Genes regulating multi-stress resistance in wheat and their applications

Abstract

The present application belongs to the field of plant breeding, and particularly relates to a gene for regulating multi-stress resistance of wheat and application thereof. It is found that the TraesCS2B02G460000 gene has the function of regulating multi-stress resistance of wheat. Manipulating the gene can improve the multi-stress resistance of wheat.

Description

TECHNICAL FIELD

[0001] The application belongs to the field of plant breeding, and particularly relates to a gene for regulating multi-stress resistance of wheat and application thereof. BACKGROUND

[0002] Drought, salinity, high temperature and other stress are the main environmental factors affecting plant growth and development, and seriously affect the yield of crops. Cultivating excellent stress-tolerant crops is an effective method to solve the problem. Wheat is the main food crop in China and the second largest food crop in the world. Improving the abiotic stress tolerance of wheat plays an important role in improving the yield of wheat in China and the world.

[0003] Many genes in wheat itself are related to stress tolerance, such as TaLEA (Yu Jianing. Cloning, analysis and function of wheat drought and salt tolerance related genes [D]. Northwest Agriculture and Forestry University, 2003), TaWHY2-6A (CN118910132A), TaERF16-B (CN118834991A), TaSnRK1 (CN118812685A) and the like. More genes related to stress tolerance need to be identified to achieve the purpose of improving the stress tolerance of wheat. SUMMARY

[0004] The purpose of the application is to provide a gene for regulating multi-stress resistance of wheat and application thereof.

[0005] To achieve the above purpose, the application adopts the following technical solutions.

[0006] The application provides application of a gene in regulating multi-stress resistance of wheat, characterized in that the gene comprises any one of the following:

[0007] (1) a gene with the sequence shown in SEQ ID NO. 1 or SEQ ID NO. 2;

[0008] (2) a gene encoding the sequence shown in SEQ ID NO. 3;

[0009] (3) a gene numbered as TraesCS2B02G460000 in a wheat gene database;

[0010] Among the above, the multi-stress includes any one or a combination of salt, alkali, drought and high temperature.

[0011] The application also provides application of a biological material in regulating multi-stress resistance of wheat, characterized in that the biological material comprises any one of the following:

[0012] (1) an expression cassette containing the above gene;

[0013] (2) an expression vector containing the gene;

[0014] (3) a host cell containing the gene, wherein the host cell is a bacterial cell or a non-regenerable plant cell.

[0015] The present application also provides a method for improving the multi-stress resistance of wheat, characterized in that the method comprises the following steps:

[0016] (1) increasing the expression of the gene in the wheat material to be improved;

[0017] (2) selecting a wheat plant with improved multi-stress resistance.

[0018] The multi-stress includes any one or a combination of salt, alkali, drought and high temperature.

[0019] In some embodiments, the method for increasing the expression of the gene is to use a high-activity promoter to drive the expression of the gene in claim 1.

[0020] In some embodiments, the high-activity promoter is SEQ ID NO. 4.

[0021] The present application also provides the use of the above method in improving the multi-stress resistance of wheat.

[0022] The present application has the following advantages and beneficial effects: the present application finds that the TraesCS2B02G460000 gene has the function of regulating the multi-stress resistance of wheat. Manipulating the gene can improve the multi-stress resistance of wheat. BRIEF DESCRIPTION OF DRAWINGS

[0023] Figure 1 Transcriptional level expression detection results of transgenic plants. Expression detection of two lines P5-4 and P5-14. The expression amount is expressed as the fold of the relative expression amount of the internal reference gene.

[0024] Figure 2 Phenotypes of super-expression plants and receptor controls after salt-alkali stress treatment. A: phenotype photos, taken after 12 days of salt-alkali stress treatment. The left three plants in each photo are super-expression materials, and the right three plants are receptor control materials. B: statistical data of the proportion of yellow leaves of each material after 12 days of treatment. “**” indicates a very significant difference.

[0025] Figure 3Phenotype of overexpression plants and receptor control after drought and heat stress treatment. A: Phenotype photos, taken after 12 days of drought and heat stress treatment and 7 days of rehydration. The left three plants in the photo are the receptor control material Fielder, the middle three plants are the overexpression material P5-4, and the right three plants are the overexpression material P5-14. B: Statistical data of the leaf curling degree of each material after 7 days of rehydration. "**" indicates a very significant difference. DETAILED DESCRIPTION

[0026] The following definitions and methods are provided to better define the present application and to guide working practitioners in the art. Unless otherwise defined, terms are to be understood according to their common use by those of ordinary skill in the relevant art. All patents, publications, scientific articles, and other public publications, etc. cited herein are incorporated by reference in their entirety.

