Staphylococcus xylosus phage phi Sx-2 and application thereof
By using Staphylococcus xylose phage ΦSx-2, the problems of spoiled bacteria in fermented vegetables were solved, significantly improved the abundance of lactic acid bacteria, and improved the quality and flavor of fermented products.
Patent Information
- Application Number
- CN202411681812.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-22
- Publication Date
- 2025-03-11
AI Technical Summary
During the fermentation of vegetables, the presence of spoiled bacteria such as Erwinia and Pantoea may lead to fermentation abnormalities or failures, and the prior art is little known about the role of non-cellular microorganisms, especially viruses, in the kimchi fermentation system.
Provided is a phage ΦSx-2, which can effectively cleave Staphylococcus xylos, significantly improve the relative abundance of lactic acid bacteria in fermented vegetables, reduce the relative abundance of spoiled bacteria, and inhibit the formation of nitrite.
By inoculating the phage ΦSx-2, the bacterial structure in fermented vegetables is significantly improved, the abundance of lactic acid bacteria is improved, the activity of spoiled bacteria is reduced, and the quality and flavor of fermented products are improved.
Smart Images
Figure CN119592520A_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of microbial fermentation, and in particular relates to a Staphylococcus xylosus bacteriophage ΦSx-2 and a use thereof. Background Art
[0002] Traditional fermented vegetables enjoy a high reputation both at home and abroad for their unique flavor, excellent nutritional value and rich probiotics. Sichuan pickles occupy an important position in the Chinese pickle market. Fermented food is essentially a dynamic microbial ecosystem in which various microbial populations multiply rapidly in a relatively short period of time, which usually ranges from a few days to a few weeks or even a few months. Diverse microbial communities are interdependent, compete and cooperate with each other during vegetable fermentation, and jointly promote the fermentation process. Thanks to the combination of traditional culture methods and modern high-throughput sequencing technology, we can now more comprehensively analyze the dynamic changes of microbial communities during kimchi fermentation, especially the core role of lactic acid bacteria (such as Lactobacillus and Pediococcus) in promoting the fermentation process. However, the presence of certain spoilage bacteria (such as Enterobacteriaceae, Pichia pastoris, and Candida) may cause fermentation abnormalities or even failures, ultimately resulting in the complete loss of value of the fermented product. Although we have a considerable understanding of the role of cellular microorganisms in fermentation, we still know little about the role of non-cellular microorganisms, especially viruses, in the kimchi fermentation system.
[0003] Viruses, tiny organisms found in all natural ecosystems, can infect a wide range of life forms, from prokaryotes to eukaryotes. Among them, bacteriophages are the most abundant group of viruses in the biosphere, with an estimated population of 10 31 . Bacteriophages feed on specific bacteria, lyse bacteria to release new virus particles, and then infect more hosts. This characteristic suggests that they may play an important role in fermented foods rich in microorganisms. In fact, bacteriophages have been found in a variety of fermented foods, including wine, meat, cheese, yogurt, bread and kimchi, and their diversity is affected by multiple factors such as geographical location, climate, environment, raw materials, processing methods and microbial community structure. Previous studies have focused on the potential negative effects of bacteriophages on fermentation, such as hindering the fermentation process by destroying lactic acid bacteria and yeast, ultimately leading to fermentation failure. However, emerging research shows that bacteriophages can also positively affect the quality and flavor of fermented products by regulating bacterial communities. In the fermentation process of Sichuan pickles, bacteriophages play a key role as regulators of microbial activities and cannot be ignored. Understanding their behavior and specificity in host organisms is crucial to promoting research in the field of Sichuan pickles and other fermented vegetables.
