Pleurotus nigromaculatus multifunctional peptide and application thereof
By developing the multifunctional peptide of the black spot frog, the problems of infection-induced inflammatory diseases and skin barrier damage have been solved, and powerful antibacterial, anti-inflammatory, and promoting cell proliferation have been achieved, which has improved the skin barrier function.
Patent Information
- Application Number
- CN202411422133.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-10-12
- Publication Date
- 2025-03-11
AI Technical Summary
The prior art is difficult to effectively solve the problems of infection-induced inflammatory diseases and skin barrier damage, especially in the inadequate application of antibacterial drugs and skin repair.
A polyfunctional peptide of the black spotted frog was developed. Its amino acid sequence was derived through gene derivation and synthesis, demonstrating strong antibacterial and bactericidal activity, significant anti-inflammatory and cell proliferation ability, and was used to improve skin barrier function.
This polypeptide not only shows a broad-spectrum antibacterial activity, but also has significant anti-inflammatory and cell proliferation ability, which can effectively improve skin barrier function and make up for the shortcomings of antibiotics in the application.
Smart Images
Figure CN119591687A_ABST
Abstract
Description
Technical Field
[0001] The invention relates to a multifunctional peptide of Pleurotus nigromaculata and application thereof. Background Art
[0002] Inflammation, as the body's defensive response to damaging factors, involves a series of complex regulatory processes, including inflammatory responses triggered by tissue damage. Typical local manifestations include redness, swelling, heat, pain, and dysfunction, while systemic reactions may manifest as fever, changes in the number of white blood cells, and substantial organ lesions. In this process, immune cells, especially macrophages, play a key role. They can not only clear damaged tissues and phagocytose pathogens, but also secrete a variety of inflammatory factors and pro-inflammatory mediators under stimulation, such as prostaglandin E2, tumor necrosis factor-α, nitric oxide, interleukin-6, chemokines, interleukin-1β, and reactive oxygen species.
[0003] The integrity of the skin barrier is essential for the body to resist external environmental aggressions. The stratum corneum, as the main component of the skin barrier, is composed of keratinocytes. When the skin barrier is damaged, the function and life cycle of keratinocytes will be significantly affected. Under normal circumstances, keratinocytes gradually lose their organelles in the outermost layer of the skin and form a strong stratum corneum through the keratinization process. This process involves the transformation of intracellular proteins and lipids to build an effective protective barrier. However, in the case of damaged skin barrier, such as mechanical damage, chemical stimulation or pathological conditions (such as eczema), the normal keratinization process of keratinocytes may be blocked or abnormal, resulting in stratum corneum dysfunction.
[0004] In view of the above situation, accelerating the development of new drugs, especially therapeutic drugs for infection-induced inflammatory diseases and skin barrier damage, has become an important strategy to reduce the mortality rate and improve the prognosis of patients. With the continuous progress of biotechnology and medical science, peptide drugs and genetic technology have shown great potential in the development of new drugs. In the preparation of antibacterial and anti-inflammatory drugs and skin repair cosmetics, peptide drugs have broad application prospects.
[0005] As a defensive polypeptide produced by the immune defense system, antimicrobial peptides play an important role in protecting the host from invasion by foreign pathogens. At present, more than 3,100 natural antimicrobial peptides have been discovered, which are widely present in different organisms and are an important part of the innate immune system. Although the sequences of antimicrobial peptides are not highly conserved, most of them have short-chain, amphiphilic molecular characteristics and show strong antimicrobial activity against a variety of bacteria, fungi and viruses. In addition, antimicrobial peptides also have the advantages of low toxicity, high thermal stability, high solubility, small molecular weight and not easy to produce resistance, so they have broad potential application value in the medical field.