[0027] In this application, the word "comprise", "comprising" or variants thereof are to be interpreted as including elements, numbers or steps described, but not excluding other elements, numbers or steps.

[0028] Unless otherwise indicated, nucleic acids are written left to right in 5' to 3' orientation; amino acid sequences are written left to right in amino to carboxyl orientation, as customary. Amino acids can be referred to herein by either the common three letter code or by the one-letter code. Similarly, nucleotides can be referred to herein by either the common three letter code or by the one-letter code. Numeric ranges are inclusive of the numbers defining the range. As used herein, "nucleic acid" includes polynucleotides of either deoxyribonucleotides or ribonucleotides, in either single- or double-stranded form, and unless otherwise indicated, includes known analogues of natural nucleotides that have similar binding properties as the reference nucleic acid and are hybridizable with nucleic acids in a manner similar to naturally occurring nucleotides. As used herein, the term "encoding" or "encoded" with respect to a specified nucleic acid sequence is intended to mean that the nucleotide sequence includes a gene sequence that, upon translation, gives rise to the specified protein. The genetic code specifies the sequences of nucleotides that, when translated in a process involving mRNA and ribosomes, result in the specified protein. As used herein, "full-length sequence" with respect to a specified polynucleotide or its encoded protein refers to the entire nucleic acid sequence or the entire amino acid sequence having the natural (non-synthetic) endogenous sequence. A full-length polynucleotide encodes a full-length, catalytically active form of the specified protein. The terms "polypeptide," "polypeptide," and "protein" are used interchangeably herein to refer to a polymer of amino acid residues. The term is used to refer to amino acid polymers in which one or more amino acid residues are artificial chemical mimics of the corresponding naturally occurring amino acid. The term is also used to refer to naturally occurring amino acid polymers. The terms "residue" or "amino acid residue" or "amino acid" are used interchangeably herein to refer to an amino acid that is incorporated into a protein, polypeptide, or peptide (collectively "protein"). The amino acid can be a naturally occurring amino acid, and unless otherwise indicated, can include known analogues of natural amino acids that can function in a similar manner as the naturally occurring amino acid.