[0004] Staphylococci in food are a hot topic of concern because they may have an impact on food safety and human health. Staphylococci are widely present in various foods, especially in foods that are rich in nutrients and easy for bacterial growth, such as dairy products, meat, and leftovers. They are divided into two categories according to their ability to produce coagulase: coagulase-positive and coagulase-negative. The former are mostly pathogenic, such as Staphylococcus aureus, while the latter are mostly considered harmless, but some species (such as Staphylococcus epidermidis and Staphylococcus haemolyticus) are occasionally reported to cause disease. Staphylococcus xylosus, as a type of coagulase-negative staphylococcus, has attracted attention from the food industry due to its fermentation ability and contribution to food taste. However, excessive levels of Staphylococcus xylosus in food or improper handling may cause food safety problems. Therefore, the addition amount and fermentation conditions of Staphylococcus xylosus need to be strictly controlled during food production. Summary of the invention
[0005] In view of the above-mentioned deficiencies in the prior art, the present invention provides a Staphylococcus xylosus phage ΦSx-2, which can improve the flora structure in fermented vegetables, significantly increase the relative abundance of lactic acid bacteria in the dominant bacterial genera in fermented vegetables, and reduce the relative abundance of spoilage bacteria such as Erwinia and Pantoea.
[0006] To achieve the above purpose, the technical solution adopted by the present invention to solve the technical problem is:
[0007] The purpose of the present invention is to provide a Staphylococcus xylosus phage ΦSx-2, which was deposited on August 12, 2024 at the General Microbiological Center of China Microorganism Culture Collection Committee, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, with a deposit number of: CGMCC No.46100.
[0008] Another object of the present invention is to provide a phage suspension comprising the above-mentioned phage ΦSx-2.
[0009] Another object of the present invention is to provide the use of the above-mentioned Staphylococcus xylosus phage ΦSx-2 or phage suspension in the preparation of fermented vegetables.
[0010] Another object of the present invention is to provide a preparation for improving the quality of fermented vegetables, wherein the preparation uses the above-mentioned Staphylococcus xylosus phage ΦSx-2 or phage suspension as an active ingredient.
[0011] Another object of the present invention is to provide the use of the above-mentioned Staphylococcus xylosus phage ΦSx-2 or phage suspension in any of the following directions of vegetable fermentation:
[0012] A1) Increase lactic acid content;
[0013] A2) Reduce nitrite content.
[0014] Another object of the present invention is to provide the use of the above-mentioned Staphylococcus xylosus phage ΦSx-2 or phage suspension in the preparation of a preparation for inhibiting the activity of spoilage bacteria that cause fermented vegetables to spoil.
[0015] Further, the fermented vegetables are kimchi.
[0016] Furthermore, the spoilage bacteria are Erwinia or Yersinia.
[0017] Another object of the present invention is to provide a preparation for inhibiting the activity of spoilage bacteria, wherein the preparation uses the above-mentioned Staphylococcus xylosus phage ΦSx-2 or phage suspension as an active ingredient.
[0018] Furthermore, the spoilage bacteria are Erwinia or Yersinia.
[0019] Beneficial effects of the present invention:
[0020] The invention discloses a specific bacteriophage ΦSx-2 isolated from Sichuan pickles, which can effectively lyse Staphylococcus xylosus. After inoculation with the bacteriophage ΦSx-2, the relative abundance of lactic acid bacteria in the fermented vegetable system can be significantly increased, and the nitrite content can be reduced. In addition, the invention can also inhibit the activity of microorganisms such as Erwinia (Erwinia) and Yersinia (Yersinia) that can cause the fermented vegetables to spoil. BRIEF DESCRIPTION OF THE DRAWINGS
[0021] Figure 1 This is the pH change detection diagram during the normal fermentation process of kimchi;
[0022] Figure 2 The morphology of phage concentrate and its SDS-PAGE test results;
[0023] Figure 3 For the case where the bacteriophage infects the host;
[0024] Figure 4 This is a transmission electron microscope image of bacteriophage ΦSx-2;
[0025] Figure 5 The results of the tolerance test of bacteriophage ΦSx-2;
[0026] Figure 6 To test the effect of inoculation with bacteriophage ΦSx-2 on kimchi fermentation;
[0027] Figure 7 To test the effect of inoculation with bacteriophage ΦSx-2 on the lactic acid content during kimchi fermentation;
[0028] Figure 8 To test the effect of inoculation with bacteriophage ΦSx-2 on the nitrite content during kimchi fermentation;
[0029] Fig. 9 Flow chart for sequencing data processing and bioinformatics analysis;
[0030] Fig.10 is the Alpha diversity index of the bacterial community after fermentation with bacteriophage ΦSx-2;
[0031] Fig.11 It is a stacked bar chart of bacterial community composition at the genus level;
[0032] Fig.12 LEfse analysis of microbial communities. DETAILED DESCRIPTION
[0033] The specific implementation modes of the present invention are described below so that those skilled in the art can understand the present invention. However, it should be clear that the present invention is not limited to the scope of the specific implementation modes. For those of ordinary skill in the art, as long as various changes are within the spirit and scope of the present invention as defined and determined by the attached claims, these changes are obvious, and all inventions and creations utilizing the concept of the present invention are protected.
