Application of MODICA gene and / or MODICA protein in preparation of medicine for improving cardiac dysfunction

Abstract

The invention discloses an application of an MODICA gene and / or an MODICA protein in preparation of a medicine for improving cardiac dysfunction. The invention provides a new target for treating cardiac dysfunction, overexpression of the MODICA can significantly relieve myocardial injury, inhibit fibrosis of cardiac tissues and reduce myocardial cell apoptosis, has great significance in clinical treatment of cardiac dysfunction related diseases and prevention of cardiovascular events caused by anti-tumor treatment, and has a wide application prospect. And a new technical choice is provided.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine technology, and in particular, to the use of MODICA gene and / or MODICA protein in preparing a medicine for improving cardiac dysfunction. Background Art

[0002] Cardiac dysfunction refers to a pathological state in which the heart's pumping capacity is impaired and cannot meet the body's metabolic needs due to structural or functional abnormalities. The main symptoms include dyspnea, fatigue, palpitations, acute heart failure, cardiogenic shock, etc. Myocardial injury is one of the important causes of cardiac dysfunction. When the myocardium is injured, whether through acute events or chronic processes, it may directly affect the heart's pumping efficiency. Over time, if cardiac damage is not properly treated, it may lead to permanent and irreversible structural changes, such as myocardial fibrosis and massive apoptosis of myocardial cells, further aggravating cardiac dysfunction. Therefore, timely diagnosis and treatment of cardiac damage is the key to improving cardiac dysfunction.

[0003] At present, the main treatments for cardiac dysfunction include: drug therapy with beta-blockers, angiotensin-converting enzyme inhibitors (ACEI), diuretics and calcium channel blockers to improve hemodynamics and reduce cardiac load; device therapy with implantable cardioverter-defibrillators (ICD) or cardiac resynchronization therapy (CRT) for some patients with arrhythmias; severe cases may require surgical heart transplantation or installation of ventricular assist devices (VAD) and other auxiliary circulation devices. Despite the continuous progress in treatment methods, the morbidity and mortality of cardiac dysfunction are still high, and new treatment strategies and targets need to be further explored.

[0004] In addition, anthracyclines are currently the most effective class of chemotherapy drugs, but they have significant cardiotoxicity. Cardiovascular events (myocardial damage, hypertension, arrhythmia, thrombosis, heart failure, etc.) caused during chemotherapy in cancer patients are an important cause of death in cancer patients, seriously affecting the prognosis of patients, so they cannot be widely used in clinical practice. Therefore, understanding the mechanism of action of anthracyclines causing cardiotoxicity and finding intervention targets for protecting heart function during the use of this type of drug are crucial for its clinical application and even for cancer patients in the entire public health system. Summary of the invention

[0005] In order to solve the above problems existing in the prior art, the present invention provides the use of MODICA gene and / or MODICA protein in preparing a drug for improving cardiac dysfunction.

[0006] The first object of the present invention is to provide the use of MODICA gene and / or MODICA protein in preparing a drug for improving cardiac dysfunction.

[0007] The second object of the present invention is to provide the use of MODICA gene and / or MODICA protein in the preparation of drugs for alleviating and / or treating cardiac damage.

[0008] The third object of the present invention is to provide the use of MODICA gene and / or MODICA protein in the preparation of drugs for inhibiting myocardial fibrosis.

[0009] The fourth object of the present invention is to provide the use of MODICA gene and / or MODICA protein in the preparation of a drug for reducing the cardiotoxicity of anthracycline antibiotics.

[0010] The fifth object of the present invention is to provide the use of a biomaterial for increasing the expression of MODICA gene and / or MODICA protein in the preparation of a drug for improving cardiac dysfunction.

[0011] The sixth object of the present invention is to provide the use of a biomaterial for increasing the expression of MODICA gene and / or MODICA protein in the preparation of a drug for alleviating and / or treating cardiac damage.

[0012] The seventh object of the present invention is to provide the use of a biomaterial for increasing the expression of MODICA gene and / or MODICA protein in the preparation of a drug for inhibiting myocardial fibrosis.

[0013] The eighth object of the present invention is to provide the use of a biomaterial for increasing the expression of MODICA gene and / or MODICA protein in the preparation of a drug for reducing the cardiotoxicity of anthracycline antibiotics.

[0014] The ninth object of the present invention is to provide a composition.

[0015] In order to achieve the above object, the present invention is implemented by the following scheme:

[0016] Current studies have shown that mitochondrial damage is a key factor in DOX cardiotoxicity. With the development of technology, many micropeptide molecules have been found to be located in mitochondria, but their functions are unknown, and the role of mitochondrial micropeptides in cardiac dysfunction has not been studied in depth. The present invention found that MODICA protein (i.e., Smim26 protein) is a conserved mitochondrial micropeptide between species. In the in vivo and in vitro DOX injury models, MODICA gene and MODICA protein are significantly downregulated. In vivo and in vitro overexpression experiments have shown that overexpression of MODICA protein can protect the activity of myocardial cells, reduce the level of myocardial cell apoptosis caused by DOX, and even reduce the level of apoptosis and fibrosis of cardiac tissue, thereby protecting cardiac function.

[0017] Therefore, the present invention requests protection for the following contents:

[0018] Use of MODICA gene and / or MODICA protein in the preparation of a drug for improving cardiac dysfunction, wherein the amino acid sequence of the MODICA protein is shown in any one of SEQ ID NOs. 1 to 7.

[0019] Preferably, the amino acid sequence of the MODICA protein is shown as SEQ ID NO.2 or SEQ ID NO.3.

[0020] Use of the MODICA gene and / or MODICA protein in the preparation of a drug for improving cardiac dysfunction caused by anthracycline antibiotics, wherein the amino acid sequence of the MODICA protein is shown in any one of SEQ ID NOs. 1 to 7.

[0021] Preferably, the anthracycline antibiotic comprises doxorubicin.

[0022] Preferably, the amino acid sequence of the MODICA protein is shown as SEQ ID NO.2 or SEQ ID NO.3.

[0023] Use of the MODICA gene and / or MODICA protein in the preparation of a drug for alleviating and / or treating cardiac damage, wherein the amino acid sequence of the MODICA protein is shown in any one of SEQ ID NOs. 1 to 7.

[0024] Preferably, the amino acid sequence of the MODICA protein is shown as SEQ ID NO.2 or SEQ ID NO.3.

[0025] Use of the MODICA gene and / or MODICA protein in the preparation of a drug for alleviating and / or treating cardiac damage caused by anthracycline antibiotics, wherein the amino acid sequence of the MODICA protein is shown in any one of SEQ ID NOs. 1 to 7.

[0026] Preferably, the anthracycline antibiotic comprises doxorubicin.

[0027] Preferably, the amino acid sequence of the MODICA protein is shown as SEQ ID NO.2 or SEQ ID NO.3.

[0028] Use of the MODICA gene and / or MODICA protein in the preparation of a drug for inhibiting myocardial fibrosis, wherein the amino acid sequence of the MODICA protein is shown in any one of SEQ ID NOs. 1 to 7.

[0029] Preferably, the amino acid sequence of the MODICA protein is shown as SEQ ID NO.2 or SEQ ID NO.3.

[0030] Use of the MODICA gene and / or MODICA protein in the preparation of a drug for inhibiting myocardial fibrosis caused by anthracycline antibiotics, wherein the amino acid sequence of the MODICA protein is shown in any one of SEQ ID NOs. 1 to 7.

[0031] Preferably, the anthracycline antibiotic comprises doxorubicin.

[0032] Preferably, the amino acid sequence of the MODICA protein is shown as SEQ ID NO.2 or SEQ ID NO.3.

[0033] Use of MODICA gene and / or MODICA protein in the preparation of a drug for reducing myocardial cell apoptosis and / or improving myocardial cell vitality, wherein the amino acid sequence of the MODICA protein is shown in any one of SEQ ID NOs. 1 to 7.

[0034] Preferably, the amino acid sequence of the MODICA protein is shown as SEQ ID NO.2 or SEQ ID NO.3.

[0035] Use of MODICA gene and / or MODICA protein in the preparation of a drug for reducing myocardial cell apoptosis and / or low myocardial cell viability caused by anthracycline antibiotics, wherein the amino acid sequence of the MODICA protein is shown in any one of SEQ ID NOs. 1 to 7.

[0036] Preferably, the anthracycline antibiotic comprises doxorubicin.

[0037] Preferably, the amino acid sequence of the MODICA protein is shown as SEQ ID NO.2 or SEQ ID NO.3.

[0038] Use of MODICA gene and / or MODICA protein in the preparation of drugs for reducing the cardiotoxicity of anthracycline antibiotics.

[0039] Preferably, the anthracycline antibiotic comprises doxorubicin.

[0040] Preferably, the amino acid sequence of the MODICA protein is shown as SEQ ID NO.2 or SEQ ID NO.3.

[0041] Preferably, the cardiac toxicity includes at least one of the following (1) to (3): (1) myocardial cell apoptosis; (2) myocardial fibrosis; (3) low myocardial cell viability.

