Application of YOD1 gene in preparation of medicine for treating rhabdomyosarcoma

Abstract

The invention discloses application of a YOD1 gene in preparation of a medicine for treating rhabdomyosarcoma. According to the invention, YOD1 is deeply analyzed to jointly regulate and control the protein stability of PAX3-FOXO1 and N-Myc, and after a tetracycline regulation and control system is adopted to induce and reduce the expression of YOD1, the clone formation ability of FOXO1 fusion positive rhabdomyosarcoma cells with high expression of N-Myc and the growth of xenotransplantation tumors are remarkably inhibited. Therefore, the invention not only discloses the application of the YOD1 gene, but also provides a new therapeutic target for FOXO1 fusion positive rhabdomyosarcoma cells with high expression of N-Myc.

Description

Technical Field

[0001] The invention belongs to the field of medical biotechnology, and specifically relates to an application of a YOD1 (YOD1 deubiquitinase) gene in preparing a drug for treating rhabdomyosarcoma. Background Art

[0002] Rhabdomyosarcoma is the most common soft tissue sarcoma in children, with high malignancy and poor prognosis. FOXO1 fusion-positive rhabdomyosarcoma is a subtype of rhabdomyosarcoma driven by PAX3-FOXO1 or PAX7-FOXO1, and is the subtype with the worst prognosis among all rhabdomyosarcomas. Studies have shown that FOXO1 fusion protein is a key factor that specifically drives the malignant evolution of rhabdomyosarcoma, and is closely related to the patient's malignant phenotypes such as recurrence, metastasis, and drug insensitivity, and is an important indicator for clinical judgment of poor prognosis of patients. Clinically, approximately 76% of FOXO1 fusion-positive rhabdomyosarcoma patients show abnormal activation of N-Myc protein function, and there is a significant positive correlation between N-Myc protein expression and poor prognosis of rhabdomyosarcoma patients. Therefore, discovering key intervention targets for rhabdomyosarcoma around FOXO1 fusion protein and N-Myc, and exploring new strategies for effective intervention based on new targets are one of the core scientific issues in this field, and there is an urgent clinical need.

[0003] YOD1 protein belongs to the family of deubiquitinating enzymes, ovarian tumor proteases, and can specifically catalyze the hydrolysis of ubiquitin molecules from substrate proteins. At present, there are few reports on the research of YOD1 protein, mainly including: 1) YOD1 protein can promote the activation of Hippo signaling pathway by inhibiting the ubiquitination level of LATS E3 ligase ITCH, and is considered to be a potential target for the treatment of liver cancer; 2) It promotes the occurrence and development of pancreatic adenocarcinoma by affecting the tumor microenvironment; 3) YOD1 expression levels are increased in a variety of cancer tissues, including pancreatic cancer, non-small cell lung cancer and triple-negative breast cancer, and its expression level is closely related to the poor prognosis of patients. These studies suggest that YOD1 protein may be involved in the occurrence and development of tumors, but the role of YOD1 protein in FOXO1 fusion-positive rhabdomyosarcoma with high expression of N-Myc has not been clearly reported in the literature. Therefore, the role of YOD1 protein in FOXO1 fusion-positive rhabdomyosarcoma with high expression of N-Myc needs further study. Summary of the invention

[0004] The purpose of the present invention is to provide an application of a YOD1 gene in the preparation of a drug for treating rhabdomyosarcoma, wherein the nucleotide sequence of the YOD1 gene is shown in SEQ ID NO: 1, and the amino acid sequence targeting the YOD1 gene is shown in SEQ ID NO: 2. The nucleotide sequences of the interfering siRNAs are: SEQ ID NO:3:5'GAGTACTGTGACTGGATCAAA3'(﹟1) SEQ ID NO: 4: 5'CCAGAAGTTCACCTGCATTTA3'(﹟2).

[0005] The rhabdomyosarcoma involves rhabdomyosarcoma that is FOXO1 fusion-positive and accompanied by high expression of N-Myc.

[0006] The YOD1 gene reduces the ubiquitination of FOXO1 fusion protein and N-Myc through its deubiquitinating activity, and plays a role in stabilizing FOXO1 fusion protein and N-Myc. By inhibiting the activity of the YOD1 gene, the expression of FOXO1 fusion protein and N-Myc protein can be simultaneously inhibited, which is of great significance for the clinical treatment of FOXO1 fusion-positive rhabdomyosarcoma and FOXO1 fusion-positive rhabdomyosarcoma patients with high expression of N-Myc, and provides a new treatment strategy.

[0007] The present invention achieves the effect of downregulating YOD1 by using a tetracycline regulatory system and siRNAs targeting the YOD1 gene, thereby studying the effect of inhibiting YOD1 in the growth of rhabdomyosarcoma with FOXO1 fusion positive accompanied by high expression of N-Myc. siRNAs targeting the YOD1 gene (SEQ ID NO: 3; SEQ ID NO: 4) can inhibit the expression of YOD1 and induce the degradation of FOXO1 fusion protein and N-Myc protein, thereby inhibiting the growth of rhabdomyosarcoma with FOXO1 fusion positive accompanied by high expression of N-Myc. Specifically, downregulating YOD has a significant inhibitory effect on the cloning ability of rhabdomyosarcoma Rh30 cells with FOXO1 fusion positive accompanied by high expression of N-Myc, and has a significant inhibitory effect on the growth of Rh30 xenograft tumors.