[0034] Example 1 Screening of phage
[0035] 1. Preparation and pH determination of Sichuan pickles
[0036] Add the cleaned and processed cowpeas to a Sichuan pickle jar, and pour in the prepared brine (the ratio of vegetables to brine is about 1:3). Add old brine (taken from the Sichuan pickles prepared earlier in the laboratory) according to the ratio (old brine: brine ≈ 1:500, v / v), cover the jar, add water to the edge of the jar to seal it, and ferment it at room temperature for 12 days. Prepare a total of 3 jars of Sichuan pickles as parallel controls according to the above method. During the first 7 days of the cowpea fermentation process, 1 mL of fermentation liquid samples were collected from the top, middle and bottom layers of the jar every day to monitor the pH value. After this initial stage, the pH value was measured every two days using the same sampling method from the 8th to the 12th day, and the results are shown in the table below. Figure 1 .
[0037] 2. Amplification and concentration of bacteriophages in Sichuan pickles
[0038] During the first three days of the experiment, 240 mL of fermentation broth was collected and centrifuged (8000 rpm, 4 °C, 10 min). The supernatant was transferred to a sterile conical flask and stored in a refrigerator at 4 °C for later use. The bacterial precipitate was resuspended in an appropriate amount of sterile saline and added to 400 mL of TSB medium (containing calcium chloride). At the same time, cycloheximide (final concentration 10 μg / mL) was added to remove fungi from the phage amplification system. It was then placed in a shaker (37 °C, 150 rpm) and cultured until the early logarithmic phase (OD 600nm ≈0.3), and then 200 mL of fermented cowpea liquid supernatant was added, and the culture was continued on a shaker (37°C, 150 rpm) for 24 h to obtain a phage amplification solution.
[0039] After the phage amplification solution reached room temperature, DNase I and RNase (final concentration of 1 μg / mL) were added thereto, followed by incubation at room temperature for 30 min. NaCl was then added to the solution to a final concentration of 1 mol / L, stirred until completely dissolved, and then transferred to an ice bath for 1 h. Next, the phage amplification solution was centrifuged (8000 rpm, 4°C, 10 min). The resulting bacterial precipitate was suspended in an appropriate amount of sterile saline and preserved with glycerol. At the same time, the supernatant of the phage amplification solution was sterilized by vacuum filtration (0.45 μm). PEG 8000 (10%, w / v) was added to the sterilized phage amplification supernatant and gently stirred with a magnetic stirrer at room temperature until completely dissolved. The solution was transferred to a centrifuge tube, and after standing in an ice bath for 1 h, it was centrifuged (8000 rpm, 4°C, 20 min) to precipitate phage particles. After centrifugation, the supernatant was carefully poured out and the centrifuge tube was tilted for 5 min to drain the remaining liquid. Subsequently, SM buffer (1.6%, v / v) was added to the centrifuge tube and the precipitate was soaked at room temperature for 1 hour, and then the precipitate was gently resuspended. Then an equal volume of chloroform was added to the centrifuge tube and gently shaken for 30 seconds. Finally, centrifugation was performed (3000g, 4°C, 15min), and the upper hydrophilic phase was recovered to obtain a concentrated phage solution (see Figure 2 A).