[0006] Due to their special habitat and skin structure, the bioactive substances secreted by the skin glands of amphibians have unique defense functions, including antimicrobial peptides, antioxidant peptides and peptides that promote wound healing. Since bombinins were first discovered from Bombina varieqata, a large number of antimicrobial peptides have been identified from a variety of amphibians. Among them, cathelicidin antimicrobial peptides, as a family of peptides with amphipathic cationic properties, exhibit multiple biological activities such as antiviral, wound healing, antioxidant and anti-inflammatory.
[0007] As a tree frog distributed in East Asia, the peptides derived from the skin of P. nigromaculata have significant research value in the field of drug development. These peptide substances usually have rich biological activities, such as antibacterial, antiviral and anti-inflammatory effects, which are helpful for the development of new drugs to treat various infectious and inflammatory diseases. In addition, because the peptides of P. nigromaculata can bind to specific receptors or biological molecules, they have strong targeting, providing an important target for drug design. Taking advantage of this targeting, more effective and safer drugs can be developed to reduce potential adverse effects on healthy tissues. At the same time, because these peptide drugs are derived from natural organisms, they are more easily absorbed and metabolized by organisms, thereby reducing the risk of adverse reactions.
[0008] In summary, peptide drugs derived from P. nigromaculata have shown broad research and development prospects in the treatment of infectious and inflammatory diseases. At present, no sequences identical to these peptides have been found in gene databases and protein databases, further highlighting their uniqueness and potential value. Therefore, in-depth research and development of peptide drugs from P. nigromaculata are expected to bring important innovative results to the future medical field. Summary of the invention
[0009] In view of the deficiencies in the prior art, the purpose of the present invention is to provide a multifunctional peptide of Pelophylax nigromaculata having antibacterial and anti-inflammatory activities and its application.
[0010] In a first aspect of the embodiments of the present application, a multifunctional peptide of P. nigromaculata is provided, and the amino acid sequence of the multifunctional peptide of P. nigromaculata is shown as SEQ ID NO.1.
[0011] In a second aspect of the embodiments of the present application, a nucleic acid molecule is provided, which consists of a nucleotide sequence encoding the polypeptide according to claim 1, characterized in that: the sequence from the 5' end to the 3' end is as shown in SEQ ID NO.2.
[0012] In a third aspect of the embodiments of the present application, an expression vector is provided, which comprises the nucleic acid molecule described in the second aspect.
[0013] In a fourth aspect of the embodiments of the present application, a cell is provided, comprising the nucleic acid molecule according to the second aspect or the vector according to the third aspect.
[0014] In a fifth aspect of the embodiments of the present application, there is provided the use of the multifunctional peptide of Pleurotus nigromaculata in active ingredients of antibacterial, anti-inflammatory and immunomodulatory therapeutic drugs.
[0015] In a sixth aspect of the embodiments of the present application, there is provided a use of the multifunctional peptide of Pleurotus nigromaculata in an active ingredient anti-infective drug.
[0016] In a seventh aspect of the embodiments of the present application, there is provided a use of the multifunctional peptide of Pelophylax nigromaculata in the preparation of a drug for preventing or treating inflammation.
[0017] In an eighth aspect of the embodiments of the present application, there is provided a use of the multifunctional peptide of Pleurotus nigromaculata in the preparation of cosmetics and beauty products.
[0018] In some embodiments of the present application, the multifunctional peptide of P. nigromaculata includes polypeptides, truncations, analogs, compositions and pharmaceutically acceptable carriers of the multifunctional peptide of P. nigromaculata.
[0019] When the polypeptide of the present invention is prepared into a pharmaceutical composition, the composition should contain an effective amount of the polypeptide of the present invention and a pharmaceutically acceptable carrier. Pharmaceutically acceptable carriers refer to substances commonly used in pharmaceutical preparations and harmless to patients, including but not limited to lactose, glucose, sucrose, sorbitol, mannitol, starch, gum arabic, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose, polyvinyl pyrrolidone, cellulose, water, syrup, methylcellulose, methyl hydroxybenzoate, propyl hydroxybenzoate, talc, magnesium stearate and / or mineral oil, etc.