[0042] Use of a biomaterial for increasing the expression of a MODICA gene and / or a MODICA protein in preparing a drug for improving cardiac dysfunction, wherein the amino acid sequence of the MODICA protein is shown in any one of SEQ ID NOs. 1 to 7.

[0043] Preferably, the biological material is at least one of the following (1) to (4): (1) a recombinant expression vector expressing the MODICA protein; (2) an expression cassette containing a nucleic acid molecule encoding the MODICA protein; (3) a recombinant expression vector containing the nucleic acid molecule described in (2); (4) a microorganism containing the recombinant expression vector described in (3).

[0044] Preferably, the amino acid sequence of the MODICA protein is shown as SEQ ID NO.2 or SEQ ID NO.3.

[0045] More preferably, the amino acid sequence of the MODICA protein is as shown in SEQ ID NO.2, and the nucleotide sequence of the nucleic acid molecule in (2) of the biological material is as shown in SEQ ID NO.9 or as the completely complementary sequence of the sequence shown in SEQ ID NO.9.

[0046] More preferably, the amino acid sequence of the MODICA protein is as shown in SEQ ID NO.3, and the nucleotide sequence of the nucleic acid molecule in (2) of the biological material is as shown in SEQ ID NO.10 or as the completely complementary sequence of the sequence shown in SEQ ID NO.10.

[0047] The present invention has no special limitation on the source and type of the recombinant expression vector in (1) or (3) of the biological material. Recombinant expression vectors including but not limited to lentiviral vectors, adenoviral vectors, retroviral vectors, adeno-associated viral vectors, etc. that can express the MODICA protein or carry the nucleic acid molecule encoding the MODICA protein can achieve the purpose of the present invention.

[0048] Preferably, the recombinant expression vector in (1) or (3) of the biological material comprises a lentiviral vector or an adeno-associated viral vector.

[0049] More preferably, the lentiviral vector comprises a pLenti-puro vector.

[0050] More preferably, the adeno-associated virus vector comprises a pAAV-cTNT-GFP-Palmd vector.

[0051] More preferably, the recombinant expression vector in (1) or (3) of the biological material further includes an auxiliary vector.

[0052] Further preferably, the recombinant expression vector includes a lentiviral vector, and the auxiliary vector includes a pMD2.G vector and a psPAX2 vector.

[0053] Further preferably, the recombinant expression vector includes an adeno-associated virus vector, and the auxiliary vector includes an AAV9-Rep / Cap vector and a pHelper vector.

[0054] The present invention has no special limitation on the source and type of the microorganism in (4) of the biological material. Microorganisms including but not limited to lentivirus, adenovirus, retrovirus, adeno-associated virus, etc. that can carry the recombinant expression vector and introduce it into the host can achieve the purpose of the present invention.

[0055] Preferably, the microorganism in (4) of the biological material comprises a lentivirus or an adeno-associated virus.

[0056] Use of a biomaterial for increasing the expression of MODICA gene and / or MODICA protein in the preparation of a drug for improving cardiac dysfunction caused by anthracycline antibiotics, wherein the amino acid sequence of the MODICA protein is shown in any one of SEQ ID NOs. 1 to 7.

[0057] Preferably, the anthracycline antibiotic comprises doxorubicin.

[0058] Preferably, the biological material is at least one of the following (1) to (4): (1) a recombinant expression vector expressing the MODICA protein; (2) an expression cassette containing a nucleic acid molecule encoding the MODICA protein; (3) a recombinant expression vector containing the nucleic acid molecule described in (2); (4) a microorganism containing the recombinant expression vector described in (3).

[0059] Preferably, the amino acid sequence of the MODICA protein is shown as SEQ ID NO.2 or SEQ ID NO.3.

[0060] More preferably, the amino acid sequence of the MODICA protein is as shown in SEQ ID NO.2, and the nucleotide sequence of the nucleic acid molecule in (2) of the biological material is as shown in SEQ ID NO.9 or as the completely complementary sequence of the sequence shown in SEQ ID NO.9.

[0061] More preferably, the amino acid sequence of the MODICA protein is as shown in SEQ ID NO.3, and the nucleotide sequence of the nucleic acid molecule in (2) of the biological material is as shown in SEQ ID NO.10 or as the completely complementary sequence of the sequence shown in SEQ ID NO.10.

[0062] Preferably, the recombinant expression vector in (1) or (3) of the biological material comprises a lentiviral vector or an adeno-associated viral vector.

[0063] More preferably, the lentiviral vector comprises a pLenti-puro vector.

[0064] More preferably, the adeno-associated virus vector comprises a pAAV-cTNT-GFP-Palmd vector.

[0065] More preferably, the recombinant expression vector in (1) or (3) of the biological material further includes an auxiliary vector.

[0066] Further preferably, the recombinant expression vector includes a lentiviral vector, and the auxiliary vector includes a pMD2.G vector and a psPAX2 vector.

[0067] Further preferably, the recombinant expression vector includes an adeno-associated virus vector, and the auxiliary vector includes an AAV9-Rep / Cap vector and a pHelper vector.

[0068] Preferably, the microorganism in (4) of the biological material comprises a lentivirus or an adeno-associated virus.

[0069] Use of a biomaterial for increasing the expression of a MODICA gene and / or MODICA protein in the preparation of a drug for alleviating and / or treating cardiac damage, wherein the amino acid sequence of the MODICA protein is shown in any one of SEQ ID NOs. 1 to 7.

[0070] Preferably, the biological material is at least one of the following (1) to (4): (1) a recombinant expression vector expressing the MODICA protein; (2) an expression cassette containing a nucleic acid molecule encoding the MODICA protein; (3) a recombinant expression vector containing the nucleic acid molecule described in (2); (4) a microorganism containing the recombinant expression vector described in (3).

[0071] Preferably, the amino acid sequence of the MODICA protein is shown as SEQ ID NO.2 or SEQ ID NO.3.

[0072] More preferably, the amino acid sequence of the MODICA protein is as shown in SEQ ID NO.2, and the nucleotide sequence of the nucleic acid molecule in (2) of the biological material is as shown in SEQ ID NO.9 or as the completely complementary sequence of the sequence shown in SEQ ID NO.9.

[0073] More preferably, the amino acid sequence of the MODICA protein is as shown in SEQ ID NO.3, and the nucleotide sequence of the nucleic acid molecule in (2) of the biological material is as shown in SEQ ID NO.10 or as the completely complementary sequence of the sequence shown in SEQ ID NO.10.

[0074] Preferably, the recombinant expression vector in (1) or (3) of the biological material comprises a lentiviral vector or an adeno-associated viral vector.

[0075] More preferably, the lentiviral vector comprises a pLenti-puro vector.

[0076] More preferably, the adeno-associated virus vector comprises a pAAV-cTNT-GFP-Palmd vector.

[0077] More preferably, the recombinant expression vector in (1) or (3) of the biological material further includes an auxiliary vector.

[0078] Further preferably, the recombinant expression vector includes a lentiviral vector, and the auxiliary vector includes a pMD2.G vector and a psPAX2 vector.

[0079] Further preferably, the recombinant expression vector includes an adeno-associated virus vector, and the auxiliary vector includes an AAV9-Rep / Cap vector and a pHelper vector.

[0080] Preferably, the microorganism in (4) of the biological material comprises a lentivirus or an adeno-associated virus.

[0081] Use of a biomaterial for increasing the expression of MODICA gene and / or MODICA protein in the preparation of a drug for alleviating and / or treating heart damage caused by anthracycline antibiotics, wherein the amino acid sequence of the MODICA protein is shown in any one of SEQ ID NOs. 1 to 7.

[0082] Preferably, the anthracycline antibiotic comprises doxorubicin.

[0083] Preferably, the biological material is at least one of the following (1) to (4): (1) a recombinant expression vector expressing the MODICA protein; (2) an expression cassette containing a nucleic acid molecule encoding the MODICA protein; (3) a recombinant expression vector containing the nucleic acid molecule described in (2); (4) a microorganism containing the recombinant expression vector described in (3).

[0084] Preferably, the amino acid sequence of the MODICA protein is shown as SEQ ID NO.2 or SEQ ID NO.3.

[0085] More preferably, the amino acid sequence of the MODICA protein is as shown in SEQ ID NO.2, and the nucleotide sequence of the nucleic acid molecule in (2) of the biological material is as shown in SEQ ID NO.9 or as the completely complementary sequence of the sequence shown in SEQ ID NO.9.

[0086] More preferably, the amino acid sequence of the MODICA protein is as shown in SEQ ID NO.3, and the nucleotide sequence of the nucleic acid molecule in (2) of the biological material is as shown in SEQ ID NO.10 or as the completely complementary sequence of the sequence shown in SEQ ID NO.10.

[0087] Preferably, the recombinant expression vector in (1) or (3) of the biological material comprises a lentiviral vector or an adeno-associated viral vector.

[0088] More preferably, the lentiviral vector comprises a pLenti-puro vector.

[0089] More preferably, the adeno-associated virus vector comprises a pAAV-cTNT-GFP-Palmd vector.