[0040] 3. SDS-PAGE experiment of phage concentrate
[0041] The phage concentrate was subjected to SDS-PAGE experiment, and the results are shown in Figure 2 B, the specific process is as follows:
[0042] According to the kit formula, prepare separation gel (12%) and concentration gel (5%) in sequence, load 10 μL sample and electrophoresed at 160 volts for about 40 minutes, then stain with staining solution for about 4 hours, then decolorize with decolorizing solution 3-4 times, each decolorization for about 30 minutes, and finally observe the protein bands. Sample preparation: phage concentrate and loading buffer are mixed in a ratio of 4:1, and then boiled in water for 10 minutes.
[0043] like Figure 2 As shown in B, different protein bands were found in the samples on days 1, 2, and 3, and the total protein content was similar. However, the distribution of these bands was different between days 1, 2, and 3, with the main bands concentrated at 66.2 KDa and in the range of 26.0 KDa-45.0 KDa.
[0044] 4. Isolation of bacteriophages and their specific hosts
[0045] Dilute the glycerol frozen bacterial pellet to an appropriate concentration and spread it on a tryptone soy agar (TSA) plate and incubate it at 37°C for 12 hours. Add 200 μL of tryptone soy broth (TSB) medium to each sterile 96-well plate. Subsequently, pick a single colony from the TSA plate and inoculate it into a 96-well plate as a potential host, and set up 2 blank control wells for comparison. Place the plate in a 37°C incubator for 12 hours to obtain a sample of a single bacterial liquid culture. Pipette an appropriate amount of single bacterial liquid from the 96-well plate and evenly spread it on a plate containing CaCl 2 Then, add 10 μL of phage concentrate to each plate, and add an equal amount of SM buffer as a blank control. After the plates are air-dried, they are placed in a 37°C incubator for 12 hours. After that, check the presence of plaques on the plates. If plaques are detected, pick them and co-culture them with the corresponding single bacterial solution to obtain a large number of single phage particles. Finally, the phages and their host bacteria are stored for future use.
[0046] 5. Host molecular biology identification
[0047] The 16S rRNA gene of the isolated phage host was amplified using PCR technology. The PCR reaction system consisted of 13 μL 2× Taq MasterMix, 1 μL upstream primer 27F (AGAGTTTGATCCTGGCTCAG), 1 μL downstream primer 1492R (GGTTACCTTGTTACGACTT), 9 μL double distilled water (ddH 2O) and 1 μL of the bacterial solution to be identified. The PCR reaction conditions were 94°C pre-denaturation for 5 min, 94°C denaturation for 30 s, 55°C annealing for 30 s, 72°C extension for 30 s, and 72°C final extension for 2 min (30 cycles from denaturation to extension). The PCR products were then electrophoresed in 1% agarose gel. Qualified PCR products were sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. The sequencing sequences were compared with the database of the National Center for Biotechnology Information (NCBI) of the United States to determine the species of the host. The results showed that the host bacteria was Staphylococcus xylosus, and its bacteriophage was named ΦSx-2. It was deposited at the General Microbiology Center of China National Microbiological Culture Collection Committee, No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing on August 12, 2024, and its deposit number is: CGMCC No.46100 (see Figure 3 , Figure 3 C in the figure is the added SM buffer, and P is the added phage concentrate).
[0048] 6. Transmission electron microscopy (TEM) observation of phage ΦSx-2 morphology
[0049] The phage concentrate was observed using a transmission electron microscope (TEM). Figure 4 , the specific process is as follows:
[0050] First, the phages in the concentrate were adsorbed onto a copper grid, and then negatively stained with 1% phosphotungstic acid at room temperature for 1-2 min. Finally, the phages adsorbed onto the copper grid were observed and captured using a TEM at 80 kV at a magnification of 120,000 times.
[0051] like Figure 4 As shown, the bacteriophage ΦSx-2 is a long-tailed phage with a head plane that is approximately hexagonal and a straight tail with a bottom plate. The diameter of the head is about 117.2 nm and the tail is about 157.6 nm long.