[0020] In addition, according to actual needs, auxiliary ingredients such as lubricants, wetting agents, sweeteners, flavoring agents, emulsifiers, suspending agents and preservatives may be added to the pharmaceutical composition of the present invention. For suitable pharmaceutically acceptable carriers and preparation methods thereof, reference may be made to the detailed description in Remington's Pharmaceutical Sciences (19th edition, 1995).
[0021] In terms of administration, the pharmaceutical composition of the present invention can be administered orally or parenterally. In the case of parenterally, intravenous injection, subcutaneous injection, intramuscular injection, intraperitoneal injection, local injection or transdermal administration can be used. The dosage needs to be adjusted individually according to factors such as the formulation method, administration method, patient's age, weight, gender, pathological state, diet, administration time, administration route, excretion rate and reaction sensitivity. In general, the preferred dosage of the pharmaceutical composition of the present invention is 0.001 μg to 1000 μg per day.
[0022] When preparing the pharmaceutical composition of the present invention, the pharmaceutical composition can be formulated using pharmaceutically acceptable carriers and / or excipients by methods well known to those skilled in the art of pharmacy. The formulation can be in the form of a liquid such as a solution, suspension or emulsion, or in the form of a solid such as an extract, powder, granule, tablet or capsule. During the formulation process, a dispersant and / or stabilizer can be added as needed to ensure the stability and effectiveness of the formulation.
[0023] The beneficial effects of the present invention are:
[0024] The present invention deduces the amino acid sequence of the mature functional polypeptide based on the gene of the multifunctional peptide of P. nigromaculata, and the synthesized multifunctional peptide of P. nigromaculata exhibits strong antibacterial and bactericidal activity, and has significant anti-inflammatory and cell proliferation promoting abilities, and can effectively improve the skin barrier function. The introduction of this polypeptide is expected to make up for the shortcomings of antibiotic drugs in their application.
[0025] It is worth mentioning that the multifunctional peptide of the present invention has the characteristics of simple structure, convenient artificial synthesis and outstanding activity, which makes it have a wide range of application prospects. The polypeptide can not only be used as a candidate component for preparing therapeutic drugs for preventing or treating wound bacterial infection and inflammation-related diseases, but also can be used in cosmetics and beauty products related to preventing skin inflammation and barrier damage.
[0026] In terms of application, the therapeutic drug can be administered by injection, mucosal administration, cavity administration (drugs) or external use (cosmetics) and other methods, thereby meeting the treatment needs of different patients and improving the treatment effect. The multifunctional peptide of the present invention provides new ideas and directions for the research and application of related fields. BRIEF DESCRIPTION OF THE DRAWINGS
[0027] Figure 1 The HPLC purification and identification results of the multifunctional peptide of Pelophylax nigromaculata of the present invention;
[0028] Figure 2 The mass spectrometry identification result of the multifunctional peptide of Pelophylax nigromaculata of the present invention;
[0029] Figure 3 The results of the multifunctional peptide of Pleurotus nigromaculata of the present invention inhibiting the growth of various bacteria;
[0030] Figure 4 The results of the multifunctional peptide of Pleurotus nigromaculata of the present invention inhibiting pro-inflammatory cytokines;
[0031] Figure 5 The results show that the multifunctional peptide of Pleurotus nigromaculata of the present invention inhibits inflammation in mice. DETAILED DESCRIPTION
[0033] The principles and features of the present invention are described below, and the examples are only used to explain the present invention and are not used to limit the scope of the present invention. The present invention is described more specifically by way of example in the following paragraphs. According to the following description and claims, the advantages and features of the present invention will become clearer.
[0034] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those commonly understood by those skilled in the art of the present invention. The terms used herein in the specification of the present invention are only for the purpose of describing specific embodiments and are not intended to limit the present invention. The term "and / or" used herein includes any and all combinations of one or more related listed items.