[0090] More preferably, the recombinant expression vector in (1) or (3) of the biological material further includes an auxiliary vector.

[0091] Further preferably, the recombinant expression vector includes a lentiviral vector, and the auxiliary vector includes a pMD2.G vector and a psPAX2 vector.

[0092] Further preferably, the recombinant expression vector includes an adeno-associated virus vector, and the auxiliary vector includes an AAV9-Rep / Cap vector and a pHelper vector.

[0093] Preferably, the microorganism in (4) of the biological material comprises a lentivirus or an adeno-associated virus.

[0094] Use of a biomaterial for increasing the expression of a MODICA gene and / or MODICA protein in the preparation of a drug for inhibiting myocardial fibrosis, wherein the amino acid sequence of the MODICA protein is shown in any one of SEQ ID NOs. 1 to 7.

[0095] Preferably, the biological material is at least one of the following (1) to (4): (1) a recombinant expression vector expressing the MODICA protein; (2) an expression cassette containing a nucleic acid molecule encoding the MODICA protein; (3) a recombinant expression vector containing the nucleic acid molecule described in (2); (4) a microorganism containing the recombinant expression vector described in (3).

[0096] Preferably, the amino acid sequence of the MODICA protein is shown as SEQ ID NO.2 or SEQ ID NO.3.

[0097] More preferably, the amino acid sequence of the MODICA protein is as shown in SEQ ID NO.2, and the nucleotide sequence of the nucleic acid molecule in (2) of the biological material is as shown in SEQ ID NO.9 or as the completely complementary sequence of the sequence shown in SEQ ID NO.9.

[0098] More preferably, the amino acid sequence of the MODICA protein is as shown in SEQ ID NO.3, and the nucleotide sequence of the nucleic acid molecule in (2) of the biological material is as shown in SEQ ID NO.10 or as the completely complementary sequence of the sequence shown in SEQ ID NO.10.

[0099] Preferably, the recombinant expression vector in (1) or (3) of the biological material comprises a lentiviral vector or an adeno-associated viral vector.

[0100] More preferably, the lentiviral vector comprises a pLenti-puro vector.

[0101] More preferably, the adeno-associated virus vector comprises a pAAV-cTNT-GFP-Palmd vector.

[0102] More preferably, the recombinant expression vector in (1) or (3) of the biological material further includes an auxiliary vector.

[0103] Further preferably, the recombinant expression vector includes a lentiviral vector, and the auxiliary vector includes a pMD2.G vector and a psPAX2 vector.

[0104] Further preferably, the recombinant expression vector includes an adeno-associated virus vector, and the auxiliary vector includes an AAV9-Rep / Cap vector and a pHelper vector.

[0105] Preferably, the microorganism in (4) of the biological material comprises a lentivirus or an adeno-associated virus.

[0106] Use of a biomaterial for increasing the expression of MODICA gene and / or MODICA protein in the preparation of a drug for inhibiting myocardial fibrosis caused by anthracycline antibiotics, wherein the amino acid sequence of the MODICA protein is shown in any one of SEQ ID NOs. 1 to 7.

[0107] Preferably, the anthracycline antibiotic comprises doxorubicin.

[0108] Preferably, the biological material is at least one of the following (1) to (4): (1) a recombinant expression vector expressing the MODICA protein; (2) an expression cassette containing a nucleic acid molecule encoding the MODICA protein; (3) a recombinant expression vector containing the nucleic acid molecule described in (2); (4) a microorganism containing the recombinant expression vector described in (3).

[0109] Preferably, the amino acid sequence of the MODICA protein is shown as SEQ ID NO.2 or SEQ ID NO.3.

[0110] More preferably, the amino acid sequence of the MODICA protein is as shown in SEQ ID NO.2, and the nucleotide sequence of the nucleic acid molecule in (2) of the biological material is as shown in SEQ ID NO.9 or as the completely complementary sequence of the sequence shown in SEQ ID NO.9.

[0111] More preferably, the amino acid sequence of the MODICA protein is as shown in SEQ ID NO.3, and the nucleotide sequence of the nucleic acid molecule in (2) of the biological material is as shown in SEQ ID NO.10 or as the completely complementary sequence of the sequence shown in SEQ ID NO.10.

[0112] Preferably, the recombinant expression vector in (1) or (3) of the biological material comprises a lentiviral vector or an adeno-associated viral vector.

[0113] More preferably, the lentiviral vector comprises a pLenti-puro vector.

[0114] More preferably, the adeno-associated virus vector comprises a pAAV-cTNT-GFP-Palmd vector.

[0115] More preferably, the recombinant expression vector in (1) or (3) of the biological material further includes an auxiliary vector.

[0116] Further preferably, the recombinant expression vector includes a lentiviral vector, and the auxiliary vector includes a pMD2.G vector and a psPAX2 vector.

[0117] Further preferably, the recombinant expression vector includes an adeno-associated virus vector, and the auxiliary vector includes an AAV9-Rep / Cap vector and a pHelper vector.

[0118] Preferably, the microorganism in (4) of the biological material comprises a lentivirus or an adeno-associated virus.

[0119] Use of a biomaterial that increases the expression of a MODICA gene and / or MODICA protein in the preparation of a drug for reducing myocardial cell apoptosis and / or increasing myocardial cell viability, wherein the amino acid sequence of the MODICA protein is shown in any one of SEQ ID NOs. 1 to 7.

[0120] Preferably, the biological material is at least one of the following (1) to (4): (1) a recombinant expression vector expressing the MODICA protein; (2) an expression cassette containing a nucleic acid molecule encoding the MODICA protein; (3) a recombinant expression vector containing the nucleic acid molecule described in (2); (4) a microorganism containing the recombinant expression vector described in (3).

[0121] Preferably, the amino acid sequence of the MODICA protein is shown as SEQ ID NO.2 or SEQ ID NO.3.

[0122] More preferably, the amino acid sequence of the MODICA protein is as shown in SEQ ID NO.2, and the nucleotide sequence of the nucleic acid molecule in (2) of the biological material is as shown in SEQ ID NO.9 or as the completely complementary sequence of the sequence shown in SEQ ID NO.9.

[0123] More preferably, the amino acid sequence of the MODICA protein is as shown in SEQ ID NO.3, and the nucleotide sequence of the nucleic acid molecule in (2) of the biological material is as shown in SEQ ID NO.10 or as the completely complementary sequence of the sequence shown in SEQ ID NO.10.

[0124] Preferably, the recombinant expression vector in (1) or (3) of the biological material comprises a lentiviral vector or an adeno-associated viral vector.

[0125] More preferably, the lentiviral vector comprises a pLenti-puro vector.

[0126] More preferably, the adeno-associated virus vector comprises a pAAV-cTNT-GFP-Palmd vector.

[0127] More preferably, the recombinant expression vector in (1) or (3) of the biological material further includes an auxiliary vector.

[0128] Further preferably, the recombinant expression vector includes a lentiviral vector, and the auxiliary vector includes a pMD2.G vector and a psPAX2 vector.

[0129] Further preferably, the recombinant expression vector includes an adeno-associated virus vector, and the auxiliary vector includes an AAV9-Rep / Cap vector and a pHelper vector.

[0130] Preferably, the microorganism in (4) of the biological material comprises a lentivirus or an adeno-associated virus.

[0131] The invention relates to the use of a biomaterial for increasing the expression of MODICA gene and / or MODICA protein in the preparation of a drug for reducing myocardial cell apoptosis and / or low myocardial cell viability caused by anthracycline antibiotics, wherein the amino acid sequence of the MODICA protein is shown in any one of SEQ ID NOs. 1 to 7.

[0132] Preferably, the anthracycline antibiotic comprises doxorubicin.

[0133] Preferably, the biological material is at least one of the following (1) to (4): (1) a recombinant expression vector expressing the MODICA protein; (2) an expression cassette containing a nucleic acid molecule encoding the MODICA protein; (3) a recombinant expression vector containing the nucleic acid molecule described in (2); (4) a microorganism containing the recombinant expression vector described in (3).

[0134] Preferably, the amino acid sequence of the MODICA protein is shown as SEQ ID NO.2 or SEQ ID NO.3.

[0135] More preferably, the amino acid sequence of the MODICA protein is as shown in SEQ ID NO.2, and the nucleotide sequence of the nucleic acid molecule in (2) of the biological material is as shown in SEQ ID NO.9 or as the completely complementary sequence of the sequence shown in SEQ ID NO.9.

[0136] More preferably, the amino acid sequence of the MODICA protein is as shown in SEQ ID NO.3, and the nucleotide sequence of the nucleic acid molecule in (2) of the biological material is as shown in SEQ ID NO.10 or as the completely complementary sequence of the sequence shown in SEQ ID NO.10.

[0137] Preferably, the recombinant expression vector in (1) or (3) of the biological material comprises a lentiviral vector or an adeno-associated viral vector.

[0138] More preferably, the lentiviral vector comprises a pLenti-puro vector.

[0139] More preferably, the adeno-associated virus vector comprises a pAAV-cTNT-GFP-Palmd vector.