[0052] Example 2 Phage tolerance detection
[0053] 1. Study on acid resistance of bacteriophage
[0054] Mix 100 μL of phage solution with 900 μL of TSB medium with different pH values (4.0, 5.0 and 6.0), take out 100 μL to determine the titer of phage; after the TSB medium with phage solution is placed at room temperature for 4 hours, immediately take out 100 μL from it to evaluate the titer of phage. Use double-layer agar plate technology to evaluate phage titer: make a series of ten-fold dilutions of phage solution, take 50 μL each time and mix with an equal amount of host bacterial liquid, then add them to the pre-packaged TSB semi-solid medium and mix them, pour them into the pre-prepared TSA plate (containing calcium chloride), incubate at 37°C for 12 hours after solidification, and then count the number of plaques. The results are shown in Figure 5 .
[0055] 2. Study on bacteriophage salt tolerance
[0056] Add 100 μL of phage solution to 900 μL of TSB medium with a salt concentration of 5% to reach a final salt concentration of 4.5%. The subsequent operation process is the same as step 1. The results are shown in Figure 5 .
[0057] like Figure 5 As shown in the figure, after the phage ΦSx-2 was exposed to the environment of pH 6.0, 5.0, and 4.0 for 4 hours, its titer did not show a significant decrease; similarly, after they were exposed to the environment of salt concentration of 4.5% for 4 hours, their titer did not show a significant decrease. The experimental results show that the phage ΦSx-2 isolated from Sichuan pickles has a good survival rate under low pH and high salt concentration, that is, low pH and high salt environment have no significant effect on the infection ability of phage ΦSx-2.
[0058] Example 3 Effect of phage inoculation on kimchi fermentation
[0059] 1. Kimchi fermentation with phage inoculation
[0060] Wash the red radish with tap water, dry it, and cut it into small pieces. Add the processed red radish and salt water (red radish: salt water ≈ 1:3, w / V) into the kimchi jar (the final salt concentration of the fermentation system is 4.5%), and then inoculate the bacteriophage ΦSx-2 (inoculation amount is about 10 8 PFU). Finally, the lid was covered and water was added to the edge of the jar to seal it, and it was naturally fermented for 28 days at a room temperature of about 20°C. At the same time, kimchi without phage inoculation was prepared according to the same operation as the blank control group (C group). Three jars of Sichuan kimchi were prepared in the C group and the group inoculated with phage ΦSx-2 (ST group) for parallel control, that is, a total of 6 jars.
[0061] The sampling time points are 0-7 days, 14 days, 21 days and 28 days of fermentation. After sampling, physical and chemical indicators are measured. At the same time, microbial diversity sequencing is performed on the 0th, 7th and 14th days of fermentation to clarify its flora structure (sampling on the 0th day of fermentation is performed 4 hours after inoculation of bacteriophage). Explanation of sampling time points: 0-7 days, fermentation start to fermentation maturity stage; 14th day: pH value begins to stabilize; 21st and 28th days, stable storage stage. When sampling, take appropriate amounts of kimchi liquid from the upper, middle and lower parts of the kimchi jar and mix them.
[0062] 2. Determination of physical and chemical indicators
[0063] 1. pH, total bacterial count and lactic acid bacteria determination
[0064] At the corresponding sampling time point, the pH value of the sampled kimchi liquid was measured using a pH acidity meter, and the total bacterial count and lactic acid bacteria count during the fermentation of Sichuan kimchi were measured using TSA plates and MRS plates (containing calcium carbonate), respectively. The results are shown in Figure 6 Among them, Figure A is the pH test result, Figure B is the total live bacteria count test result, and Figure C is the lactic acid bacteria count test result.
[0065] like Figure 6 As shown in the figure, as the fermentation of Sichuan pickles progressed, the pH of each group dropped from about 6.5 to about 3.0 and remained until the end of the fermentation, with the overall change trend being roughly the same. On the 7th day, the pH of the C group (the group not inoculated with phage) was about 4.0, while the pH of the ST group (the group inoculated with phage ΦSx-2) was about 3.5. At this time, the Sichuan pickles of both groups were mature (Figure A).