[0035] Example 1
[0036] 1. Overview of the experimental process
[0037] This study involves two cycles. After the cycle is completed, the cDNA double strands synthesized in the centrifuge tube need to be extracted.
[0038] 2. PCR product extraction and recovery
[0039] Using PROMEGA's SV Gel and PCR Clean-Up System kit was used to extract and recover the PCR product. The specific steps are as follows:
[0040] 1. Mix the cDNA double strands obtained by PCR with an equal volume of membrane binding buffer.
[0041] 2. Transfer the mixture to a centrifugal purification column and let it stand at room temperature for 5 minutes to ensure that the DNA is fully bound to the silica membrane.
[0042] 3. Centrifuge at 12000 rpm for 30 seconds and discard the waste liquid in the collection tube.
[0043] 4. Add 700 μl of elution buffer containing ethanol to the centrifugal purification column, centrifuge again at 12,000 rpm for 30 seconds, and discard the waste liquid.
[0044] 5. Repeat the above elution steps.
[0045] 6. Centrifuge at 12000 rpm for 5 minutes.
[0046] 7. Place the centrifugal purification column in a new centrifuge tube, add 30 μl of ultrapure water, and let stand at room temperature for 5 minutes.
[0047] 8. Centrifuge at 12000 rpm for 30 seconds. The solution at the bottom of the centrifuge tube is the purified cDNA double strand.
[0048] 3. Enzyme digestion, ligation and transformation
[0049] Add 1μl Takara pMD18-T vector and 4μl black-spotted frog cDNA double-stranded solution in a microcentrifuge tube in turn, with a total volume of 5μl. Then add 5μl of ligase buffer mixture. React at 16℃ for 2 hours. Add all the reaction solution (10μl) to 100μl DH5α competent cells and place on ice for 30 minutes. Then, heat at 42℃ for 90 seconds and place on ice again for 1 minute. Next, add 890μl LB medium that has been incubated at 37℃, and continue to culture slowly at 37℃ for 60 minutes. Finally, take 200μl of culture solution and evenly spread it on LB medium containing X-Gal, IPTG, and Amp, and culture at 37℃ for 16 hours to form single colonies. Wash the colonies on each LB plate with 5ml LB liquid culture medium and add 30% glycerol for freezing. The constructed cDNA library contains about 1×10^6 individual clones.
[0050] 4. Cloning and screening of multifunctional peptide genes of Pleurotus nigromaculata
[0051] This experiment used a 25-nucleotide amplification primer with a sequence of 5'ATGAAGGTCTGGCAGTGCGCGCTC 3' (SEQ ID NO. 3). Another PCR amplification primer was 3'PCR Primer in SMARTTM cDNA Library Construction Kit of CLONTECH, with a sequence of 5'ATTCTAGAGGCCGAGGCGGCCGACATG 3' (SEQ ID NO. 4). The PCR reaction conditions were set as: 94°C pre-denaturation for 30 seconds, 50°C annealing for 45 seconds, 72°C extension for 2.5 minutes, and a total of 35 cycles.
[0052] First, the constructed bacterial cDNA library was titrated and diluted to an appropriate bacterial concentration (about 5000 bacteria / ml in the first round of screening and about 30 bacteria / ml in the second round of screening) with LB medium containing 100 μg / ml ampicillin. Subsequently, the plates were plated in an 8×8 matrix on a 96-well culture plate (64 wells in total, 100 μl per well) and cultured overnight at 37°C. The bacterial culture fluids were merged by row and column, and 16 samples were selected for PCR identification. The bacterial samples in the cross-positive wells were included in the second round of screening.