[0029] In some embodiments, the nucleotide sequences of the application can be altered to make conservative amino acid substitutions. Principles and examples of conservative amino acid substitutions are further described below. In certain embodiments, the nucleotide sequences of the application can be altered without changing the amino acid sequence, e.g., codons preferred by monocots can be substituted for codons encoding the same amino acid sequence without changing the amino acid sequence encoded by the nucleotide sequence. In some embodiments, portions of the nucleotide sequences in the application are replaced with different codons that encode the same amino acid sequence, thereby altering the nucleotide sequence while not changing the amino acid sequence it encodes. Conservative variants include those sequences that encode the same amino acid sequence of a protein of the embodiments due to the degeneracy of the genetic code. In some embodiments, portions of the nucleotide sequences in the application are replaced according to monocot-preferred codons. Those of skill in the art will recognize that amino acid additions and / or substitutions generally are based on the relative similarity of the amino acid side chains, for example, as is shown by the hydrophilicity, charge, size, and the like. Exemplary amino acid substitution groups that take various of the foregoing considerations into account are well-known in the art and include: arginine and lysine; glutamate and aspartate; serine and threonine; glutamine and asparagine; and valine, leucine, and isoleucine. Guidance in appropriate amino acid substitutions that do not affect the biological activity of the protein of interest can be found in the model of Dayhoff et al. (1978) Atlas of Protein Sequence and Structure (Natl. Biomed. Res. Found., Washington, D.C.), incorporated herein by reference. Conservative substitutions can be made, such as replacing one amino acid with another amino acid of similar properties. Identification of sequence identity includes hybridization techniques. For example, all or a portion of a known nucleotide sequence is used as a hybridization probe to selectably hybridize to other corresponding nucleotide sequences present in a population of cloned genomic DNA fragments or cDNA fragments from a selected organism (i.e., a genomic or cDNA library). The hybridization probe can be a genomic DNA fragment, a cDNA fragment, an RNA fragment, or other oligonucleotide, and can be labeled with a detectable group, such as32P, or other detectable marker. Thus, for example, a hybridization probe can be prepared by labeling a synthetic oligonucleotide based on an embodiment sequence. Methods for preparing hybridization probes and constructing cDNA and genomic libraries are generally known in the art. The hybridization of the sequences can be performed under stringent conditions. As used herein, the term "stringent conditions" or "stringent hybridization conditions" means conditions under which a probe will hybridize to its target sequence to a detectably greater degree than to other sequences (e.g., at least 2-fold, 5-fold, or 10-fold background).Stringency conditions are sequence dependent, and are different under different circumstances. By controlling hybridization stringency and / or controlling wash conditions, one can identify target sequences that are 100% complementary to the probe (homologous probe method). Alternatively, one can adjust stringency conditions to allow some sequence mismatch, in order to detect lower degrees of similarity (heterologous probe method). Typically, the probe is less than about 1000 or 500 nucleotides in length. Typically, stringency conditions are conditions under which the salt concentration is less than about 1.5 M Na ion, typically about 0.01 to 1.0 M Na ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is that at which DNA is normally melted (about 50°C for a 1 kb DNA fragment; about 60°C for a 0.1 kb DNA fragment; and about 65°C for a 0.05 kb DNA fragment). Stringent conditions can also be achieved with the addition of destabilizing agents such as formamide. Exemplary low stringency conditions include hybridization in 30 to 35% formamide, 1 M NaCl, 1% SDS at 37°C, with a wash in 0.1 x to 0.2 x SSC at 37°C. Exemplary moderate stringency conditions include hybridization in 40 to 45% formamide, 1 M NaCl, 1% SDS at 37°C, with a wash in 0.1 x to 0.2 x SSC at 55°C. Exemplary high stringency conditions include hybridization in 50% formamide, 1 M NaCl, 1% SDS at 37°C, with a wash in 0.1 x to 0.2 x SSC at 60 to 65°C. Optionally, the wash buffer can include about 0.1% to about 1% SDS. The duration of hybridization is typically less than about 24 hours, often about 4 to about 12 hours. Specificity is typically dependent on the length of the probe and the degree of mismatching, with longer probes and less mismatching being more specific. The degree of mismatching can be controlled by the length of the probe and the temperature of hybridization. The Tm (temperature of melting) of a DNA-DNA hybrid can be approximated from the equation of Meinkoth and Wahl (1984) Anal. Biochem. 138:267-284: Tm = 81.5°C + 16.6(log M) + 0.41(%GC) - 0.61(%formamide) - 500 / L; where M is the molarity of monovalent cations, %GC is the percentage of guanosine and cytosine nucleotides in the DNA, "%formamide" is the percentage of formamide in the hybridization solution, and L is the length of the hybrid in base pairs. Tm is the temperature at which 50% of the complementary target sequence will hybridize with a perfectly matched probe, at the specified ionic strength and pH. Washes are typically carried out at least to the point of equilibrium, and to a low background level of hybridization, such as for 2 hours, 1 hour, or 30 minutes. Each 1% of mismatch corresponds to a decrease in Tm of about 1°C; thus, one can adjust the Tm, hybridization, and / or wash conditions to hybridize with sequences of the desired degree of identity. For example, if sequences of >90% identity are desired, one can decrease the Tm by 10°C.Generally, stringency conditions are chosen to be about 5°C lower than the Tm of specific sequence and its complement for the specified ionic strength and pH. However, under very high stringency conditions, a hybridization and / or a wash at a compound of the specified Tm for the specified ionic strength and pH can be performed. Under moderately high stringency conditions, a hybridization and / or a wash at 3°C lower than the specified Tm for the specified ionic strength and pH can be performed. Under low stringency conditions, a hybridization and / or a wash at 10°C lower than the specified Tm for the specified ionic strength and pH can be performed.