[0140] More preferably, the recombinant expression vector in (1) or (3) of the biological material further includes an auxiliary vector.

[0141] Further preferably, the recombinant expression vector includes a lentiviral vector, and the auxiliary vector includes a pMD2.G vector and a psPAX2 vector.

[0142] Further preferably, the recombinant expression vector includes an adeno-associated virus vector, and the auxiliary vector includes an AAV9-Rep / Cap vector and a pHelper vector.

[0143] Preferably, the microorganism in (4) of the biological material comprises a lentivirus or an adeno-associated virus.

[0144] Use of biological materials for increasing the expression of MODICA genes and / or MODICA proteins in the preparation of drugs for reducing the cardiotoxicity of anthracycline antibiotics.

[0145] Preferably, the anthracycline antibiotic comprises doxorubicin.

[0146] Preferably, the amino acid sequence of the MODICA protein is shown as SEQ ID NO.2 or SEQ ID NO.3.

[0147] Preferably, the cardiac toxicity includes at least one of the following (1) to (3): (1) myocardial cell apoptosis; (2) myocardial fibrosis; (3) low myocardial cell viability.

[0148] Preferably, the biological material is at least one of the following (1) to (4): (1) a recombinant expression vector expressing the MODICA protein; (2) an expression cassette containing a nucleic acid molecule encoding the MODICA protein; (3) a recombinant expression vector containing the nucleic acid molecule described in (2); (4) a microorganism containing the recombinant expression vector described in (3).

[0149] Preferably, the amino acid sequence of the MODICA protein is shown as SEQ ID NO.2 or SEQ ID NO.3.

[0150] More preferably, the amino acid sequence of the MODICA protein is as shown in SEQ ID NO.2, and the nucleotide sequence of the nucleic acid molecule in (2) of the biological material is as shown in SEQ ID NO.9 or as the completely complementary sequence of the sequence shown in SEQ ID NO.9.

[0151] More preferably, the amino acid sequence of the MODICA protein is as shown in SEQ ID NO.3, and the nucleotide sequence of the nucleic acid molecule in (2) of the biological material is as shown in SEQ ID NO.10 or as the completely complementary sequence of the sequence shown in SEQ ID NO.10.

[0152] Preferably, the recombinant expression vector in (1) or (3) of the biological material comprises a lentiviral vector or an adeno-associated viral vector.

[0153] More preferably, the lentiviral vector comprises a pLenti-puro vector.

[0154] More preferably, the adeno-associated virus vector comprises a pAAV-cTNT-GFP-Palmd vector.

[0155] More preferably, the recombinant expression vector in (1) or (3) of the biological material further includes an auxiliary vector.

[0156] Further preferably, the recombinant expression vector includes a lentiviral vector, and the auxiliary vector includes a pMD2.G vector and a psPAX2 vector.

[0157] Further preferably, the recombinant expression vector includes an adeno-associated virus vector, and the auxiliary vector includes an AAV9-Rep / Cap vector and a pHelper vector.

[0158] Preferably, the microorganism in (4) of the biological material comprises a lentivirus or an adeno-associated virus.

[0159] A composition comprises an active ingredient 1 and an active ingredient 2; the active ingredient 1 comprises a MODICA gene and / or a MODICA protein, or a biological material for increasing the expression of the MODICA gene and / or the MODICA protein; the amino acid sequence of the MODICA protein is shown in any one of SEQ ID NOs. 1 to 7; and the active ingredient 2 comprises an anthracycline antibiotic.

[0160] Preferably, the anthracycline antibiotic comprises doxorubicin.

[0161] Preferably, the biological material is at least one of the following (1) to (4): (1) a recombinant expression vector expressing the MODICA protein; (2) an expression cassette containing a nucleic acid molecule encoding the MODICA protein; (3) a recombinant expression vector containing the nucleic acid molecule described in (2); (4) a microorganism containing the recombinant expression vector described in (3).

[0162] Preferably, the amino acid sequence of the MODICA protein is shown as SEQ ID NO.2 or SEQ ID NO.3.

[0163] More preferably, the amino acid sequence of the MODICA protein is as shown in SEQ ID NO.2, and the nucleotide sequence of the nucleic acid molecule in (2) of the biological material is as shown in SEQ ID NO.9 or as the completely complementary sequence of the sequence shown in SEQ ID NO.9.

[0164] More preferably, the amino acid sequence of the MODICA protein is as shown in SEQ ID NO.3, and the nucleotide sequence of the nucleic acid molecule in (2) of the biological material is as shown in SEQ ID NO.10 or as the completely complementary sequence of the sequence shown in SEQ ID NO.10.

[0165] Preferably, the recombinant expression vector in (1) or (3) of the biological material comprises a lentiviral vector or an adeno-associated viral vector.

[0166] More preferably, the lentiviral vector comprises a pLenti-puro vector.

[0167] More preferably, the adeno-associated virus vector comprises a pAAV-cTNT-GFP-Palmd vector.

[0168] More preferably, the recombinant expression vector in (1) or (3) of the biological material further includes an auxiliary vector.

[0169] Further preferably, the recombinant expression vector includes a lentiviral vector, and the auxiliary vector includes a pMD2.G vector and a psPAX2 vector.

[0170] Further preferably, the recombinant expression vector includes an adeno-associated virus vector, and the auxiliary vector includes an AAV9-Rep / Cap vector and a pHelper vector.

[0171] Preferably, the microorganism in (4) of the biological material comprises a lentivirus or an adeno-associated virus.

[0172] A composition for use in the preparation of an anti-tumor drug, the composition comprising an active ingredient 1 and an active ingredient 2; the active ingredient 1 comprising a MODICA gene and / or a MODICA protein, or a biological material for increasing the expression of the MODICA gene and / or the MODICA protein; the amino acid sequence of the MODICA protein is shown in any one of SEQ ID NOs. 1 to 7; the active ingredient 2 comprises an anthracycline antibiotic. The active ingredient 1 is used to reduce the cardiotoxicity of the active ingredient 2, and the active ingredient 2 is used to treat tumors.

[0173] Preferably, the anthracycline antibiotic comprises doxorubicin.

[0174] Preferably, the biological material is at least one of the following (1) to (4): (1) a recombinant expression vector expressing the MODICA protein; (2) an expression cassette containing a nucleic acid molecule encoding the MODICA protein; (3) a recombinant expression vector containing the nucleic acid molecule described in (2); (4) a microorganism containing the recombinant expression vector described in (3).

[0175] Preferably, the amino acid sequence of the MODICA protein is shown as SEQ ID NO.2 or SEQ ID NO.3.

[0176] More preferably, the amino acid sequence of the MODICA protein is as shown in SEQ ID NO.2, and the nucleotide sequence of the nucleic acid molecule in (2) of the biological material is as shown in SEQ ID NO.9 or as the completely complementary sequence of the sequence shown in SEQ ID NO.9.

[0177] More preferably, the amino acid sequence of the MODICA protein is as shown in SEQ ID NO.3, and the nucleotide sequence of the nucleic acid molecule in (2) of the biological material is as shown in SEQ ID NO.10 or as the completely complementary sequence of the sequence shown in SEQ ID NO.10.

[0178] Preferably, the recombinant expression vector in (1) or (3) of the biological material comprises a lentiviral vector or an adeno-associated viral vector.

[0179] More preferably, the lentiviral vector comprises a pLenti-puro vector.

[0180] More preferably, the adeno-associated virus vector comprises a pAAV-cTNT-GFP-Palmd vector.

[0181] More preferably, the recombinant expression vector in (1) or (3) of the biological material further includes an auxiliary vector.

[0182] Further preferably, the recombinant expression vector includes a lentiviral vector, and the auxiliary vector includes a pMD2.G vector and a psPAX2 vector.

[0183] Further preferably, the recombinant expression vector includes an adeno-associated virus vector, and the auxiliary vector includes an AAV9-Rep / Cap vector and a pHelper vector.

[0184] Preferably, the microorganism in (4) of the biological material comprises a lentivirus or an adeno-associated virus.

[0185] Compared with the prior art, the present invention has the following beneficial effects:

[0186] The present invention provides a new target for treating cardiac dysfunction. Overexpression of MODICA can significantly alleviate myocardial damage, inhibit cardiac tissue fibrosis, and reduce myocardial cell apoptosis. It is of great significance for the clinical treatment of diseases related to cardiac dysfunction and the prevention of cardiovascular events caused by anti-tumor treatment, and provides a new technical option. BRIEF DESCRIPTION OF THE DRAWINGS

[0187] Figure 1 The MODICA protein sequence alignment results of different species in Example 1.

[0188] Figure 2 The subcellular localization of the MODICA protein in Example 1 in H9C2 cardiomyocytes.

[0189] Figure 3 The expression of MODICA in primary cardiomyocytes of neonatal rats in Example 2; A is the mRNA level of MODICA in the DOX group and the CTRL group; B is the protein level of MODICA in the DOX group and the CTRL group; C is the statistical result of Figure B; ****p<0.0001.