[0066] The total bacterial count and lactic acid bacteria count of each group reached a peak on the 3rd or 4th day of fermentation, then began to gradually decline and reached the lowest on the 28th day of fermentation (Figures B and C). According to the above test results, the inoculation of bacteriophages did not significantly affect the changes in pH, total bacterial count and lactic acid bacteria count during the fermentation of Sichuan pickles, that is, the inoculation of bacteriophages did not significantly affect the normal fermentation of Sichuan pickles.
[0067] 2. Determination of nitrite and lactic acid content
[0068] (1) The method for determining nitrite changes was based on GB 5009.33-2016 and modified. The final experimental process is as follows:
[0069] Respectively pipette 0mL, 0.1mL, 0.2mL, 0.4mL, 0.6mL, 0.8mL, 1.0mL, 1.5mL and 2.0mL of sodium nitrite standard solution into a 5mL EP tube, then add 100μL of p-aminobenzenesulfonic acid solution, mix well, let stand for 3-5min, then add 50μL of naphthaleneethylenediamine solution, accurately add distilled water to 2.5mL, mix well and let stand for 15min, finally use an enzyme marker to measure the absorbance at a wavelength of 538nm, and draw a standard curve with the mass of sodium nitrite as the horizontal axis and the absorbance value as the vertical axis. Take 5mL of Sichuan pickle liquid and centrifuge (8000rpm, 5min) to remove impurities such as bacteria, then pipette 2mL of supernatant into a 5mL EP tube, and the remaining steps are the same as the operation method formulated by the standard curve. After measuring the absorbance, calculate the nitrite content using the standard curve. At the same time, a blank test is carried out in parallel. See the test results. Figure 7 .
[0070] like Figure 7 As shown, during the fermentation process, the nitrite content of the two groups reached a peak on the 3rd or 4th day of fermentation, which was around 6.00 mg / kg and 12.50 mg / kg respectively, and the nitrite content was close to 0 on the 7th day of fermentation. It is particularly noteworthy that compared with the C group, the nitrite peak of the ST group decreased faster and the peak value was lower than that of the C group at any time.
[0071] (2) The preparation method of lactic acid standard was based on GB 5009.157-2016. The lactic acid determination method was used to determine the standard curve. The lactic acid determination method was based on the method of Cai Ting et al. and some modifications were made. The final experimental process was as follows:
[0072] Sample treatment: 2 mL of Sichuan pickle liquid was centrifuged (8000 rpm, 5 min), and then 1 mL of supernatant was filtered (0.22 μm); a reverse phase column (Athena, C18-WP, 100A, 250 mm x 4.6 mm, 5 μm) was used for determination, and the mobile phases were potassium dihydrogen phosphate (0.01 mol / L) and methanol (potassium dihydrogen phosphate (0.01 mol / L): methanol = 98:2), flow rate 1.0 mL / min, UV detector wavelength 210 nm, injection volume 10 μL and column temperature 30 °C. Finally, lactic acid was characterized and quantified by comparing the retention time and peak area with those of the standard. The test results are shown in Figure 8 .
[0073] like Figure 8 As shown in Figure 2, as the fermentation progressed, the lactic acid content of both groups increased significantly. It is worth noting that on the 7th and 14th days of fermentation, the lactic acid content of the ST group was significantly higher than that of the C group.
[0074] 3. Microbial diversity determination
[0075] 1. Sequencing sample acquisition and sequencing process
[0076] On the 0th, 7th and 14th days of Sichuan pickle fermentation, 2 groups and 3 parallels, a total of 6 jars of Sichuan pickle were sampled. When sampling, pickle liquid was drawn from the upper, middle and lower parts of the pickle jar and mixed, and 50 mL was taken from each jar. After sampling, the samples were temporarily stored at -80℃, and then all samples were sent to Shanghai Lingen Biotechnology Co., Ltd. for microbial diversity sequencing. Extraction of microbial genomic DNA from kimchi liquid: Genomic DNA was extracted from microorganisms in kimchi liquid using a kit, and then the extracted genomic DNA was detected by 1% agarose gel electrophoresis; PCR amplification and product purification, quantification, and homogenization: PCR amplification was performed on the V3-V4 variable region of the 16S rRNA gene. The upstream primer used in the amplification was 338F (5′-ACTCCTACGGGAGGCAGCAG-3′) and the downstream primer was 806R (5′-GGACTACHVGGGTWTCTAAT-3′). After the amplification was completed, the product was purified using 2% agarose gel and a gel recovery kit. The PCR product was then quantitatively detected using a blue fluorescence quantitative system. Finally, the corresponding proportions were mixed according to the sequencing amount requirements of each sample; Illumina PE250 sequencing library construction: The main steps included connecting a "Y"-shaped adapter, using magnetic beads to screen and remove the adapter self-ligated fragments, using PCR amplification to enrich the library template, and sodium hydroxide denaturation to produce single-stranded DNA fragments; Finally, Illumina PE250 high-throughput sequencing.