[0053] 5. Sequence determination and analysis of the multifunctional peptide gene of Pleurotus nigromaculata
[0054] Extract bacterial samples from the wells with positive results in the second round of screening in step 4, and then extract plasmid DNA. The nucleotide sequence was determined by the dideoxy method, and the instrument used was Applied Biosystems 373A fully automatic nucleotide sequencer. The sequencing primers included BcaBESTTM Sequencing Primer RV-M and BcaBESTTM Sequencing Primer M13-47. Among them, the nucleotide sequence of BcaBESTTM Sequencing Primer RV-M is: 5'-GAGCGGATAACAATTTCACACAGG-3' (SEQ ID NO.5); the nucleotide sequence of BcaBESTTM Sequencing Primer M13-47 is: 5'-CGCCAGGGTTTTCCCAGTCACGAC-3' (SEQ ID NO.6).
[0055] The gene sequencing result shows that the sequence from the 5' end to the 3' end is shown in SEQ ID NO.2, and the specific sequence length is 294 bases. The sequence is a single-stranded nucleic acid with a linear peptide structure, and is derived from the cDNA in the skin tissue of the black-spotted frog. According to the sequencing result analysis, the gene encodes a multifunctional activity.
[0056] Example 2
[0057] Ⅰ. Preparation process of multifunctional peptide of Pleurotus nigromaculata:
[0058] First, based on the gene sequence of the multifunctional peptide of the black-spotted frog, the functional mature multifunctional amino acid sequence was accurately deduced. Subsequently, the peptide was synthesized strictly according to the deduced amino acid sequence using an advanced automatic peptide synthesizer. To ensure the purity and activity of the peptide, a high-performance liquid chromatography (HPLC) reverse phase C18 column was used for chromatographic desalting and purification. In the process of disulfide bond formation, we used air oxidation method, the specific steps are to dissolve the peptide in 0.1% acetic acid solution in a suitable flask to make its concentration reach 0.1mg / ml, and then adjust the solution pH to 7.8 by titration with ammonium hydroxide, and ensure sufficient stirring overnight at room temperature. After the oxidation is completed, the HPLC reverse phase C18 column is used again for chromatographic desalting and purification to ensure the purity of the peptide. During the purification process, the mobile phase A used is 100% acetonitrile (CH3CN) containing 0.1% trifluoroacetic acid (TFA), and the mobile phase B is a pure water solution containing 0.1% TFA. Within 25 minutes, the concentration of liquid A gradually increased from 27% to 52%, and was monitored by HPLC at a wavelength of 220nm. Finally, the purity of the purified multifunctional peptide of P. nigromaculata was identified by HPLC, and the spectrum showed that the peptide appeared at 8.645 minutes.
[0059] Ⅱ. Molecular weight determination method:
[0060] The molecular weight was determined using advanced fast atom bombardment mass spectrometry (FAB-MS). In this process, we selected glycerol, m-nitrobenzyl alcohol and dimethyl sulfoxide as a substrate in a volume ratio of 1:1:1, used Cs+ as the bombardment particle, set the current to 1μA, and the emission voltage to 25Kv. Through the analysis and calculation of the mass spectrum, we obtained the molecular weight of the polypeptide to be 3417.10Da.
[0061] The multifunctional peptide of P. nigromaculata is a polypeptide encoded by the multifunctional peptide gene of the Chinese amphibian P. nigromaculata, with a molecular weight of 3417.10 Da and an isoelectric point of 8.82. Its specific amino acid sequence is: Gly Phe LeuAsp Ile Ile Lys Asn Leu Gly Lys Thr Phe Ala Gly His Met Leu Asp Lys Ile LysCys Thr Ile Gly Thr Cys Pro Pro Ser Pro(GFLDIIKNLGKTFAGHMLDKIKCTIGTCPPSP)(SEQID NO.1). The gene sequence of the polypeptide consists of SEQ ID NO.2, wherein the nucleotide sequence encoding the functional mature multifunctional peptide of P. nigromaculata is located at positions 108 to 294.
[0062] Experimental Example 1
[0063] Regarding the study of the effect on the ability to inhibit bacteria, this study used plate dilution method and scanning electron microscopy to conduct a detailed analysis.
