0090] The present invention provides a method for developing markers for alfalfa chromosomes, such as Figure 1 As shown, the alfalfa chromosome marker development method comprises:

[0091] S101, based on the Xinjiang Daye genome, used Repeat Masker to remove the repetitive sequences of the Xinjiang Daye genome, divided the remaining genome sequences into 45 bp oligonucleotide sequences, aligned each oligonucleotide sequence back to the Xinjiang Daye genome, and removed oligo sequences with multiple alignment sites (homology > 75%);

[0092] In this embodiment, Repeat Masker is used to remove the repetitive sequences of Xinjiang Daye genome. Repetitive sequences include transposons, satellite DNA, microsatellite DNA, etc., which appear repeatedly in the genome.

[0093] S102, using Primer to calculate the melting temperature and hairpin melting temperature of each oligonucleotide, and retaining oligonucleotide sequences with dTm>10°C;

[0094] S103, 21 regions were selected on chromosomes 1-8 of alfalfa, the selected 21 regions were region 1, region 2, region 3, region 4, region 5, region 6, region 7, region 8, region 9, region 10, region 11, region 12, region 13, region 14, region 15, region 16, region 17, region 18, region 19, region 20, and region 21, each region contained 4800 oligonucleotides, different regions in the same chromosome were spaced 3.8-5.0 Mb apart, left and right primers were added to these 21 regions;

[0095] S104, using the oligonucleotide sequence pool as a template, using the synthesized specific primers to perform PCR to amplify the oligonucleotide sequence of the selected region of each chromosome into an oligo probe with fluorescent modification, Figure 2 A schematic diagram of a fluorescently modified oligo probe provided in an embodiment of the present invention is shown.

[0096] It should be noted that the PCR amplification system is 50 μL, including 1 μL template, 1 μL upstream and downstream primers each, 25 μL HiFi Mix, and 22 μL ddH2O. For the PCR amplification reaction, first perform pre-denaturation at 95°C for 2 min; perform 15 cycles of denaturation at 98°C for 20 s, annealing at 60°C for 20 s, and extension at 72°C for 30 s; perform 25 cycles of denaturation at 98°C for 20 s, annealing at 55°C for 30 s, and extension at 72°C for 30 s, and finally extend at 72°C for 1 min, and store at 4°C.

[0097] In this embodiment, the selected 21 regional oligonucleotide sequence probes with fluorescent modifications are Ms1.1, Ms1.2, Ms2.1, Ms2.2, Ms3.1, Ms3.2, Ms3.3, Ms4.1, Ms4.2, Ms4.3, Ms5.1, Ms5.2, Ms6.1, Ms6.2, Ms6.3, Ms7.1, Ms7.2, Ms7.3, Ms8.1, Ms8.2, Ms8.3;

[0098] Among them, probes Ms1.1, Ms1.2, Ms3.1, Ms3.2, Ms3.3, Ms4.2, Ms4.3, Ms5.2, Ms6.2, Ms7.1, Ms7.3, and Ms8.1 were modified with TAMRA;

[0099] Probes Ms2.1, Ms2.2, Ms4.1, Ms5.1, Ms6.1, Ms6.3, Ms7.2, Ms8.2, and Ms8.3 are modified with FAM.

[0100] The embodiment of the present invention provides a marker development method for alfalfa chromosomes. Repeat Masker is used to remove Xinjiang large-leaf genome repetitive sequences, and the remaining genome sequences are divided into 45bp oligonucleotide sequences. 21 regions are selected on alfalfa chromosomes 1-8, and a pool of oligonucleotide sequences is used as a template. PCR is performed using synthesized specific primers to amplify the oligonucleotide sequences of the selected regions of each chromosome into oligo probes with fluorescence modification, so that only the oligonucleotide sequences of the target regions can be amplified under different environments, thereby improving the specificity of the marker, being able to clearly display the specific regions of the chromosomes at the cytological level, and being helpful to more accurately identify chromosome aberrations and variations. A large amount of genetic information can be obtained by marking and analyzing multiple chromosome regions, which is helpful to deeply understand the genetic diversity, evolutionary history and kinship of alfalfa.