[0190] Figure 4 The expression of MODICA in the DOX chronic heart injury model in Example 2; A is the mRNA level of MODICA, ANP and BNP in the heart tissue of mice in the control group and the DOX injury group; B is the protein level of MODICA in the heart tissue of mice in the control group and the DOX injury group; C is the statistical result of Figure B; **p<0.01; ***p<0.001; ****p<0.0001.

[0191] Figure 5 The effect of overexpression of MODICA on the activity of different cardiomyocytes in Example 3; A is the viability detection results of cardiomyocytes in MOCK (DOX) group, MOCK (CTRL) group, MODICA (DOX) group, MODICA (CTRL) group, CTRL (DOX) group and CTRL (DOX) group; B is the live and dead cell detection results of cardiomyocytes in MODICA (DOX) group, MODICA (CTRL) group, CTRL (DOX) group and CTRL (CTRL) group; *p<0.05; ****p<0.0001.

[0192] Figure 6 The figure shows the effect of overexpression of MODICA on apoptosis of primary cardiomyocytes of different neonatal rats in Example 3; A is the flow cytometry detection result of the apoptosis level of cardiomyocytes in MODICA (DOX) group, MODICA (CTRL) group, CTRL (DOX) group and CTRL (DOX) group; B is the statistical analysis graph of Figure A; C is the western-blot detection result of apoptosis-related markers in cardiomyocytes in MODICA (DOX) group, MODICA (CT RL) group, CTRL (DOX) group and CTRL (DOX) group; D is the statistical analysis graph of Figure C; **p<0.01; ***p<0.001; ****p<0.0001.

[0193] Figure 7 The effect of overexpression of MODICA on cardiac function in Example 4; A is the ultrasonic detection result of cardiac function of CTRL (CTRL) mice, CTRL (DOX) mice, MODICA (CTRL) mice and MODICA (DOX) mice; B and C are the detection results of CK and LDH in the serum of CTRL (CTRL) mice, CTRL (DOX) mice, MODICA (CTRL) mice and MODICA (DOX) mice, respectively; D is the detection result of cardiac tissue fibrosis level of CTRL (CTRL) mice, CTRL (DOX) mice, MODICA (CTRL) mice and MODICA (DOX) mice; E is the statistical analysis chart of Figure D; *p<0.05; ***p<0.001; ****p<0.0001; ns means p≥0.05.

[0194] Figure 8 The effect of overexpression of MODICA on apoptosis of cardiac tissue in Example 4; A is the TUNEL staining result of cardiac tissue of MODICA (CTRL) mice and MODICA (DOX) mice; B is the statistical analysis graph of A; C is the western-blot detection result of apoptosis markers in cardiac tissue of MODICA A (CTRL) mice and MODICA (DOX) mice; D is the statistical analysis graph of C; **p<0.01. DETAILED DESCRIPTION

[0195] The present invention is further described in detail below in conjunction with the accompanying drawings and specific examples of the specification. The examples are only used to explain the present invention and are not used to limit the scope of the present invention. The test methods used in the following examples are conventional methods unless otherwise specified; the materials and reagents used are reagents and materials that can be obtained from commercial channels unless otherwise specified.

[0196] Example 1 MODICA is a mitochondrial micropeptide conserved across species

[0197] 1. Sequence alignment

[0198] The amino acid sequences of MODICA protein (i.e., Smim26 protein) in different species were downloaded from the UNIPROT database (https: / / www.uniprot.org / ), where the sequence numbers corresponding to each species are: human (A0A096LP01, SEQ ID NO.1), mouse (Q3V460, SEQ ID NO.2), rat (A6K766, SEQ ID NO.3), chimpanzee (A0A2I3T4U5, SEQ ID NO.4), rhesus monkey (A0A2K5WG43, SEQ ID NO.5), cattle (A0A3Q1M7N8, SEQ ID NO.6) and pig (A0A4X1V370, SEQ ID NO.7); the alignment results were visualized using the software MEGA11 (default parameters), and the antigenic epitopes were predicted using BepiPred-2.0. Figure 1 As shown, MODICA is a highly conserved protein among species, especially the transmembrane region (TMD) from amino acids 8 to 34, of which amino acids 80 to 90 are the antigenic epitopes used to prepare endogenous antibodies against MODICA.

[0199] 2. MODICA Cell Localization

[0200] (1) Construction of MODICA overexpression vector

[0201] The cDNA of H9c2 cell line was used as template, and the upstream amplification primer was 5'-CTCTCCTATGGAGTCATGCGTCCTG-3' and the downstream amplification primer was 5'-TCATGATTGAGGGCCAGGCCCACCAGACTACAAGGACGACGA TGACAAGThe MODICA-Flag gene fragment (5'-ATGCGTCCTGACCAGGCTACGATCTGGTACCGGCGGATGTCTATTGTCTATGCACTAG GCGCCTGGTCGGTGCTGGGCTCGGCGATTTTCCTTACACGAAAACCGAAGATGTCAGACTATGGGGAAAATGAAGAGGATGACTCAAGCAATGAAATGCCTTTTTCTACAAGTGAAGACTCTGATTTAGCGATGGAAAGGGCTGAGCCTATTAAAGGGTTTTATACGAAGACAATTGTAAAGTATTCAGAAAATTCTGTTCCAGTTACTCAGAGGATCCTGAACTATCTGAACTCATGGACTGGTGGGCCTGGCCCTCAATCATGA-3'(SEQ ID NO.8)) was amplified to obtain the MODICA-Flag gene fragment (5'-ATGCGTCCTGACCAGGCTACGATCTGGTACCGGCGGATGTCTATTGTCTATGCACTAGCGCCTGGTCGGTGCTGGGCTCGGCGATTTTCCTTACACGAAAACCGAAGATGTCAGACTATGGGGAAAATGAAGAGGATGACTCAAGCAATGAAATGCCTTTTTCTACAAGTGAAGACTCTGATTTAGCGATGGAAAGGGCTGAGCCTATTAAAGGGTTTTATACGAAGACAATTGTAAAGTATTCAGAAAATTCTGTTCCAGTTACTCAGAGGATCCTGAACTATCTGAACTCATGGACTGGTGGGCCTGGCCCTCAATCATGA-3'(SEQ ID NO.8)).

[0202] The MODICA-Flag gene fragment (SEQ ID NO.8) was inserted between the XhoI site and the MluI site in the pLenti-puro vector (addgene#39481) to obtain a vector overexpressing MODICA-Flag, which was named pLenti-MODICA-Flag vector.

[0203] (2) Lentivirus preparation

[0204] HEK293 cells (Wuhan Pronocell Life Science Co., Ltd.) were cultured at 1.0 × 10 5The cells were inoculated in a 10 cm cell culture dish at a density of 100 cells / cm2 and cultured in complete medium (high-glucose DMEM containing 10% (v / v) fetal bovine serum (FBS) and 1% (v / v) double-antibody (P / S)) at 37°C and 5% CO2 for 16 h. The pLenti-MODICA-Flag vector, pMD2.G vector (addgene#12259) and psPAX2 vector (addgene#12260) were mixed at a ratio of 2:1:1 and PEI-MAX (Poly sciences, USA, 23966-2) was transfected into HEK293 cells. After 48 hours of transfection, the supernatant was collected and filtered with a 0.22 μm filter to obtain a virus solution containing a lentivirus overexpressing MODICA-Flag, named V-MODICA. The same method was used to transfect the pLenti-puro vector, pMD2.G vector, and psPAX2 vector into HEK293 cells, and the virus solution was collected after culture, which contained a control virus carrying an empty vector, named V-Blank.

[0205] (3) Screening of H9C2 stable cell lines

[0206] H9C2 cardiomyocytes (Wuhan Pronocell Life Science Co., Ltd.) were cultured at 1.0 × 10 5 The cells were inoculated into six-well plates at a density of 100 cells / mL and cultured with complete medium at 37°C and 5% CO2 for 16 h.

[0207] 48 hours after H9C2 cardiomyocytes were infected with V-MODICA virus, 1 μg / μl Puromycin was added to the culture medium for resistance screening, and a blank control group (i.e., H9C2 cells not infected with V-MODICA virus) was set up. When the cells in the blank control group died completely (usually 48 hours), the culture medium was replaced with complete culture medium for expanded culture, thus obtaining MODICA stably overexpressing H9C2 cardiomyocytes, named MODICA-H9C2 cells.

[0208] (4) Immunofluorescence

[0209] MODICA-H9C2 cells were fixed with 4% paraformaldehyde for 15 min at room temperature, permeabilized with 0.1% Triton X-100 for 10 min at room temperature, blocked with 5% BSA for 1 h at room temperature, incubated with primary antibodies anti-TOM20 (1:200, 11802-1-AP, Proteintech) and anti-FLA G M2 (1:200, Sigma-Aldrich, F1804) at 4 °C overnight, washed three times with 1xPBST, and then added with secondary antibodies Alexa 488 (1:1,000; Thermo Fisher Scientific; A-11029) and Alexa 594 (1:1,000; ThermoFisher Scientific) The sections were incubated at room temperature for 1 h, washed three times with 1xPBST, and then mounted with a mounting medium containing DAPI (Vector, H-1200-10), observed under a confocal microscope (Zeiss; LSM880), and photographed.