[0030] Unless otherwise indicated, all numbers expressing quantities of ingredients, reaction conditions, and so forth used in the specification and claims are to be understood as being modified in all instances by the term "about." As used herein, the term "about," when used to modify a measurable quantity used in the application, such as an amount, a time, temperature, and the like, means that the quantity is within 20% of the specified amount, in some embodiments within 10% of the specified amount, in some embodiments within 5% of the specified amount, in some embodiments within 1% of the specified amount, in some embodiments within 0.5% of the specified amount, and in some embodiments within 0.1% of the specified amount, as such variations are appropriate to perform the disclosed methods and / or use the disclosed compositions, nucleic acids, polypeptides, and the like. Therefore, unless otherwise indicated, the numerical parameters listed in the specification and claims are approximations. Variations to the numerical parameters are meant to be within the skills of persons of ordinary skill in the art, and the numerical parameters are practiced with more or less and / or differing age-related amounts.

[0031] The following examples are intended to illustrate the application and are not intended to limit the scope of the application. Modifications or substitutions of the methods, steps or conditions of the application are considered to be within the scope of the application. Unless otherwise specified, the examples are performed according to conventional experimental conditions, such as described in Sambrook et al. Molecular Cloning: A Laboratory Manual (2001), or according to the conditions suggested by the manufacturer. Unless otherwise specified, the chemical reagents used in the examples are conventional commercially available reagents, and the technical means used in the examples are conventional means known to the person skilled in the art.

[0032] Example

[0033] Example 1 Whole genome association analysis of wheat metabolome

[0034] The inventors aim to locate genes affecting wheat flavonoid metabolism by using metabolome and genome-wide association analysis. The specific process is as follows: first, metabolome analysis is performed on 391 wheat natural populations, combined with whole genome resequencing data to perform metabolome and whole genome-wide association analysis, and 11410 significantly associated SNP sites are obtained, from which 63 candidate genes are screened. Among them, the TraesCS2B01G460000 gene encodes a flavonoid methoxyltransferase, and a SNP-17430954 in the promoter region of the gene is significantly associated with the content of metabolite 3', 4', 5'-O-trimethyltricetin (P value <4.97E-9). There is no other gene encoding flavonoid methoxyltransferase near the gene. The gene number in the database is TraesCS2B01G460000, the genomic sequence is shown as SEQ ID NO. 1, and the encoded protein sequence is shown as SEQ ID NO. 3.

[0035] Example 2 Gene function verification

[0036] In order to further identify the specific function of the gene, the inventors cloned the coding region (CDS) of the TraesCS2B01G460000 gene, the sequence is shown as SEQ ID NO. 2, and constructed an overexpression vector. The CDS is cloned into the pDONR207 vector, and then transferred to the vector pUbiGW using the Gateway technology to obtain the overexpression transformation vector. The promoter and terminator used in the overexpression vector are the commonly used corn ubiquitin promoter (SEQ ID NO. 4) and nos terminator (SEQ ID NO. 5) in the art. The vector plasmid is transformed into Agrobacterium EHA105, and the Agrobacterium-mediated immature embryo wheat genetic transformation system is used to transform the wheat variety Fielder. Finally, the transformed strain is obtained, and T1 generation is screened for positive detection to obtain 4 positive transformed strains. The leaf of two strains P5-4 and P5-14 is taken to extract RNA, and cDNA is obtained after reverse transcription, and the expression amount of the TraesCS2B01G460000 gene is detected by qRT-PCR method, and it is found that the expression amount of the gene in the two strains P5-4 and P5-14 is significantly higher than that of the receptor control. Figure 1 ). Among them, the qRT-PCR detection primers are: GTTATCCACCCTTGCCCTCC; GCAGGAACATCAACAGCCAC. The internal reference primers are: TaActin-F, ACCCAGATCATGTTCGAGACC; TaActin-R, TTCGACCGCTGGCATACAAA.

[0037] Further identification of the phenotypic traits of P5-4 and P5-14 materials found that overexpression of the gene can not only significantly increase the content of wheat flavonoid metabolites, but also significantly improve the stress resistance. The specific stress and resistance identification method is as follows, wherein the salt and alkali stress treatment method is as follows: a small square pot with a size of 8cmx8cm is used for soil loading, 100g of soil (including pot weight) is loaded in each square pot, and after ensuring that the soil is fully watered, it is sown. 5 experimental materials are sown in each square pot, and 3 repeats are set for each material, totaling 15 experimental materials. When the wheat grows to the "two-leaf core" stage (about 12-13 days, growth conditions are 20-23°C, 12h / 12h day and night). A 400mmol / L salt and alkali aqueous solution (the ratio of NaCl:NaHCO3:Na2CO3 is 11:4.5:0.5, and the pH value is finally 9) is slowly irrigated at the root of the plant. 150mL of salt and alkali water is irrigated on the first day, and the excess water is poured out. 50mL of salt and alkali water is irrigated again on the 4th day. After 12 days of treatment, the number of yellow and green leaves of each strain is counted, the yellow leaf ratio is calculated, and a photo record is taken to evaluate the effect of salt and alkali stress on wheat growth.