[0101] Example 3

[0102] The present invention also provides a fluorescence in situ hybridization method for efficiently identifying alfalfa chromosomes. Figure 3 As shown, the fluorescent in situ hybridization identification method for efficiently identifying alfalfa chromosomes specifically includes:

[0103] S201, preparation of metaphase chromosomes: young and tender root tips of Xinjiang Daye, Zhongmu No. 1 and Lei Ting were selected and pretreated in actinomycin for 2 hours to enrich metaphase chromosomes, and then fixed with fixative, wherein the fixative was a mixture of anhydrous ethanol and acetic acid in a volume ratio of 3:1. After that, the root cap and elongation zone were removed, and the cell walls were removed with 4% R-10 cellulase, 2% pect pectinase, 2% RS cellulase and 1% Y-23 pectinase, and the slices were made by the "liquid nitrogen freezing and knocking method".

[0104] In the present embodiment, adopting " liquid nitrogen freezing knocking film method " to prepare alfalfa chromosome sample is an effective cytological film making technology, is particularly suitable for experiments such as fluorescence in situ hybridization (FISH) that need to keep chromosome morphology and structural integrity, when " liquid nitrogen freezing knocking film method " prepares sample, takes out young and tender root tip from Xinjiang big leaf, Zhongmu No. 1, and Lei Ting young and tender, puts into Carno's fixative (usually 3: 1 ethanol and acetic acid mixture) and fixes for 30min immediately, thereby keeps the morphology of chromosome.Then rinse the root tip after fixing with distilled water, immerse in certain concentration of cellulase and pectinase solution, enzymolysis for a period of time at an appropriate temperature, to remove cell wall, cell membrane.Rinse the root tip after enzymolysis with distilled water again, then utilize fixative fixation treatment.Put the root tip after treatment on a clean slide, knock the cell out with a knocking needle, then quickly put the slide into liquid nitrogen and freeze for a few seconds.Take out the slide subsequently, dry at room temperature, finally store in -20 ℃ refrigerator for standby use.

[0105] S202, hybridization: prepare a hybridization solution containing 3ul of 50% dextran sulfate, 7.5ul of deionized formamide, 1.5ul / 20×SSC, and 400ng of oligo probe. Denature the slides at 85°C for 5min, dehydrate them in a gradient of 70% and 100% ethanol at -20°C, drop the hybridization solution on the slides, and hybridize them at 37°C overnight.

[0106] S203, elution: Elute the slide in 2×SSC solution for 3 times and in 1×PBS solution once, with the elution time being 5 min each time. Rinse with distilled water, add DAPI after the slide is dry, and cover with a coverslip for chromosome re-staining.

[0107] S204, image acquisition: Use a fluorescence microscope to acquire images and present the distribution of oligo probes on chromosomes. Figure 4 The hybridization results of alfalfa chromosome markers in tetraploid alfalfa Xinjiang Daye, Leiting, and Zhongmu No. 1 are shown, among which, Figure 4 In the figure, (a1-a3): chromosomes in metaphase of mitosis; (b1-b3): signal diagrams of probes with TAMRA fluorescence modification (red); (c1-c3): signal diagrams of probes with FAM fluorescence modification (green); (d1-d3): barcode probes identifying alfalfa chromosomes.

[0108] from Figure 4 It is concluded that by performing fluorescence in situ hybridization identification on alfalfa chromosomes, the six pairs of primers provided by the present invention obtain 21 marker sites based on different amplification templates, and these marker sites are relatively stable and can be used for the identification of high-yield and high-protein alfalfa materials. Therefore, the markers developed above for efficient identification of alfalfa chromosomes can be combined with traditional breeding methods to accelerate the cultivation of new high-yield and high-quality alfalfa varieties.

[0109] In summary, the present invention provides a marker for efficiently identifying alfalfa chromosomes and an application thereof. The marker for efficiently identifying alfalfa chromosomes provided by the present invention can efficiently and accurately identify the markers of alfalfa chromosomes 1-8, can identify chromosomes 1-8 in alfalfa at one time, can quickly distinguish different chromosomes, greatly shortens the identification time, improves work efficiency, helps to understand the genetic diversity of alfalfa, facilitates hybridization by selecting individuals with excellent traits, and cultivates new varieties that are more adapted to market demand. The marker is a favorable tool for chromosome identification, karyotype research, evolution and diversity research of alfalfa.