[0064] In the plate dilution method experiment, first take out the frozen bacterial solution stored at -80℃, thaw quickly in a 37℃ water bath, add it to fresh broth medium for activation, and culture it overnight in a constant temperature shaker at 37℃ and 220rpm. Then, take an appropriate amount of the activated bacterial solution and add it to the new broth medium, and continue to culture until the bacteria reach the logarithmic growth phase (OD600 value is between 0.6 and 0.8). Then, collect the bacteria by centrifugation, wash with physiological saline and resuspend in equal volume. After that, dilute the bacterial solution to a specific multiple with fresh LB medium to adjust the bacterial density to an appropriate range. Then, in a sterile 96-well flat-bottom plate, use the two-fold dilution method to prepare a series of sample working solutions with a concentration gradient, add a mixture of the sample to be tested and the bacterial solution to each well, and set up a negative control group. Finally, the culture plate is cultured at 37℃ for a certain period of time, and each group of experiments is repeated at least three times.
[0065] The experimental results showed that the antimicrobial peptides of P. nigromaculata exhibited a broad spectrum of inhibitory activity against the tested strains. Among them, Escherichia coli and Candida albicans were particularly sensitive to the antimicrobial peptides, with the minimum inhibitory concentration (MIC value) of both being 25 μM. For Staphylococcus aureus, the MIC value was 50 μM.
[0066] To further explore the antibacterial mechanism of antimicrobial peptides, this study also used scanning electron microscopy. First, Escherichia coli and Staphylococcus aureus in the logarithmic growth phase were collected. After centrifugation, washing, resuspension and other steps, they were incubated with antimicrobial peptides or an equal volume of PBS for a certain period of time. Subsequently, through a series of treatment steps such as fixation, dehydration, and replacement, the bacterial solution was prepared into a sample suitable for scanning electron microscopy observation. Finally, the morphology of bacteria in the experimental group and the control group and the changes in bacterial membrane were observed using a scanning electron microscope.
[0067] The observation results show that the antimicrobial peptides of P. nigromaculata can exert their antibacterial effects by destroying the bacterial cell membrane and inducing increased permeability. This discovery provides an important experimental basis for our in-depth understanding of the antibacterial mechanism of antimicrobial peptides.
[0068] In summary, this study systematically studied the inhibitory ability and mechanism of the antimicrobial peptides of P. nigromaculata against bacteria by using two methods: plate dilution method and scanning electron microscopy. The experimental results not only confirmed the broad-spectrum antibacterial activity of the antimicrobial peptides, but also revealed the specific mechanism by which they exert their antibacterial effects by destroying the bacterial cell membrane. These findings are of great significance for the development of new antimicrobial drugs and improving the effectiveness of disease prevention and treatment.
[0069] Experimental Example 2
[0070] 1. Study on the effect of peptides on the release of pro-inflammatory cytokines from RAW264.7 cells induced by LPS
[0071] In this study, mouse peritoneal macrophages RAW264.7 were used as experimental subjects, which were inoculated in 96-well plates and treated for overnight adhesion. Subsequently, the cells were pretreated with different concentrations of the multifunctional peptide of P. nigromaculata and exposed to the LPS environment. After the incubation, the cell supernatant was collected as the test sample. Through the detection of the Thermo Fisher ELISA kit, we found that the expression levels of proinflammatory cytokines IL-1β, IL-6 and TNF-α in LPS-induced cells were significantly increased. However, it is worth noting that the multifunctional peptide of P. nigromaculata can effectively inhibit the release of proinflammatory cytokines stimulated by LPS, and this inhibitory effect shows a significant concentration dependence.
