Genes for multiple stress tolerance in wheat and their use

By overexpressing the TraesCS1B02G022400 gene in wheat, the problem of limited wheat yield under adverse conditions was solved, and significant improvement in resistance to adversities such as salt, alkali, drought, and heat was achieved, thereby enhancing the growth adaptability of wheat.

CN119592610BActive Publication Date: 2025-10-17HUAZHONG AGRI UNIV
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
CN202411795601.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-12-09
Publication Date
2025-10-17
Estimated Expiration
2044-12-09

AI Technical Summary

Technical Problem

In the existing technology, many genes related to wheat stress tolerance have not been fully identified, resulting in limited wheat yield under adverse stresses such as drought, salinity, and high temperature.

Method used

The TraesCS1B02G022400 gene and its encoded protein are used to drive their overexpression in wheat through a high-activity promoter, thereby improving wheat's resistance to adverse conditions such as salt, alkali, drought, and high temperature.

Benefits of technology

Significantly improve wheat's resistance to multiple adversities, enhance its growth performance under saline-alkali, drought and heat stress, and improve the overall yield and adaptability of wheat.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119592610B_ABST
    Figure CN119592610B_ABST
Patent Text Reader

Abstract

The application belongs to the field of plant breeding, and particularly relates to a wheat multi-stress resistance gene and application thereof. A wheat multi-stress resistance gene is obtained through big data analysis. Manipulation of the gene can improve the multi-stress resistance of wheat.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the field of plant breeding, and particularly relates to a wheat multi-stress resistance gene and application thereof. BACKGROUND

[0002] Drought, salinity, high temperature and other stress are the main environmental factors affecting plant growth and development, and seriously affect the yield of crops. Cultivating excellent stress-tolerant crops is an effective method to solve the problem. Wheat is the main food crop in China and the second largest food crop in the world. Improving the abiotic stress tolerance of wheat plays an important role in improving the yield of wheat in China and the world.

[0003] Many genes in wheat itself are related to stress resistance, such as TaLEA (Yu Jianing. Cloning, analysis and function of wheat drought and salt tolerance related genes [D]. Northwest Agriculture and Forestry University, 2003), TaWHY2-6A (CN118910132A), TaERF16-B (CN118834991A), TaSnRK1 (CN118812685A) and the like. More stress-related genes need to be identified to achieve the purpose of improving the stress tolerance of wheat. SUMMARY

[0004] The purpose of the present application is to provide a method for improving the stress tolerance of wheat.

[0005] To achieve the above purpose, the present application adopts the following technical solutions:

[0006] The present application provides an application of a gene in regulating the multi-stress resistance of wheat, characterized in that the gene comprises any of the following:

[0007] (1) a gene with the sequence shown in SEQ ID NO. 1 or SEQ ID NO. 2;

[0008] (2) a gene encoding the sequence shown in SEQ ID NO. 3;

[0009] (3) a gene numbered as TraesCS1B02G022400 in the wheat gene database;

[0010] Among them, the multi-stress includes any one or combination of salt, alkali, drought and high temperature.

[0011] The present application also provides an application of a biological material in regulating the multi-stress resistance of wheat, characterized in that the biological material comprises any of the following:

[0012] (1) an expression cassette containing the above-mentioned gene;

[0013] (2) an expression vector containing the above-mentioned gene;

[0014] (3) A host cell containing the gene, wherein the host cell is a bacterial cell or a non-regenerable plant cell.

[0015] The application also provides a method for improving the multi-stress resistance of wheat, characterized in that the method comprises the following steps:

[0016] (1) increasing the expression of the gene in the wheat material to be improved;

[0017] (2) selecting the wheat plant with improved multi-stress resistance.

[0018] The multi-stress includes any one or a combination of salt, alkali, drought and high temperature.

[0019] In some embodiments, the method for increasing the expression of the gene is to use a high-activity promoter to drive the expression of the gene in claim 1.

[0020] In some embodiments, the high-activity promoter is SEQ ID NO. 4.

[0021] The application also provides the use of the above method in improving the multi-stress resistance of wheat.