[0110] The invention provides a marker development method for alfalfa chromosomes. Repeat Masker is used to remove Xinjiang bigleaf genome repetitive sequences, and the remaining genome sequences are divided into 45bp oligonucleotide sequences. 21 regions are selected on alfalfa chromosomes 1 to 8, and a PCR is performed using an oligonucleotide sequence pool as a template and synthesized specific primers to amplify the oligonucleotide sequences of the selected regions of each chromosome into oligo probes with fluorescence modification, so that only the oligonucleotide sequences of the target regions can be amplified under different environments, thereby improving the specificity of the marker, being able to clearly display the specific regions of the chromosomes at the cytological level, and being helpful to more accurately identify chromosome aberrations and variations. A large amount of genetic information can be obtained by marking and analyzing multiple chromosome regions, and being helpful to deeply understand the genetic diversity, evolutionary history and kinship of alfalfa.

[0111] It should be noted that, for the above-mentioned embodiments, for the sake of simplicity, they are all described as a series of action combinations, but those skilled in the art should know that the present invention is not limited by the described order of actions, because according to the present invention, some steps may be performed in other orders or simultaneously. Secondly, those skilled in the art should also know that the embodiments described in the specification are all preferred embodiments, and the actions and modules involved are not necessarily required by the present invention.

[0112] The above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit the scope of protection of the invention. Obviously, the described embodiments are only some embodiments of the present invention, rather than all embodiments. Based on these embodiments, all other embodiments obtained by ordinary technicians in this field without making creative work are within the scope of protection of the present invention. Although the present invention has been described in detail with reference to the above embodiments, ordinary technicians in this field can still combine, add, delete or make other adjustments to the features in the various embodiments of the present invention according to the circumstances without conflict, without making creative work, so as to obtain different other technical solutions that do not deviate from the concept of the present invention in essence, and these technical solutions also belong to the scope of protection of the present invention.

Claims

1. A marker for efficiently identifying alfalfa chromosomes, characterized in that: The marker for efficiently identifying alfalfa chromosomes is used to identify chromosomes 1-8 of alfalfa. The marker for alfalfa chromosomes is located on chromosomes 1-8 of alfalfa. The marker for alfalfa chromosomes consists of 6 pairs of alfalfa-specific sequence amplification primers. The 6 pairs of primers for alfalfa chromosomes include: MF5 / MR5, MF16 / MR16, MF17 / MR17, MF18 / MR18, MF19 / MR19, MF28 / MR28; Among them, the markers of alfalfa chromosomes are 21 single copy sequences distributed in specific regions of 8 alfalfa chromosomes. A total of 21 regions were selected in the 8 alfalfa chromosomes, each containing 4,800 oligonucleotides. The selected 21 regions were region 1, region 2, region 3, region 4, region 5, region 6, region 7, region 8, region 9, region 10, region 11, region 12, region 13, region 14, region 15, region 16, region 17, region 18, region 19, region 20, and region 21.

2. The marker for efficiently identifying alfalfa chromosomes as claimed in claim 1, characterized in that: The sequence of the sequence amplification primer pair MF5 / MR5 is: MF5:CAACCACTTCATCAGTTGGA; MR5:TGTTTTGAAGGTGACAAACC; The sequence of the primer pair MF16 / MR16 for sequence amplification is: MF16: ACACCATGGACCAAAACCAT; MR16:CGTTTACGAGGTTCACGGAT.

3. The marker for efficiently identifying alfalfa chromosomes as claimed in claim 2, characterized in that: The sequence amplification primer pair MF17 / MR17 sequence is: MF17:AAAGTGCCCGAGAGCATAGA; MR17:TTCCTTCCTAATGATCGCAA; The sequence of the primer pair MF18 / MR18 for sequence amplification is: MF18:AAATCCACGTTCTTCAACCG; MR18: AAGGAGCCAAACACATCGTC.

4. The marker for efficiently identifying alfalfa chromosomes as claimed in claim 3, characterized in that: The sequence of the sequence amplification primer pair MF19 / MR19 is: MF19: ACACTCAACCGTGTCATTGG; MR19:TACATGATGGAATGCGAGGA; The sequence of the primer pair MF28 / MR28 for sequence amplification is: MF28:TGGTTTGAGAGGGAAAGAAC; MR28: GGCTGCTCTGGATACATTTT.

5. The marker for efficiently identifying alfalfa chromosomes as claimed in claim 1, characterized in that: Primers were added left and right to the oligonucleotide sequences of the 21 selected regions; Among them, the oligo sequences of region 1, region 3, region 5, region 8, region 11, region 13, region 16, and region 19 used primers MF5 / MR5; The oligo sequences of region 2, region 4, region 7, region 10, region 12, region 15, region 18, and region 21 were amplified using primers MF28 / MR28.