[0210] Immunofluorescence results Figure 2 As shown, MODICA co-localizes with mitochondrial marker (TOM20), indicating that MODICA is a micropeptide localized in mitochondria.

[0211] Example 2 Correlation between MODICA and myocardial injury

[0212] 1. MODICA expression is decreased in doxorubicin (DOX)-injured cardiomyocytes

[0213] 1. Isolation and culture of neonatal rat primary cardiomyocytes (NRCM)

[0214] (1) Separation of the heart

[0215] Spray your hands with alcohol, use large scissors to cut the skin, use tweezers and small scissors to remove the rat's heart and place it in a culture dish containing 1xPBS, remove excess tissue and blood, and transfer it to a culture dish containing 1xPBS on ice for temporary storage.

[0216] (2) Solution preparation

[0217] Prepare 4 tubes of trypsin neutralization solution (i.e. DMEM (45 mL / tube) containing 10% (v / v) domestic serum (manufacturer: Excell, product number: FSP500) (5 mL / tube)), and preheat them at 37°C after preparation; prepare 2 tubes of primary digestion solution (specific formula: NaCl, 137 mmol / L; KCl, 4 mmol / L; NaHCO3, 4.2 mmol / L; Glucose, 5 mmol / L; pH, 7.68; filtered sterilization) 30 mL / tube + 0.25% trypsin (Trpsin) 15 mL / tube), take 1 tube and preheat them at 37°C after preparation.

[0218] Prepare 3 tubes of cardiomyocyte culture medium (i.e., DMEM 43.5 mL / tube + double antibody 0.5 mL / tube + Transe serum 5 mL / tube + sodium pyruvate 0.5 mL / tube + glutamine 0.5 mL / tube), and mix by inversion.

[0219] (3) Tissue digestion

[0220] Add 7mL 1xPBS to a T50 conical flask, wipe the index finger with sterile paper, spray alcohol on the table, use the index finger as the operating table, place the rat heart, cut the tissue into four parts with small scissors, and put it in the conical flask. Seal the conical flask with tin foil (containing a rotor) and shake it several times, then discard the first non-tissue liquid in the clean bench. Add 5mL of primary digestion solution preheated at 37℃ to the conical flask, seal it with tin foil and digest it with spiral oscillation at 37℃ outside the clean bench for 5min to obtain tissue digestion solution. During the digestion period, prepare a 50mL centrifuge tube, put a 70μm filter sieve on the tube mouth, and add an equal amount of pancreatin neutralizing solution to the tube as the tissue digestion solution. After obtaining the tissue digestion solution, spray alcohol on the table, discard the first tissue digestion solution, and transfer the tissue digestion solution to a 70μm filter sieve for filtration and neutralization each time. Add new primary digestion solution to the conical flask, blow away the agglomerated particles and mix them evenly, and repeat this step until all the heart tissues are digested.

[0221] (4) Isolation and purification of cardiomyocytes by differential adhesion method

[0222] Calculate the total volume of cardiomyocyte culture medium needed for equal distribution, that is, 5 mouse hearts / 10cm culture dish, 10mL / 10cm cell culture dish, to determine the volume of resuspension solution used to precipitate cells. Centrifuge the neutralized tissue digestion solution at 1000rpm for 10min, remove the supernatant in the centrifuge tube after centrifugation, add cardiomyocyte culture medium to resuspend, collect the cell pellets after multiple tubes of centrifugation into 1 tube, divide them equally into 10cm cell culture dishes, and place them in a cell culture incubator with 5% CO2 and 37℃ for 1h. This process is to make fibroblasts adhere to the wall first to distinguish them from cardiomyocytes.

[0223] After the fibroblasts adhere to the wall of the 10 cm cell culture dish, aspirate the supernatant into a 50 mL centrifuge tube, wash the dish with new cardiomyocyte culture medium, and recover the culture medium into the centrifuge tube. After washing, observe the closed culture dish surface under a microscope. If there are many residual cardiomyocytes (cardiomyocytes are bright and round, and fibroblasts are gray and irregular), wash several times. Combine the obtained supernatant and culture medium to obtain a cell suspension of rat cardiomyocytes, named NRCM suspension.

[0224] (5) NRCM cell culture

[0225] Incubate the culture plates with gelatin (6-well plate, 1 mL / well; 12-well plate, 500 μL / well; 24-well plate, 250 μL / well) and incubate in a cell culture incubator at 5% CO2 and 37°C for 0.5 h. Take out the culture plates incubated with gelatin, discard the gelatin, mix the NRCM suspension, and evenly inoculate them in the cell culture plates at a density of 1.5 newborn rats per six-well plate, and culture them with complete medium at 37°C and 5% CO2 for 16 h.

[0226] 2. Construction of DOX-injured cardiomyocyte model

[0227] 1 μM Doxorubicin (MCE, HY-15142) was added to the NRCM cells after 16 hours of culture, and the cells were treated at 37°C and 5% CO2 for 24 hours. The obtained cells were named DOX group; NR CM cells cultured in complete medium without Doxorubicin were used as the control group (named CTRL group). The two groups of cells were collected separately for the next step of detection.

[0228] 3. MODICA expression detection

[0229] (1) Preparation of endogenous antibodies against MODICA

[0230] MODICA endogenous antibodies were produced by Shanghai Jier Biotechnology Co., Ltd. The main steps include: chemical synthesis of MOC ADI epitope peptide (amino acid sequence: Cys-KYSENSVPATQ), immunization of rabbits and collection of immune serum, and detection of serum antibody titer by ELISA. The results are shown in Table 1. At a dilution of 1:50000, the antibody titer in the immune serum is still higher than that in the negative serum, indicating that the antibody preparation was successful. MODICA endogenous antibodies were obtained by affinity purification of the immune serum.

[0231] Table 1 ELISA test results of MODICA endogenous antibodies

[0232]

[0233] Note: The dilution ratio of negative serum is 1:1000.

[0234] (2) Extraction of total cell RNA and qPCR detection

[0235] The total RNA of the two groups of cells was extracted by Trizol / chloroform method, and the RNA concentration was determined by nandrop2000. TM RT reagent Kit with gDNA Eraser (TAKARA, RR047) was used to reverse transcribe total RNA into cDNA.

[0236] Using cDNA as a template, the kit TB Green Premix Ex Taq (TAKARA, RR420) was used for fluorescence quantitative PCR (qPCR) detection. The primers used are shown in Table 2, and the qPCR reaction system is shown in Table 3.

[0237] Table 2 Fluorescence quantitative PCR primers

[0238]

[0239] Table 3 Fluorescence quantitative PCR primers

[0240]

[0241] The qPCR reaction program was: 95°C for 30 s; 95°C for 5 s; 60°C for 30 s, plate reading, for a total of 40 cycles. Melting curve analysis: temperature 55°C to 95°C, reading once every minute.

[0242] (3) Extraction of total cell protein and western-blot detection

[0243] The two groups of cells were treated with RIPA lysis buffer (Beyotime, P0013) to obtain total cell protein, which was mixed with protein loading buffer (Beyotime, P0015) for denaturation, and the expression of MODICA protein was detected by western-blot method; the antibodies used were: anti-β-TUBULIN (1:5000, Sigma-Aldrich, T0198), HRP-labeled goat anti-rabbit IgG (1:5000, Proteintech, SA00001-2-1), and anti-MODICA (1:1000, i.e., the MODICA endogenous antibody prepared in this example).

[0244] (4) Test results

[0245] like Figure 3As shown in A to C, compared with the control group, the mRNA level and protein level of MODICA were significantly decreased after DOX-injured primary cardiomyocytes of neonatal rats.

[0246] 2. The expression of MODICA decreased in DOX-damaged heart tissue

[0247] 1. Establishment of DOX chronic cardiac injury model

[0248] C57BL / 6 mice aged 6 to 8 weeks were randomly divided into two groups, named control group (i.e., CTRL) and DOX injury group (i.e., DOX group). Among them, 5 mg / kg of DOX was injected intraperitoneally into the mice in the DOX injury group for four times, with a total injection of 20 mg / kg, thus constructing a DOX chronic heart injury model; the treatment method of the control group was basically the same as that of the DOX injury group, except that normal saline was injected intraperitoneally.

[0249] 2. Isolation of cardiac tissue

[0250] Two weeks after the injection, anesthetize with 1.5% isoflurane, make a transverse incision along the lower edge of the sternum to cut the mouse skin, fully expose the upper abdominal cavity, and then cut the diaphragm. Use scissors to cut the ribs on both sides to fully expose the heart. Fix the blood vessels at the bottom of the heart with forceps, cut the blood vessels at the bottom of the heart before the heart stops, and quickly place the heart in a pre-cooled PBS solution. When the heart pumps out the remaining blood in the heart cavity, cut off the connective tissue around the heart and the left and right atria. After weighing the ventricular tissue, immediately freeze it in liquid nitrogen and transfer it to -80℃ for storage.