[0022] The application has the following advantages and beneficial effects: the application obtains a wheat multi-stress resistance gene through transcriptome analysis. Manipulating the gene can improve the multi-stress resistance of wheat. BRIEF DESCRIPTION OF DRAWINGS

[0023] Figure 1 Expression amount of TraesCS1B02G022400 gene in #7AABB and SHW3_AABBDD. The expression amount is expressed by TPM (number of transcripts per million).

[0024] Figure 2 Superexpression vector map. Elements are labeled on the map.

[0025] Figure 3 DNA level positive detection and transcription level expression amount detection results of transgenic plants. A: positive detection results of four positive transformation strains (OE-1 to OE-4). B: expression amount detection of two strains ZR27-369 and ZR27-397.

[0026] Figure 4Phenotypes of overexpression plants and receptor control after salt-alkali stress treatment. A: Phenotype photos, taken after 12 days of salt-alkali stress treatment. The left three plants in each photo are overexpression materials, and the right three plants are receptor control materials. B: Statistics of the proportion of yellow leaves of each material after 12 days of treatment. “**” indicates a highly significant difference. ZR27-OX-369, ZR27-OX-397 are overexpression materials ZR27-369, ZR27-397.

[0027] Figure 5 Phenotypes of overexpression plants and receptor control after drought-heat stress treatment. A: Phenotype photos, taken after 12 days of drought-heat stress treatment and 7 days of rehydration. The left three plants in the photo are receptor control material Fielder, the middle three plants are overexpression material ZR27-369, and the right three plants are overexpression material ZR27-397. ZR27-OX-369, ZR27-OX-397 are overexpression materials ZR27-369, ZR27-397. B: Statistics of the leaf curling degree of each material after 7 days of rehydration. “**” indicates a highly significant difference. DETAILED DESCRIPTION

[0028] The following definitions and methods are provided to better define the present application and to guide working persons in the art to practice the present application. Unless otherwise defined, the terms are understood according to the conventional usage of the terms by those of ordinary skill in the relevant art. All patent documents, academic papers, industry standards and other published publications cited herein are incorporated herein in their entirety as references.

[0029] In the present application, the word “comprise”, “contain” or its variants should be understood as containing other elements, numbers or steps in addition to the described elements, numbers or steps.

[0030] Unless otherwise indicated, nucleic acids are written left to right in 5' to 3' orientation; amino acid sequences are written left to right in amino to carboxyl orientation, as customary. Amino acids can be referred to herein by either the common three letter code or by the one-letter code. Similarly, nucleotides can be referred to herein by either the common three letter code or by the one-letter code. Numeric ranges are inclusive of the numbers defining the range. As used herein, "nucleic acid" includes polynucleotides of either deoxyribonucleotides or ribonucleotides, in either single- or double-stranded form, and unless otherwise indicated, includes known analogues of natural nucleotides that have similar binding properties as the reference nucleic acid and are hybridizable with nucleic acids in a manner similar to naturally occurring nucleotides. As used herein, the term "encoding" or "encoded" with respect to a specified nucleic acid sequence is intended to mean that the nucleotide sequence includes a gene sequence that, upon translation, gives rise to the specified protein. The genetic code specifies the sequences of nucleotides that, when translated in a process involving mRNA and ribosomes, result in the specified protein. As used herein, "full-length sequence" with respect to a specified polynucleotide or its encoded protein refers to the entire nucleic acid sequence or the entire amino acid sequence having the natural (non-synthetic) endogenous sequence. A full-length polynucleotide encodes a full-length, catalytically active form of the specified protein. The terms "polypeptide," "polypeptide," and "protein" are used interchangeably herein to refer to a polymer of amino acid residues. The term is used to refer to amino acid polymers in which one or more amino acid residues are artificial chemical mimics of the corresponding naturally occurring amino acid. The term is also used to refer to naturally occurring amino acid polymers. The terms "residue" or "amino acid residue" or "amino acid" are used interchangeably herein to refer to an amino acid that is incorporated into a protein, polypeptide, or peptide (collectively "protein"). The amino acid can be a naturally occurring amino acid, and unless otherwise indicated, can include known analogues of natural amino acids that can function in a similar manner as the naturally occurring amino acid.