[0072] 2. Study on the in vivo model of acute inflammation induced by carrageenan in mice
[0073] In this part of the study, 24 Kunming mice weighing between 20-25g were selected and randomly divided into four groups. They were placed in an environment with suitable temperature (22±1℃) and humidity (55±10%) and regular light-dark cycles. Acute inflammation was induced by a single injection of carrageenan in the right hind paw of mice. One hour before the injection of carrageenan, the mice were intraperitoneally injected with the multifunctional peptide of P. nigromaculata and the positive control indomethacin solution. At the set time points, the volume changes of the right hind paw of mice were accurately measured using a toe solvent meter. In addition, 5 hours after the injection of carrageenan, the mice were euthanized and the relevant tissues were collected for subsequent analysis. The supernatant was obtained by homogenization and centrifugation with physiological saline, and the levels of proinflammatory cytokines IL-1β, IL-6 and TNF-α in it were measured using ELISA kits. The experimental results showed that the multifunctional peptide of P. nigromaculata can effectively inhibit the swelling of the mouse foot induced by carrageenan, thereby controlling the progression of acute inflammation.
[0074] In summary, this study verified the significant anti-inflammatory effect of the multifunctional peptide of P. nigromaculata through in vivo and in vitro experiments, providing a strong experimental basis for its application in related fields.
[0075] Experimental Example 3
[0076] The human fibroblast proliferation experiment was conducted using the MTT method to evaluate the effect of the multifunctional peptide of P. nigromaculata on the proliferation activity of human keratinocytes. In this experiment, we used the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-tetrazolium (MTT) colorimetric assay as an evaluation method. The experimental steps are as follows: First, 1×104 cells / well were seeded into a 96-well plate; then, different concentrations of the multifunctional peptide of P. nigromaculata (0, 2.5, 5, 10, 20, 40 μM, respectively) were added and incubated for 24 hours; then, 10 μl of MTT solution (concentration of 5 mg / mL) was added to each well. After incubation for another 4 hours, we carefully removed the supernatant and dissolved the formed formazan crystals in 200 μl of dimethyl sulfoxide for 10 minutes. Finally, the absorbance of each well was measured at a wavelength of 490 nm using a microplate reader.
[0077] The results showed that the multifunctional peptide from Pelophylax nigromaculata promoted the proliferation of human fibroblasts in a concentration-dependent manner.
[0078] The above embodiments of the present invention are not intended to limit the protection scope of the present invention, and the implementation modes of the present invention are not limited thereto. All other modifications, replacements or changes made to the above structures of the present invention based on the above contents of the present invention, in accordance with common technical knowledge and customary means in the art, without departing from the above basic technical ideas of the present invention, should fall within the protection scope of the present invention.
Claims
1. A multifunctional peptide of Pelophylax nigromaculata, the amino acid sequence of which is shown in SEQ ID NO.
1.
2. A nucleotide sequence of a multifunctional peptide gene of P. nigromaculata, wherein the cDNA consists of 294 nucleotides, and the sequence from the 5' end to the 3' end is shown in SEQ ID NO.2, wherein the nucleotides 108-294 encode a functional mature multifunctional peptide of P. nigromaculata.
3. An expression vector comprising the nucleic acid molecule according to claim 3.
4. A cell comprising the nucleic acid molecule according to claim 3 or the vector according to claim 3.
5. The gene sequence of the multifunctional peptide of Pleurotus nigromaculata according to claim 1, consisting of SEQ ID NO.
2.
6. Use of the multifunctional peptide of Pelophylax nigromaculata according to claim 1 in active ingredients of antibacterial, anti-inflammatory and immunomodulatory therapeutic drugs.
7. Use of the multifunctional peptide of Pelophylax nigromaculata according to claim 1 in an active ingredient anti-infective drug.
8. Use of the multifunctional peptide of Pelophylax nigromaculata according to claim 1 in preparing a drug for preventing or treating inflammation.
9. Use of the multifunctional peptide of Pelophylax nigromaculata according to claim 1 in the preparation of cosmetics and beauty products.
10. The multifunctional peptide of Pleurotus nigromaculata according to any one of claims 6 to 9, characterized in that: The multifunctional peptide of P. nigromaculata comprises polypeptides, truncations, analogs, compositions and pharmaceutically acceptable carriers of the multifunctional peptide of P. nigromaculata.