[0008] The present invention uses RNA interference technology to reduce YOD1, which can significantly inhibit the growth of rhabdomyosarcoma with positive FOXO1 fusion and high expression of N-Myc. Therefore, the present invention not only discloses the application of the YOD1 gene, but also provides a new therapeutic target for rhabdomyosarcoma with positive FOXO1 fusion and high expression of N-Myc.

[0009] Specifically, inhibitors are developed targeting the YOD1 gene, including chemical drugs, peptide drugs and protein drugs that target the inhibition of YOD1 expression level or activity, so as to inhibit cell proliferation and thus fight rhabdomyosarcoma by downregulating YOD1 expression or inhibiting YOD1 activity.

[0010] The present invention utilizes siRNA interference technology to induce degradation of FOXO1 fusion protein and N-Myc protein by reducing the expression of YOD1, thereby inhibiting the growth of rhabdomyosarcoma. Therefore, it is proposed for the first time that the YOD1 gene is a key gene for the malignant progression of rhabdomyosarcoma with positive FOXO1 fusion accompanied by high expression of N-Myc, and the siRNAs molecules of YOD1 can be used as an effective intervention method for the treatment of rhabdomyosarcoma with positive FOXO1 fusion accompanied by high expression of N-Myc.

[0011] The drug is in the form of a liquid preparation or a solid preparation.

[0012] Compared with the prior art, the present invention has the following beneficial effects: The present invention provides a use of YOD1 siRNA in preparing a therapeutic drug for rhabdomyosarcoma with FOXO1 fusion-positive accompanied by high expression of N-Myc. YOD1 reduces the ubiquitination of FOXO1 fusion protein and N-Myc through its deubiquitinating activity, and plays a role in stabilizing FOXO1 fusion protein and N-Myc. Down-regulating YOD1 can effectively inhibit the cloning ability and growth of xenograft tumors of rhabdomyosarcoma with FOXO1 fusion-positive accompanied by high expression of N-Myc, and provides a new direction for the development of therapeutic drugs for rhabdomyosarcoma with FOXO1 fusion-positive accompanied by high expression of N-Myc, and to a certain extent solves the embarrassing situation that there are few available drugs and a single mechanism for rhabdomyosarcoma with FOXO1 fusion-positive accompanied by high expression of N-Myc in clinical practice. In short, down-regulating YOD1 can inhibit the cloning ability and growth of xenograft tumors of rhabdomyosarcoma with FOXO1 fusion-positive, and provides the possibility for preparing new rhabdomyosarcoma drugs with FOXO1 fusion-positive, improving the efficacy of patients, and improving prognosis and survival. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 Two siRNAs targeting the YOD1 gene (SEQ ID NO: 3; SEQ ID NO: 4) both have the effects of significantly downregulating the protein expression of YOD1 and promoting the degradation of FOXO1 fusion protein and N-Myc protein.

[0014] Figure 2 It shows that YOD1 can inhibit the ubiquitination level of FOXO1 fusion protein and N-Myc. A shows the regulation of FOXO1 fusion protein ubiquitination level by YOD1 and its enzyme-active mutant YOD1-C160S; B shows the regulation of N-Myc ubiquitination level by YOD1 and its enzyme-active mutant YOD1-C160S.

[0015] Figure 3The tetracycline regulatory system is combined with siRNA (SEQ ID NO: 3) targeting the YOD1 gene and applied to the rhabdomyosarcoma Rh30 cells that are FOXO1 fusion-positive and accompanied by high expression of N-Myc. The cloning ability of Rh30 cells is significantly inhibited. Figure 4 The tetracycline regulatory system is combined with siRNA (SEQ ID NO: 3) targeting the YOD1 gene and applied to rhabdomyosarcoma xenograft tumors that are FOXO1 fusion-positive and accompanied by high expression of N-Myc, and the growth of the xenograft tumors is significantly inhibited. DETAILED DESCRIPTION

[0016] The present invention will be further described in detail below in conjunction with the accompanying drawings and examples. The following examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention.

[0017] The experimental methods for which specific conditions are not specified in the examples are generally carried out under conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or under conditions recommended by the manufacturer.

[0018] The application of the YOD1 gene described in the present invention can refer to conventional drug preparation methods and actual development. The drug dosage form and biological preparation are any dosage form recognized in medicine, such as powder, injection, capsule, tablet or oral solution.

[0019] Embodiment 1: Two YOD1 siRNAs targeting different sequences (SEQ ID NO: 3; SEQ ID NO: 4) and a negative control NC were introduced into rhabdomyosarcoma cells Rh30 by liposome transfection. The cells were harvested 72 hours later, lysed with cell lysis buffer, and then Western blot experiments were performed using YOD1 antibody (purchased from Proteintech), FOXO1 antibody (purchased from Cell Signal Technology) and N-Myc antibody (purchased from Cell Signal Technology).