[0031] In some embodiments, the nucleotide sequences of the application can be altered to make conservative amino acid substitutions. Principles and examples of conservative amino acid substitutions are further described below. In certain embodiments, the nucleotide sequences of the application can be altered without changing the amino acid sequence, e.g., codons preferred by monocots can be substituted for codons encoding the same amino acid sequence without changing the amino acid sequence encoded by the nucleotide sequence. In some embodiments, portions of the nucleotide sequences in the application are replaced with different codons that encode the same amino acid sequence, thereby altering the nucleotide sequence while not changing the amino acid sequence it encodes. Conservative variants include those sequences that encode the same amino acid sequence of a protein of the embodiments due to the degeneracy of the genetic code. In some embodiments, portions of the nucleotide sequences in the application are replaced according to monocot-preferred codons. Those of skill in the art will recognize that amino acid additions and / or substitutions generally are based on the relative similarity of the amino acid side chains, for example, as is shown by the hydrophilicity, charge, size, and the like. Exemplary amino acid substitution groups that take various of the foregoing considerations into account are well-known in the art and include: arginine and lysine; glutamate and aspartate; serine and threonine; glutamine and asparagine; and valine, leucine, and isoleucine. Guidance in appropriate amino acid substitutions that do not affect the biological activity of the protein of interest can be found in the model of Dayhoff et al. (1978) Atlas of Protein Sequence and Structure (Natl. Biomed. Res. Found., Washington, D.C.), incorporated herein by reference. Conservative substitutions can be made, such as replacing one amino acid with another amino acid of similar properties. Identification of sequence identity includes hybridization techniques. For example, all or a portion of a known nucleotide sequence is used as a hybridization probe to selectably hybridize to other corresponding nucleotide sequences present in a population of cloned genomic DNA fragments or cDNA fragments from a selected organism (i.e., a genomic or cDNA library). The hybridization probe can be a genomic DNA fragment, a cDNA fragment, an RNA fragment, or other oligonucleotide, and can be labeled with a detectable group, such as32P, or other detectable marker. Thus, for example, a hybridization probe can be prepared by labeling a synthetic oligonucleotide based on an embodiment sequence. Methods for preparing hybridization probes and constructing cDNA and genomic libraries are generally known in the art. The hybridization of the sequences can be performed under stringent conditions. As used herein, the term "stringent conditions" or "stringent hybridization conditions" means conditions under which a probe will hybridize to its target sequence to a detectably greater degree than to other sequences (e.g., at least 2-fold, 5-fold, or 10-fold background).Stringency conditions are sequence dependent, and are different under different circumstances. By controlling hybridization stringency and / or controlling wash conditions, one can identify target sequences that are 100% complementary to the probe (homologous probe method). Alternatively, one can adjust stringency conditions to allow some sequence mismatch, in order to detect lower degrees of similarity (heterologous probe method). Typically, the probe is less than about 1000 or 500 nucleotides in length. Typically, stringency conditions are conditions under which the salt concentration is less than about 1.5 M Na ion, typically about 0.01 to 1.0 M Na ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is that at which DNA is normally melted (about 50°C for a 1 kb DNA fragment; about 60°C for a 0.1 kb DNA fragment; and about 65°C for a 0.05 kb DNA fragment). Stringent conditions can also be achieved with the addition of destabilizing agents such as formamide. Exemplary low stringency conditions include hybridization in 30 to 35% formamide, 1 M NaCl, 1% SDS at 37°C, with a wash in 0.1 x to 0.2 x SSC at 37°C. Exemplary moderate stringency conditions include hybridization in 40 to 45% formamide, 1 M NaCl, 1% SDS at 37°C, with a wash in 0.1 x to 0.2 x SSC at 55°C. Exemplary high stringency conditions include hybridization in 50% formamide, 1 M NaCl, 1% SDS at 37°C, with a wash in 0.1 x to 0.2 x SSC at 60 to 65°C. Optionally, the wash buffer can include about 0.1% to about 1% SDS. The duration of hybridization is typically less than about 24 hours, often about 4 to about 12 hours. Specificity is typically dependent on the length of the probe and the degree of mismatching, with longer probes and less mismatching being more specific. The degree of mismatching can be controlled by the length of the probe and the temperature of hybridization. The Tm (temperature of melting) of a DNA-DNA hybrid can be approximated from the equation of Meinkoth and Wahl (1984) Anal. Biochem. 138:267-284: Tm = 81.5°C + 16.6(log M) + 0.41(%GC) - 0.61(%formamide) - 500 / L; where M is the molarity of monovalent cations, %GC is the percentage of guanosine and cytosine nucleotides in the DNA, "%formamide" is the percentage of formamide in the hybridization solution, and L is the length of the hybrid in base pairs. Tm is the temperature at which 50% of the complementary target sequence will hybridize with a perfectly matched probe, at the specified ionic strength and pH. Washes are typically carried out at least to the point of equilibrium, and to a low background level of hybridization, such as for 2 hours, 1 hour, or 30 minutes. Each 1% of mismatch corresponds to a decrease in Tm of about 1°C; thus, one can adjust the Tm, hybridization, and / or wash conditions to hybridize with sequences of the desired degree of identity. For example, if sequences of >90% identity are desired, one can decrease the Tm by 10°C.Generally, stringency conditions are chosen to be about 5°C lower than the Tm of specific sequence and its complement for the specified ionic strength and pH. However, under very high stringency conditions, a hybridization and / or wash at a compound of the specified Tm for the specified ionic strength and pH can be used; under moderately high stringency conditions, a hybridization and / or wash at 11°C lower than the specified Tm for the specified ionic strength and pH can be used; under low stringency conditions, a hybridization and / or wash at 11°C lower than the specified Tm for the specified ionic strength and pH can be used.