[0077] 2. Sequencing data processing and bioinformatics analysis
[0078] The flowchart of sequencing data processing and bioinformatics analysis is shown in the figure. Fig. 9 , the PE250 sequencing sequence processing process is as follows: ① Get the valid sequence of all samples according to the label; ② Perform quality control filtering on the quality of reads; ③ According to the overlapping relationship between PEreads, splice the paired reads into a sequence; ④ Split the high-quality sequence of each sample according to the label and primer sequence. In this process, the sequence direction is corrected and the chimera is removed according to the positive and negative labels and primer directions. Subsequent bioinformatics analysis is performed using software such as Usearch and uclust algorithm, and statistics and drawing are performed in the Lingen Biotech Microbial Diversity Sequencing Project Delivery System.
[0079] 3. Alpha Diversity Index
[0080] The Alpha diversity index of Sichuan pickled cabbage on the 0th, 7th and 14th days of fermentation is as follows Fig.10As shown, the Chao1 index reflects community richness (Figure A), that is, the larger the Chao1 index, the higher the community richness; the Shannon index reflects community diversity, that is, the larger the Shannon index, the better the community diversity (Figure B). On the 0th day of fermentation, the community richness of group C was slightly higher than that of group ST, and the community diversity of group ST was slightly higher than that of group C, but there was no significant difference between the two groups in both; on the 7th day of fermentation, the community richness and community diversity of group C were higher than those of group ST, and there was a significant difference between the two groups in community richness, but no significant difference in community diversity; on the 14th day of fermentation, there was no significant difference in community richness and community diversity between group ST and group C.
[0081] It can be seen that after inoculation with phages from different hosts, there was no significant difference in community richness and diversity of Sichuan pickles on day 0 of fermentation, but there were significant differences in community richness and diversity of Sichuan pickles on day 7 of fermentation, and there was no significant difference in community richness and diversity of Sichuan pickles on day 14 of fermentation. It is speculated that as the fermentation of Sichuan pickles progressed, the inoculated phages gradually died in large numbers, and their impact on the bacterial community gradually decreased, which led to the failure of significant differences in community richness and diversity among the groups on day 14 of fermentation.
[0082] 4. Analysis of bacterial community composition
[0083] The sequencing results of the bacteria on the 0th, 7th and 14th days of Sichuan pickle fermentation were annotated, and finally 258, 101 and 70 bacterial genera were annotated from the sequencing samples of these three days, respectively. The top ten bacterial genera in relative abundance were selected from the C group and ST group on these three days to draw a stacked column chart of bacterial community composition ( Fig.11 ).
[0084] like Fig.11As shown in the figure, on the 0th day of fermentation, the bacterial community composition of group C and group ST was similar, and the top three dominant genera in relative abundance in the two groups were the same, namely Vibrionimonas, Variovorax and Bradyrhizobium, but their relative abundance in the two groups was different; on the 7th day of fermentation, compared with the 0th day of fermentation, the dominant genera in both group C and group ST changed, and the top three dominant genera in relative abundance in the two groups were not exactly the same: the first dominant genus in group C was Erwinia, while the first dominant genus in group ST was Lactiplantibacillus; on the 14th day of fermentation, the first dominant genus in both group C and group ST was Lactiplantibacillus and its relative abundance in both groups exceeded 51%, but the top three dominant genera in relative abundance in the two groups were not exactly the same. In detail, compared with the 7th day of fermentation, the relative abundance of Lactobacillus in group C increased significantly on the 14th day of fermentation, becoming the first dominant genus; the relative abundance of Lactobacillus in group ST also increased significantly, further strengthening its position as the first dominant genus. That is, inoculation of bacteriophage ΦSx-2 in Sichuan kimchi significantly increased the relative abundance of lactic acid bacteria in the dominant genus of Sichuan kimchi, which was beneficial to the fermentation process.