[0038] The drought and heat stress treatment method is as follows: a small square pot with a size of 8cmx8cm is used for soil loading, 100g of soil (including pot weight) is loaded in each square pot, and after ensuring that the soil is fully watered, it is sown. 5 experimental materials are sown in each square pot, and 3 repeats are set for each material, totaling 15 experimental materials. On the day before the wheat grows to the "two-leaf core" stage (about 12-13 days, growth conditions are 20-23°C, 12h / 12h day and night), water irrigation treatment is carried out to ensure that the weights of the small pots are basically consistent. After multiple accurate measurements, the total weight of the small pots before treatment should be controlled within the range of 250g±4g. Then, the water in the white plate is poured out, and the treatment begins. The environmental temperature is adjusted to a high temperature range of 33-36°C, and no water is irrigated while simulating a drought and high temperature stress environment. After 12 days of treatment, a 7-day rehydration treatment is carried out for photo recording, and the leaf curling degree of each material is counted.

[0039] After 12 days of salt and alkali stress treatment, the number of yellow and green leaves of the transgenic plants is counted, and the yellow leaf ratio is calculated to measure the resistance of the wheat material to salt and alkali stress. The results show that the yellow leaf and green leaf ratio of the overexpression plants is significantly lower than that of the control material Fielder (see Figure 2 ), indicating that overexpression of the TraesCS2B02G460000 gene can significantly improve the salt and alkali tolerance of wheat. Figure 3 After 12 days of drought and heat stress treatment and 7 days of rehydration, the leaf curling rate of the overexpression material is significantly lower than that of the control material Fielder (see

[0040] The above results show that after overexpression of the TraesCS2B02G460000 gene, the resistance of wheat to salt, alkali, drought and heat (high temperature) stress is significantly improved, and therefore increasing the expression of the TraesCS2B02G460000 gene can achieve the technical effect of improving the multi-stress resistance of wheat to salt, alkali, drought and heat. Although the present application has been described in detail in the foregoing general description and specific embodiments, modifications or improvements can be made to it on the basis of the present application, which will be apparent to those skilled in the art. Therefore, these modifications or improvements made on the basis of not deviating from the spirit of the present application, all belong to the scope of protection claimed by the present application.

Claims

1. An application of gene overexpression in improving wheat resistance to multiple stresses, characterized in that: The gene includes any one of the following: (1) The gene with the sequence shown in SEQ ID NO.1; (2) a gene encoding the sequence shown in SEQ ID NO. 3; (3) the gene numbered TraesCS2B02G460000 in the wheat gene database; Wherein, the multiple adversities are any one of salt, alkali, drought, and high temperature or a combination thereof.

2. Application of a biomaterial in improving wheat's resistance to multiple adversities, characterized in that: The biological material includes any one of the following: (1) An expression cassette containing the gene according to claim 1; (2) an expression vector containing the gene according to claim 1; (3) A host cell containing the gene of claim 1, wherein the host cell is a bacterial cell; Wherein, the multiple adversities are any one of salt, alkali, drought, and high temperature or a combination thereof.

3. A method for improving wheat resistance to multiple adversities, characterized in that: The method comprises the following steps: (1) increasing the expression of the gene of claim 1 in the wheat material to be improved; (2) selecting wheat plants with improved resistance to multiple stresses; Wherein, the multiple adversities are any one of salt, alkali, drought, and high temperature or a combination thereof.

4. The method according to claim 3, characterized in that The method for increasing gene expression is to use a high-activity promoter to drive the expression of the gene according to claim 1.

5. The method according to claim 4, characterized in that The high-activity promoter is shown in SEQ ID NO.

4.

6. Use of the method according to any one of claims 3 to 5 in improving the resistance of wheat to multiple stresses; in, The multiple adversities are any one of salt, alkali, drought, and high temperature, or a combination thereof.

Images