[0032] Unless otherwise indicated, all numbers expressing quantities of ingredients, reaction conditions, and so forth used in the specification and claims are to be understood as being modified in all instances by the term "about." As used herein, the term "about," when used in reference to a measurable value such as an amount of mass, weight, time, volume, concentration, or percentage, is meant to encompass variations that can occur due to reasonable expected deviations in measurement, such as variations that would occur in making such a measurement through the use of different testing equipment, or variations that occur due to differences in the manufacture and properties of the composition, nucleic acid, polypeptide, etc. being used, as such variations are known to occur in the art. Therefore, unless otherwise indicated, the numerical parameters listed in the specification and claims are approximations. Variations can occur when the specified parameters are

[0033] The following examples are intended to illustrate the present application and are not intended to limit the scope of the present application. Modifications or substitutions of the methods, steps or conditions of the present application, which are apparent to those skilled in the art, are intended to fall within the scope of the present application. Unless otherwise specified, the examples were performed according to conventional experimental conditions, such as those described in Sambrook et al. (Molecular Cloning: A Laboratory Manual, 2001) or according to the conditions suggested by the manufacturer. Unless otherwise specified, the chemical reagents used in the examples were conventional commercial reagents and the technical means used in the examples were conventional means known to those skilled in the art.

[0034] Example

[0035] Example 1 Discovery of a stress tolerance gene in wheat

[0036] Common wheat is an important food crop, which is a typical allopolyploid species with A, B and D genomes. The formation of common wheat experienced two allopolyploidization processes: the first polyploidization occurred about 500,000 years ago, which was formed by two diploids Triticum urartu (AA) and Aegilops speltoides (SS) to form an early tetraploid (AABB); the second polyploidization occurred about 8,000 years ago, which was formed by natural hybridization between the tetraploid (T. turgidum, AABB) in domesticated state and Aegilops tauschii (DD) as the male parent, and then chromosome doubling to form; and through later natural selection and artificial domestication to become the present common wheat. Wheat is an important genetic model for studying polyploid evolution and crop domestication. However, the extent and influence of this change in the evolution of wheat, especially from tetraploid to hexaploid wheat, is not clear. The addition of the D genome greatly improves the adaptability and quality of wheat.

[0037] In order to study the influence of the addition of the D genome on the whole genome of wheat in the evolution from tetraploid to hexaploid wheat, the inventors first obtained tetraploid wheat #7AABB and diploid wheat #10DD, and crossed the two materials to screen a stable hexaploid synthetic wheat single plant SHW3 (AABBDD) in F2 generation. The three materials were grown to the seedling stage (three-leaf stage) under normal light conditions, and the leaves were taken to extract RNA for transcriptome analysis. The gene expression levels between hexaploid SHW3 (AABBDD) and tetraploid wheat #7AABB were compared. The results showed that compared with tetraploid wheat #7AABB, 2673 up-regulated genes and 2076 down-regulated genes were identified in hexaploid SHW3 (AABBDD), and the expression levels of 504 genes increased more than 8-fold and from no expression to expression. Since hexaploid wheat has wider environmental adaptability compared with tetraploid wheat, three genes (the expression levels of which all increased more than 8-fold) were screened after the addition of the D genome to tetraploid wheat #7AABB, TraesCS1B02G022400, TraesCS2D02G069100 and TraesCS3B02G056100.