[0085] 5. Characteristic microbial analysis
[0086] The microbial communities of Sichuan kimchi fermentation on days 0, 7, and 14 were analyzed by Lefse (LDAEffect Size), and characteristic microorganisms with significant differences in abundance between Sichuan kimchi inoculated with phage ΦSx-2 and group C were found. The results are shown in Fig.12 .
[0087] like Fig.12 As shown, on the 0th day of fermentation, the characteristic microorganisms in group C included Micrococcus, and the characteristic microorganisms in group ST included Mycobacterium, Corynebacterium, Pollangium, Bacteroides, and Chitinophaga; on the 7th day of fermentation, the characteristic microorganisms in group C included Enterobacter, Erwinia, and Yersinia, and the characteristic microorganisms in group ST included Exiguobacterium; on the 14th day of fermentation, group C had only one characteristic microorganism, Streptococcus, and the characteristic microorganisms in group ST included Enterococcus, Lactobacillus, and Bacillus.
[0088] It can be seen that the bacterial community structure after inoculation of phage ΦSx-2 in Sichuan kimchi is somewhat different from that of Sichuan kimchi fermented normally, but the dominant bacterial community remains consistent. In addition, on the 7th day of fermentation, the characteristic microorganisms in group C are Enterobacter, Erwinia, and Yersinia, among which Erwinia (Erwinia) and Yersinia (Yersinia) can cause the kimchi to spoil. In contrast, the characteristic microorganisms of the ST group inoculated with phage ΦSx-2 do not contain the above microorganisms. It can be seen that inoculation with phage ΦSx-2 infected with Staphylococcus is beneficial to control the growth of spoilage bacteria in Sichuan kimchi.
[0089] Finally, it should be noted that the above specific implementation methods are only used to illustrate the technical solution of the present invention rather than to limit it. Although the present invention has been described in detail with reference to examples, those skilled in the art should understand that the technical solution of the present invention can be modified or replaced by equivalents without departing from the spirit and scope of the technical solution of the present invention, which should be included in the scope of the claims of the present invention.
Claims
1. A Staphylococcus xylosus phage ΦSx-2, characterized in that: It was deposited on August 12, 2024 at the General Microbiology Center of China Culture Collection, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, with the deposit number: CGMCC No.46100.
2. A bacteriophage suspension, characterized in that: Comprising the bacteriophage ΦSx-2 described in claim 1.
3. Use of the Staphylococcus xylosus phage ΦSx-2 according to claim 1 or the phage suspension according to claim 2 in the preparation of fermented vegetables.
4. A bacteriophage preparation for improving the quality of fermented vegetables, characterized in that: The phage preparation uses the Staphylococcus xylosus phage ΦSx-2 according to claim 1 or the phage suspension according to claim 2 as an active ingredient.
5. Use of the Staphylococcus xylosus phage ΦSx-2 according to claim 1 or the phage suspension according to claim 2 in any of the following directions of vegetable fermentation: A1) Increase lactic acid content; A2) Reduce nitrite content.
6. Use of the Staphylococcus xylosus phage ΦSx-2 according to claim 1 or the phage suspension according to claim 2 in the preparation of a preparation for inhibiting the activity of spoilage bacteria that cause spoilage of fermented vegetables.
7. The use according to claim 6, characterized in that The spoilage bacteria are Erwinia or Yersinia.
8. A preparation for inhibiting the activity of spoilage bacteria, characterized in that: The preparation uses the Staphylococcus xylosus phage ΦSx-2 described in claim 1 or the phage suspension described in claim 2 as an active ingredient.
9. The preparation according to claim 8, characterized in that The spoilage bacteria are Erwinia or Yersinia.