[0251] 3. MODICA expression detection

[0252] (1) Extraction of total RNA from cardiac tissue and qPCR detection

[0253] The ventricular tissues of the two groups of mice were treated with the Trizol / chloroform method to extract total RNA, and reverse transcription qPCR detection was performed according to the method in this example. In addition to MODICA, the primers in Table 4 were also used to detect the mRNA expression levels of ANP (atrial natriuretic peptide) and BNP (brain natriuretic peptide), markers of myocardial injury.

[0254] Table 4 Fluorescence quantitative PCR primers

[0255]

[0256] (3) Extraction of total protein from cardiac tissue and western-blot detection

[0257] The ventricular tissues of the two groups of mice were treated with RIPA lysis buffer (Beyotime, P0013) to extract total protein, and western-blot detection was performed according to the method in this example.

[0258] (4) Test results

[0259] like Figure 4 As shown in Figures A to C, compared with the control group, the mRNA and protein expression levels of MODICA in the DOX chronic heart injury model were also significantly decreased, among which the mRNA level was significantly decreased along with the increase of myocardial injury markers (ANP and BNP), and the protein level of MODICA in the heart was also significantly decreased after DOX injury.

[0260] The above results indicate that MODICA is negatively correlated with myocardial injury, and MODICA may have the function of positively treating or alleviating cardiac injury.

[0261] Example 3 Effect of overexpression of MODICA on cardiomyocytes in vitro

[0262] 1. Purification and titer determination of lentivirus

[0263] The V-MODICA-containing virus solution and the V-Blank-containing virus solution obtained in Example 1 were mixed with PEG8000 solution (PEG8000 (sigma, 1546605) 44 g dissolved in 100 ml of double distilled water) in a ratio of 4:1, allowed to stand at 4 degrees for 16 h, centrifuged at 5000 rpm for 30 min at 4 degrees, and the virus precipitate was collected. The virus precipitate was resuspended with 1 mL of PBS to obtain purified V-MODICA virus solution and V-Blank virus solution, respectively.

[0264] The lentivirus titer in the two purified virus solutions was measured using a lentivirus titer rapid detection kit (Biodragon, BF06202).

[0265] 2. Extraction and culture of primary cardiomyocytes from neonatal rats

[0266] The method is the same as in Example 2.

[0267] 3. Lentivirus infection of cardiomyocytes

[0268] V-MODICA and V-Blank were added to the culture medium of NRCM cells at the same titer (10 TU / mL) and cultured for 24 h. The obtained cells were named MODICA group and CTRL group respectively; NRCM cells without virus treatment were named MOCK group.

[0269] 4. DOX damages myocardial cells

[0270] The cell culture medium of the MODICA group was replaced with a complete culture medium containing 1 μg / μL DOX, and the cells were statically cultured for 24 h. The obtained cells were named MODICA (DOX) group; the cell culture medium of the MODICA group was replaced with a complete culture medium without DOX, and the cells were statically cultured for 24 h. The obtained cells were named MODICA (CTRL) group; the cell culture medium of the CTRL group was replaced with a complete culture medium containing 1 μg / μL DOX, and the cells were statically cultured for 24 h. The obtained cells were named CTRL (DOX) group; the cell culture medium of the CTRL group was replaced with a complete culture medium without DOX, and the cells were statically cultured for 24 h. The obtained cells were named CTRL (CTRL) group; the cell culture medium of the MOCK group was replaced with a complete culture medium containing 1 μg / μL DOX, and the cells were statically cultured for 24 h. The obtained cells were named MOCK (DOX) group; the cell culture medium of the MOCK group was replaced with a complete culture medium without DOX, and the cells were statically cultured for 24 h. The obtained cells were named MOCK (CTRL) group.

[0271] 5. Detection of live and dead cells (calcein-AM / PI)

[0272] The Calcein AM / PI live-dead double staining kit (Elabscience, E-CK-A354) was used to detect the live and dead status of cells in the MODICA (DOX) group, MODICA (CTRL) group, CTRL (DOX) group, and CTRL (CTRL) group.

[0273] 6. Cell viability detection

[0274] The Cell Counting Kit-8 (CCK-8) kit (GLPBIO, GK10001) was used to detect the cell viability of the MOCK (DOX) group, MOCK (CTRL) group, MODICA (DOX) group, MODICA (CTRL) group, CTRL (DOX) group and CTRL (CTRL) group.

[0275] 7. Flow cytometry to detect cell apoptosis

[0276] The levels of cell apoptosis in the MODICA (DOX) group, MODICA (CTRL) group, CTRL (DOX) group, and CTRL (CTRL) group were detected using the Annexin V-FITC / PI cell apoptosis detection kit (Elabscience, E-CK-A211) and CytoFLEX flow cytometer (Beckman).

[0277] 8. Western-blot detection of apoptosis indicators

[0278] The total cell protein of the MODICA (DOX) group, MODICA (CTRL) group, CTRL (DOX) group and CTRL (CTRL) group was extracted according to the method in Example 2, and the expression of apoptosis-related markers BAX protein and Bcl2 protein was detected by Western-blot. The antibodies used were: anti-BAX (1:1000, Proteintech, 50599-2-Ig), anti-Bcl2 (1:5000, Proteintech, 26593-1-AP).

[0279] 9. Test results

[0280] like Figure 5 As shown in A and B in Figure 1, compared with the CTRL (DOX) group, the cell viability in the MODICA (DOX) group and the MODICA (CTRL) group was significantly higher and the apoptosis was significantly less, indicating that overexpression of MODICA in cardiomyocytes can improve the viability and survival rate of cardiomyocytes and reduce cardiomyocyte death caused by DOX.

[0281] like Figure 6 As shown in A and B in Figure 3, the apoptosis rate of cells in the MODICA(CTRL) group was lower than that in the CTRL(CTRL) group, and the apoptosis rate of cells in the MODICA(DOX) group was lower than that in the CTRL(DOX) group. Figure 6 As shown in Figures C and D, the expression level of apoptosis-related markers in the MODIC A (CTRL) group was lower than that in the CTRL (CTRL) group, and the expression level of apoptosis-related markers in the MODICA (DOX) group was lower than that in the CTRL (DOX) group. This indicates that overexpression of MODICA can inhibit the apoptosis of cardiomyocytes and significantly reduce the apoptosis of cardiomyocytes caused by DOX.

[0282] The above results indicate that overexpression of MODICA reduces cardiomyocyte death, decreased cell activity and apoptosis caused by DOX.

[0283] Example 4 Effect of overexpression of MODICA on cardiac function in vivo

[0284] 1. Construction of MODICA overexpression vector

[0285] Mouse heart cDNA was used as a template and the upstream amplification primer: 5'-CTCTCCTATGGAGCCATGCGAG-3' and the downstream amplification primer: 5'-CTTGTCATCGTCATCCTTGTAGTCCGCTTGCGGGCCAGG-3' were used to amplify the MODICA-Flag gene fragment (5'-ATGCGAGCTGAAAAGGCCTCTCTCTGGT ACCGGCGAATGTCCCTTGTCTACGCACTTGGCGCCTGGTCCCTGCTGGGCTCGGCGTTTTTCCTTTCACGGAAACAGAAAGTATCAGACTGTGAAGAAGGTCAAGAGGATGGCTCAAGGAATGAAACACCTTTTTCTACAAGTGAAGACTC TGATTTAGAAACGGAAACGGTCGAGCTTGGTGGAGGGTTTTATGTGAAATCATTTTTAAAGTATTCAGAAAATTCTGTCCCAGCCACTCAAAGGTTCCTGACCTATCTGAAGTCATGGACTGGTGGGCCTGGCCCGCAAGCGTAG-3'(SEQ ID NO.9));

[0286] The MODICA-Flag gene fragment (SEQ ID NO.9) was inserted between the NheI site and the SalI site in the pAAV-cTNT-GFP-Palmd vector (addgene#216832) to obtain the MODICA overexpression vector, which was named pAAV-MODI CA-Flag vector.

[0287] 2. Preparation of adeno-associated virus (AAV)

[0288] Adeno-associated virus was prepared by referring to the method reported in the prior art (PMID: 35576474), and the specific steps were as follows: 70 μg of pAAV-cTNT-GFP-Palmd vector, 70 μg of AAV9-Rep / Cap (addgene #198016) vector and 200 μg of pHelper (addgene #112867) vector (pAd-deltaF6, Penn Vector Core) were co-transfected with 1 mg / mL polyethyleneimine (PEI, Polysciences, USA, 23966-2) into HEK293T cells in ten 15 cm culture dishes; 72 h after transfection, the cells were collected and resuspended in lysis buffer (20 mM Tris, pH 8, 150 mM NaCl, 1 mM MgCl, 50μg / mLBenzonase), and the cells were lysed by three freeze-thaw cycles, and the AAV in the supernatant was precipitated with PEG8000 (VWR, USA, 97061-100), and the AAV precipitate obtained was resuspended with lysis buffer and mixed with the above-mentioned lysis buffer in which the cells were resuspended. AAV was purified by iodixanol density gradient ultracentrifugation (Optiprep, Sigma D1556-250mL) and VTi-50 rotor (Beckman, USA, XL-90). The purified AAV was concentrated with phosphate buffered saline (PBS) containing 0.001% Pluronic F68 (Invitrogen, USA, 24040032), and further concentrated using a 100kDa filter (Millipore, USA, UFC910096). The obtained AAV was recorded as the control adeno-associated virus and named AAV-blank.