[0038] Among them, the expression level of gene TraesCS1B02G022400 in hexaploid synthetic wheat SHW3 (AABBDD) increased more than 9-fold ( Figure 1 ), which is speculated to play a role in the process of hexaploid wheat adapting to environmental signals. The genomic sequence of the gene is shown as SEQ ID NO. 1, and the encoded protein sequence is shown as SEQ ID NO. 3.

[0039] Gene function verification of embodiment 2

[0040] In order to further identify the specific function of the gene, the inventors cloned the gene coding region (CDS) of TraesCS1B02G022400 gene, the sequence of which is shown as SEQ ID NO. 2. After the empty vector was digested by BamHI, the CDS was constructed into the overexpression vector by homologous recombination, and the plasmid was transformed into Agrobacterium EHA105. Using the Agrobacterium-mediated wheat immature embryo genetic transformation system, the gene was successfully transformed into the wheat variety Fielder, and the promoter and terminator used in the overexpression vector were the commonly used maize ubiquitin promoter (SEQ ID NO. 4) and nos terminator (SEQ ID NO. 5) in the art (see the vector map in Figure 2 ). Finally, the transformed strains were obtained, and 4 positive transformed strains were screened in the T1 generation Figure 3 A). After extracting RNA from the leaves of two strains ZR27-369 and ZR27-397 and reverse transcribing to obtain cDNA, the expression amount of TraesCS1B02G022400 gene was detected by qRT-PCR method, and it was found that the expression amount of the gene in the two strains ZR27-369 and ZR27-397 was significantly improved compared with the receptor control Figure 3 B). Among them, the specific primers for detecting the expression amount of TraesCS1B02G022400 gene by qRT-PCR are: WRGP-5943, AGAATTGCTGGCCCAGTCTC; WRGP-5944, AGAGCTTGTCTGACGTTGGG. The internal reference primers are: TaActin-F, CAGCAATGTATGTCGCAATC; TaActin-R, TAGCATGAGGAAGCGTGTAT.

[0041] After obtaining the overexpression materials, the stress resistance of ZR27-369 and ZR27-397 strains was further identified. ZR27-369, ZR27-397 and the receptor control Fielder were treated with saline-alkali stress and drought-heat stress.

[0042] The saline-alkali stress treatment method is as follows: a small square pot with a size of 8 cm x 8 cm is used for soil loading, 100 g of soil (including the weight of the pot) is loaded in each square pot, and after ensuring that the soil is fully watered, seeding is performed. Five experimental materials are seeded in each square pot, and three replicates are set for each material, totaling 15 experimental materials. When the wheat grows to the "two-leaf core" stage (about 12-13 days, the growth conditions are 20-23°C, 12h / 12h day and night). A 400 mmol / L saline-alkali aqueous solution (the ratio of NaCl:NaHCO3:Na2CO3 is 11:4.5:0.5, and the final pH value is 9) is slowly irrigated at the root of the plant. On the first day, 150 mL of saline-alkali water is irrigated, and the excess water is poured out. On the fourth day, 50 mL of saline-alkali water is irrigated again. After 12 days of treatment, the number of yellow and green leaves of each strain is counted, the proportion of yellow leaves is calculated, and a photograph is taken to evaluate the effect of saline-alkali stress on wheat growth.

[0043] The drought-heat stress treatment method is as follows: a small square pot with a size of 8 cm x 8 cm is used for soil loading, 100 g of soil (including the weight of the pot) is loaded in each square pot, and after ensuring that the soil is fully watered, seeding is performed. Five experimental materials are seeded in each square pot, and three replicates are set for each material, totaling 15 experimental materials. On the day before the wheat grows to the "two-leaf core" stage (about 12-13 days, the growth conditions are 20-23°C, 12h / 12h day and night), watering treatment is performed to ensure that the weights of the small pots are basically consistent. After multiple accurate measurements, the total weight of the small pots before treatment should be controlled within the range of 250g±4g. Then, the water in the white plate is poured out, and the treatment begins. The environmental temperature is adjusted to a high temperature range of 33-36°C, and no watering is performed while simulating a drought and high temperature stress environment. After 12 days of treatment, a 7-day rehydration treatment is performed, a photograph is taken, and the leaf curling degree of each material is counted.