6. The marker for efficiently identifying alfalfa chromosomes as claimed in claim 5, characterized in that: The primers used in region 6 are MF17 / MR17, the primers used in region 9 are MF19 / MR19, the primers used in region 14 are MF16 / MR16, and the primers used in regions 17 and 20 are MF18 / MR18.

7. The marker for efficiently identifying alfalfa chromosomes as claimed in claim 1, characterized in that: The alfalfa chromosome marker development method comprises: S101, based on the Xinjiang Daye genome, used Repeat Masker to remove the repetitive sequences of the Xinjiang Daye genome, divided the remaining genome sequences into 45 bp oligonucleotide sequences, aligned each oligonucleotide sequence back to the Xinjiang Daye genome, and removed oligo sequences with multiple alignment sites; S102, using Primer to calculate the melting temperature and hairpin melting temperature of each oligonucleotide, and retaining oligonucleotide sequences with dTm>10°C; S103, 21 regions were selected on chromosomes 1-8 of alfalfa, the selected 21 regions were region 1, region 2, region 3, region 4, region 5, region 6, region 7, region 8, region 9, region 10, region 11, region 12, region 13, region 14, region 15, region 16, region 17, region 18, region 19, region 20, and region 21, each region contained 4800 oligonucleotides, different regions in the same chromosome were spaced 3.8-5.0 Mb apart, left and right primers were added to these 21 regions; S104, using the oligonucleotide sequence pool as a template, using the synthesized specific primers to perform PCR to amplify the oligonucleotide sequence of the selected region of each chromosome into an oligo probe with fluorescent modification.

8. The marker for efficiently identifying alfalfa chromosomes as claimed in claim 7, characterized in that: The selected 21 regional oligonucleotide sequence probes with fluorescent modification are Ms1.1, Ms1.2, Ms2.1, Ms2.2, Ms3.1, Ms3.2, Ms3.3, Ms4.1, Ms4.2, Ms4.3, Ms5.1, Ms5.2, Ms6.1, Ms6.2, Ms6.3, Ms7.1, Ms7.2, Ms7.3, Ms8.1, Ms8.2, Ms8.3; Among them, probes Ms1.1, Ms1.2, Ms3.1, Ms3.2, Ms3.3, Ms4.2, Ms4.3, Ms5.2, Ms6.2, Ms7.1, Ms7.3, and Ms8.1 were modified with TAMRA; Probes Ms2.1, Ms2.2, Ms4.1, Ms5.1, Ms6.1, Ms6.3, Ms7.2, Ms8.2, and Ms8.3 are modified with FAM.

9. The marker for efficiently identifying alfalfa chromosomes as claimed in claim 1, characterized in that: The fluorescent in situ hybridization identification method for efficiently identifying alfalfa chromosomes comprises: S201, preparation of metaphase chromosomes: young root tips of Xinjiang Daye, Zhongmu No. 1 and Leiting were selected and pretreated in actinomycin for 2 hours to enrich metaphase chromosomes, and then fixed with a fixative, wherein the fixative was a mixture of anhydrous ethanol and acetic acid in a volume ratio of 3:

1. After that, the root cap and elongation zone were cut off, and the cell wall was removed with 4% R-10 cellulase, 2% pect pectinase, 2% RS cellulase and 1% Y-23 pectinase, and the slides were prepared by the "liquid nitrogen freezing and knocking method"; S202, hybridization: prepare a hybridization solution containing 3ul of 50% dextran sulfate, 7.5ul of deionized formamide, 1.5ul / 20×SSC, and 400ng of oligo probe, denature the slide at 85°C for 5min, dehydrate in 70% and 100% ethanol at -20°C, drop the hybridization solution on the slide, and hybridize at 37°C overnight; S203, elution: the slides were eluted in 2×SSC solution for 3 times and in 1×PBS solution for 5 min each time, and then rinsed with distilled water. After the slides were dried, DAPI was added and coverslips were placed for chromosome counterstaining. S204, image acquisition: using a fluorescence microscope to acquire images to present the distribution of the oligo probes on the chromosomes.

10. Use of the marker for efficiently identifying alfalfa chromosomes as claimed in claims 1 and 9 in any of the following: (1) Alfalfa chromosome identification; (2) Alfalfa staining karyotype study; (3) Alfalfa breeding; (4) Molecular marker-assisted breeding of alfalfa.

Images