[0289] Adeno-associated virus overexpressing MODICA was prepared according to the same method, with the only difference being that the pAAV-cTNT-GFP-Pal md plasmid was replaced with the pAAV-MODICA-Flag vector. The resulting AAV was adeno-associated virus overexpressing MODICA and was named AAV-MODICA.

[0290] The viral titers of AAV-blank and AAV-MODICA were determined by real-time quantitative PCR using SYBR Green Master Mix (TAKARA, RR820B, USA). The standard curve was based on the cTNT promoter DNA fragment. The primers used were 5′-TCGGGATAAAAGCAGTCTGG-3′ and 5′-CCCAAGCTATTGTGTGGCCT-3′.

[0291] 3. Adeno-associated virus injection into mice

[0292] The virus titers of AAV-blank and AAV-MODICA prepared in this example were adjusted to 1×10 12 vg / mL, and then injected subcutaneously into C57BL / 6 mice born 1 to 3 days old at a dose of 20 μL / mouse. The resulting mice were named CTRL mice and MODICA mice, and then continued to be raised until 8 weeks of age for subsequent experiments.

[0293] 4. Establishment of DOX chronic cardiac injury model

[0294] The CTRL mice were randomly divided into two groups, named CTRL (CTRL) mice and CTRL (DOX) mice. The MODICA mice were randomly divided into two groups, named MODICA (CTRL) mice and MODICA (DOX) mice.

[0295] According to the method in Example 2, DOX was intraperitoneally injected into CTRL (DOX) mice and MODICA (DOX) mice to establish a DOX chronic cardiac injury model; and physiological saline was intraperitoneally injected into CTRL (CTRL) mice and MODICA (CTRL) mice.

[0296] 5. Cardiac ultrasound testing

[0297] Echocardiography was performed on CTRL(CTRL) mice, CTRL(DOX) mice, MODICA(CTRL) mice, and MODICA(DOX) mice using the VisualSonics Vevo 2100 system with Vevostrain software. During the examination, the animals were awake and immobilized in a standard hand-held position. M-mode images were obtained from the parasternal long-axis view at the level of the mitral papillary muscles for the measurement of left ventricular ejection fraction (LVEF), left ventricular fractional shortening (LVFS), and other relevant parameters.

[0298] 6. Collection of mouse serum

[0299] CTRL (CTRL) mice, CTRL (DOX) mice, MODICA (CTRL) mice, and MODICA (DO X) mice were anesthetized to keep them in a static state to reduce stress and pain. The head of the anesthetized mouse was gently fixed to expose the eye, and blood was collected from the retro-orbital venous plexus. The sterilized capillary was gently inserted into the retro-orbital venous plexus behind the eyeball. Blood will flow along the capillary. After the required amount is reached, the capillary is slowly removed, and the blood collection site is gently pressed with a sterile cotton swab to stop bleeding. The status of the mouse was monitored to ensure that it returned to normal. The collected blood sample was allowed to coagulate, and then centrifuged at 3000 rpm for 10 minutes at 4°C, and the supernatant was collected to obtain serum.

[0300] 7. Detection of creatine kinase (CK) and lactate dehydrogenase (LDH)

[0301] The levels of myocardial injury markers CK and LDH in the serum of CTRL (CTRL) mice, CTRL (DOX) mice, MODICA (CTRL) mice, and MODICA (DOX) mice were measured at a wavelength of 340 nm using a fully automatic biochemical analyzer. This test was performed by Savier Biotech.

[0302] 8. Detection of cardiac fibrosis

[0303] According to the method in Example 2, the ventricular tissues of CTRL (CTRL) mice, CTRL (DOX) mice, MODI CA (CTRL) mice and MODICA (DOX) mice were isolated. The heart tissues of CTRL (CTRL) mice, CTRL (DOX) mice, MODICA (CTRL) mice and MODICA (DOX) mice were fixed in 4% paraformaldehyde and embedded in paraffin. The embedded tissues were sliced ​​to 5 μm thick and placed in an oven at 65°C for 2 hours to obtain heart slices of 4 groups of mice. After conventional dewaxing with xylene and dehydration with gradient ethanol, the slices were rinsed with water and stained with Bouin's fixative, iron hematoxylin, picric acid-fuchsin red dye and phosphomolybdic acid in sequence, followed by dehydration and sealing. Images were collected using an automatic digital pathology slice scanner (Kfbio / KF-PRO-020) and quantitative analysis was performed using ImageJ software.

[0304] 9. Myocardial cell apoptosis detection

[0305] The heart sections of CTRL (CTRL) mice, CTRL (DOX) mice, MODICA (CTRL) mice, and MODICA (DO X) mice were dewaxed and permeabilized, and then TUNEL staining was performed using a one-step TUNEL apoptosis detection kit (G1501, Servicebio). The stained images were observed and photographed using a confocal microscope (Zeiss; LSM880), and the fluorescence of the images was quantitatively analyzed using ImageJ software.

[0306] 10. Test results

[0307] like Figure 7 As shown in Figure A, overexpression of MODICA specifically in the mouse heart can alleviate DOX-induced cardiac dysfunction. Figure 7 As shown in Figures B and C, overexpression of MODICA in the mouse heart can reduce the increase of creatine kinase and lactate dehydrogenase induced by DOX. Figure 7As shown in D and E, overexpression of MODICA can reduce the degree of cardiac fibrosis induced by DOX.

[0308] like Figure 8 As shown in A to D in Figure 3, overexpression of MODICA can reduce the apoptosis level of cardiomyocytes in cardiac tissue, accompanied by a decrease in the levels of apoptosis-related markers (BAX and BCL2).

[0309] These results indicate that overexpression of MODICA in vivo can significantly improve cardiac dysfunction and reduce cardiac damage.

[0310] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention rather than to limit the protection scope of the present invention. For ordinary technicians in this field, other different forms of changes or modifications can be made based on the above descriptions and ideas. It is not necessary and impossible to list all the implementation methods here. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the protection scope of the claims of the present invention.

Claims

1. Use of MODICA gene and / or MODICA protein in the preparation of a drug for improving cardiac dysfunction, characterized in that: The amino acid sequence of the MODICA protein is shown in any one of SEQ ID NOs. 1 to 7.

2. Use of MODICA gene and / or MODICA protein in the preparation of a drug for alleviating and / or treating cardiac damage, characterized in that: The amino acid sequence of the MODICA protein is shown in any one of SEQ ID NOs. 1 to 7.

3. Use of MODICA gene and / or MODICA protein in the preparation of a drug for inhibiting myocardial fibrosis, characterized in that: The amino acid sequence of the MODICA protein is shown in any one of SEQ ID NOs. 1 to 7.

4. Use of MODICA gene and / or MODICA protein in the preparation of a drug for reducing the cardiotoxicity of anthracycline antibiotics, characterized in that: The amino acid sequence of the MODICA protein is shown in any one of SEQ ID NOs. 1 to 7.

5. Use of a biomaterial for increasing the expression of MODICA gene and / or MODICA protein in the preparation of a drug for improving cardiac dysfunction, characterized in that: The amino acid sequence of the MODICA protein is shown in any one of SEQ ID NOs. 1 to 7.

6. Use of a biomaterial for increasing the expression of MODICA gene and / or MODICA protein in the preparation of a drug for alleviating and / or treating cardiac damage, characterized in that: The amino acid sequence of the MODICA protein is shown in any one of SEQ ID NOs. 1 to 7.

7. Use of a biomaterial for increasing the expression of MODICA gene and / or MODICA protein in the preparation of a drug for inhibiting myocardial fibrosis, characterized in that: The amino acid sequence of the MODICA protein is shown in any one of SEQ ID NOs. 1 to 7.

8. Use of a biomaterial for increasing the expression of MODICA gene and / or MODICA protein in the preparation of a drug for reducing the cardiotoxicity of anthracycline antibiotics, characterized in that: The amino acid sequence of the MODICA protein is shown in any one of SEQ ID NOs. 1 to 7.

9. The use according to any one of claims 5 to 8, characterized in that: The biomaterial is at least one of the following (1) to (4): (1) a recombinant expression vector expressing the MODICA protein; (2) an expression cassette containing a nucleic acid molecule encoding the MODICA protein; (3) a recombinant expression vector containing the nucleic acid molecule described in (2); (4) A microorganism containing the recombinant expression vector described in (3).

10. A composition, characterized in that comprising active ingredient 1 and active ingredient 2; The active ingredient 1 includes MODICA gene and / or MODICA protein, or biological material that increases the expression of MODICA gene and / or MODICA protein; the amino acid sequence of the MODICA protein is shown in any one of SEQ ID NO. 1 to 7; The active ingredient 2 includes anthracycline antibiotics.

Images