[0044] After 12 days of saline-alkali stress treatment, the number of yellow and green leaves of the transgenic plants is counted, the proportion of yellow leaves is calculated, and the resistance of the wheat material to saline-alkali stress is measured. The results show that the yellow leaf and green leaf ratio of the overexpression plants is significantly lower than that of the control material Fielder (see Figure 4 ), indicating that overexpression of the TraesCS1B02G022400 gene can significantly improve the saline-alkali tolerance of wheat. After 12 days of drought-heat stress treatment and 7 days of rehydration, the leaf curling rate of the overexpression material is significantly lower than that of the control material Fielder (see Figure 5 ), indicating that overexpression of the TraesCS1B02G022400 gene can significantly improve the drought-heat tolerance of wheat.

[0045] In the same way, the functions of the two genes TraesCS3B02G056100 and TraesCS2D02G069100 were identified, and it was found that TraesCS3B02G056100 had the same anti-multiple stress ability as TraesCS1B02G022400, and TraesCS2D02G069100 had weaker anti-multiple stress ability.

[0046] The above results show that after overexpression of the TraesCS1B02G022400 gene, the resistance of wheat to salt, alkali, drought, and heat (high temperature) stress is significantly improved, and therefore increasing the expression amount of the TraesCS1B02G022400 gene can achieve the technical effect of improving the salt, alkali, drought, and heat multiple stress resistance of wheat. Although the present application has been described in detail in the foregoing general description and specific embodiments, modifications or improvements can be made to it on the basis of the present application, which will be apparent to those skilled in the art. Therefore, these modifications or improvements made on the basis of not deviating from the spirit of the present application are within the scope of the present application claimed.

Claims

1. An application of gene overexpression in improving wheat resistance to multiple stresses, characterized in that: The gene includes any one of the following: (1) A gene with the sequence shown in SEQ ID NO. 1 or SEQ ID NO. 2; (2) a gene encoding the sequence shown in SEQ ID NO. 3; (3) the gene numbered TraesCS1B02G022400 in the wheat gene database; Wherein, the multiple adversities are any one of salt, alkali, drought, and high temperature or a combination thereof.

2. Application of a biomaterial in improving wheat's resistance to multiple adversities, characterized in that: The biological material includes any one of the following: (1) An expression cassette containing the gene according to claim 1; (2) an expression vector containing the gene according to claim 1; (3) A host cell containing the gene of claim 1, wherein the host cell is a bacterial cell; Wherein, the multiple adversities are any one of salt, alkali, drought, and high temperature or a combination thereof.

3. A method for improving wheat resistance to multiple adversities, characterized in that: The method comprises the following steps: (1) increasing the expression of the gene of claim 1 in the wheat material to be improved; (2) selecting wheat plants with improved resistance to multiple stresses; Wherein, the multiple adversities are any one of salt, alkali, drought, and high temperature or a combination thereof.

4. The method according to claim 3, characterized in that The method for increasing gene expression is to use a high-activity promoter to drive the expression of the gene according to claim 1.

5. The method according to claim 4, characterized in that The high-activity promoter is shown in SEQ ID NO.

4.

6. Use of the method according to any one of claims 3 to 5 in improving the resistance of wheat to multiple stresses; in, The multiple adversities are any one of salt, alkali, drought, and high temperature, or a combination thereof.

Citation Information

Patent Citations

  • Application of wheat TaSnRK1 protein and related biological materials thereof in improving heat resistance of plants

    CN118812685A

  • SNP (Single Nucleotide Polymorphism) molecular marker related to salt tolerance of wheat and application

    CN118834991A

  • Application of TaWHY2-6A protein and coding gene thereof in regulation and control of plant drought tolerance

    CN118910132A

  • Wheat TaZNF10 gene and application thereof

    CN118879766A

  • Wheat disease-resistant gene Lr-L1 and its use

    CN1641029A