[0020] The results are as follows Figure 1As shown, two siRNAs targeting the YOD1 gene (SEQ ID NO: 3; SEQ ID NO: 4) both significantly down-regulated the protein expression of YOD1 and induced the degradation of FOXO1 fusion protein and N-Myc protein. These results indicate that targeting the YOD1 gene can intervene in the stability of key proteins in rhabdomyosarcoma with FOXO1 fusion-positive and N-Myc high expression, providing an experimental basis for the development of new treatment strategies.

[0021] Embodiment 2: HEK-293T cells were co-transfected with PAX3-FOXO1-HA or N-Myc-HA, YOD1-Flag or YOD1-C160S-Flag (enzymatic mutant of YOD1) and His-Ub, and then treated with 8 μmol / L MG132 for 12 hours to enhance the effect of protein ubiquitination. Cell extracts were immunoprecipitated with anti-HA antibody on agarose gel, and the ubiquitination of PAX3-FOXO1 and N-Myc was detected by Western blot using His antibody (purchased from Cell Signal Technology).

[0022] The results are as follows Figure 2 As shown, YOD1 overexpression significantly reduced the ubiquitination levels of PAX3-FOXO1 and N-Myc, while the YOD1-C160S mutant lacking catalytic activity failed to reduce the ubiquitination levels of these two proteins, confirming the necessity of the deubiquitinase activity of YOD1 for regulating the stability of PAX3-FOXO1 and N-Myc.

[0023] Embodiment 3: The siRNA (SEQ ID NO: 3) targeting the YOD1 gene and the negative control NC were stably transfected into the rhabdomyosarcoma Rh30 cells by lentivirus, digested and counted using a blood cell counting plate. (1) 1500 cells were inoculated into a six-well plate for clonal culture. A 1μg / ml tetracycline treatment group and a control group were set up respectively, and SRB was used for staining after 14 days. (2) 8000 cells were inoculated into a six-well plate for soft agar culture. A 1μg / ml tetracycline treatment group and a control group were set up respectively, and photos were taken after 14 days, and the area of ​​the cloned spheres was counted by imageJ.

[0024] The results are as follows Figure 3As shown, siRNA (SEQ ID NO: 3) targeting the YOD1 gene using the tetracycline regulatory system can significantly inhibit the cloning ability of Rh30 rhabdomyosarcoma cells with FOXO1 fusion-positive and high N-Myc expression. These results reveal the key role of the YOD1 gene in maintaining the cloning of Rh30 rhabdomyosarcoma cells and provide a scientific basis for using siRNA technology to regulate YOD1 gene expression to treat specific types of rhabdomyosarcoma.

[0025] Embodiment 4: The siRNA (SEQ ID NO: 3) targeting the YOD1 gene and the negative control NC were stably transfected into the rhabdomyosarcoma Rh30 cells by lentivirus, digested and counted using a hemocytometer, and resuspended in 100 μl of serum-free culture medium at 4×10 6 The cells were inoculated in the armpits of nude mice, which were fed with tetracycline feed and ordinary feed respectively. The growth of the transplanted tumors in nude mice was monitored continuously for four weeks.

[0026] The results are as follows Figure 4 As shown, siRNA (SEQ ID NO: 3) targeting the YOD1 gene using the tetracycline regulatory system can significantly inhibit the growth of xenograft tumors of rhabdomyosarcoma cells Rh30. This result emphasizes the importance of the YOD1 gene in the development of rhabdomyosarcoma and confirms that downregulating the expression of the YOD1 gene by siRNA technology is an effective therapeutic strategy that can inhibit tumor growth, providing experimental support for the development of new anti-tumor drugs.

Claims

1. A use of a YOD1 deubiquitinase gene in the preparation of a drug for treating rhabdomyosarcoma, characterized in that: The nucleotide sequence of the YOD1 deubiquitinase gene is shown in SEQ ID NO:1, and the amino acid sequence of the targeted YOD1 deubiquitinase gene is shown in SEQ ID NO:

2.

2. The nucleotide sequences of the interfering siRNAs of the YOD1 deubiquitinase gene according to claim 1 are respectively: SEQ ID NO:3:5'GAGTACTGTGACTGGATCAAA3' SEQ ID NO: 4: 5'CCAGAAGTTCACCTGCATTTA3'.

3. The use according to claim 1, characterized in that: The rhabdomyosarcoma is a rhabdomyosarcoma that is FOXO1 fusion-positive and accompanied by high expression of N-Myc.

4. The use according to claim 1, characterized in that: The application is that YOD1 reduces the ubiquitination of FOXO1 fusion protein and N-Myc through its deubiquitination activity, thereby stabilizing FOXO1 fusion protein and N-Myc.

5. The use according to claim 1, characterized in that: The drug is in the form of a liquid preparation or a solid preparation.

Images