Application of the SlSYP51 gene and its encoded protein in regulating cold tolerance in tomato

Abstract

The present invention is applicable to the field of molecular biology technology and provides the use of the SlSYP51 gene and the protein it encodes for regulating tomato cold tolerance. The nucleotide sequence of the SlSYP51 gene is shown in SEQ ID No. 1, and the amino acid sequence of the protein encoded by the SlSYP51 gene is shown in SEQ ID No. 2. The present invention introduced the SlSYP51 gene into tomato plants using Agrobacterium-mediated transfection and found that SlSYP51-overexpressing plants exhibited greater cold tolerance than wild-type tomato plants. After treatment at 4°C for 2 days, the leaves of wild-type tomato plants showed significant wilt and curling, and were more severely damaged than those of SlSYP51-overexpressing plants. Overexpression of the SlSYP51 gene enhances antioxidant enzyme activity and improves cold tolerance in tomato plants. The present invention reveals a new pathway for cold tolerance signaling in tomatoes and provides genetic resources for breeding new cold-tolerant tomato varieties.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biology, and in particular relates to the application of the SlSYP51 gene and the protein encoded thereby in regulating the cold tolerance of tomatoes. Background Art

[0002] In the natural environment, plants often encounter adverse environments such as drought, low temperature, salinity, and heavy metals, which are collectively referred to as abiotic stresses. Among them, cold stress (low temperature stress) is a type of stress that has a particularly significant impact on plants. It affects the geographical distribution, growth cycle, crop yield, and fruit quality of plants. According to statistics, the economic losses caused by low temperature damage to global agriculture are huge, with crop yields decreasing by an average of about 13-15%. In China, cold waves in early spring and late autumn often cause reactions such as freezing of plant cell membranes, hindering plant growth and even causing permanent damage. Therefore, it is of great significance to deeply study the cold resistance mechanism of plants and improve their cold resistance.

[0003] Tomato (Solanum lycopersicum L.), a key crop originating in South America, is widely cultivated worldwide for its rich vitamin A and other nutrients, sweet and sour taste, and excellent flavor. It plays a crucial role in the global economy. However, cold stress can severely impact tomato growth, development, and yield. Therefore, using biobreeding techniques to develop cold-tolerant genes and rapidly cultivate cold-tolerant tomato varieties has important theoretical and practical value.

[0004] In cell biology, SNAREs are protein complexes that fuse the cell membrane and vesicle membrane. Found on both the cell membrane and the vesicle membrane, they bind and fuse to enable vesicle-cell fusion, thereby enabling the transport and release of intracellular substances. SNAREs are also involved in cellular processes such as neurotransmitter release, endocytosis, and the regulation of certain signaling pathways. Therefore, SNAREs play a crucial role in the normal function and physiological processes of cells.

[0005] With the development of molecular biology theory and technology, current research shows that the molecular regulatory mechanism of plant cold resistance is complex, involving multiple genes and transcription factors, such as CBF, COR, MYB, WRKY, bHLH, etc. These genes and transcription factors improve the cold resistance of plants by regulating the expression of downstream genes. However, the response mechanism of SNARE protein family member SlSYP51 under plant abiotic stress, especially its function in cold tolerance, has not yet been studied. For this reason, the present invention proposes the application of SlSYP51 gene and its encoded protein in regulating tomato cold tolerance. Summary of the Invention

[0006] The purpose of the present invention is to provide the use of the SlSYP51 gene and the protein encoded by it in regulating the cold tolerance of tomatoes, aiming to solve the problems raised in the above background technology.

[0007] To achieve the above object, the present invention provides the following technical solutions:

[0008] The SlSYP51 gene and the protein encoded by it are used in regulating the cold tolerance of tomatoes. The nucleotide sequence of the SlSYP51 gene is shown in SEQ ID No. 1, and the amino acid sequence of the protein encoded by the SlSYP51 gene is shown in SEQ ID No. 2.

[0009] Furthermore, overexpression of the SlSYP51 gene improves the cold tolerance of the plant by enhancing the activity of antioxidant enzymes in the plant.

[0010] Furthermore, the antioxidant enzymes include superoxide dismutase and peroxidase.

[0011] Compared with the prior art, the present invention has the following beneficial effects:

[0012] This study used Agrobacterium-mediated gene transfer to successfully introduce the SlSYP51 gene into tomato plants. Experimental results showed that SlSYP51-overexpressing plants exhibited greater cold tolerance than wild-type tomato plants. Specifically, after two days of treatment at 4°C, the leaves of wild-type tomato plants showed significant wilting and curling, and were more severely damaged than those of SlSYP51-overexpressing plants. Further research revealed that overexpression of the SlSYP51 gene can lead to increased antioxidant enzyme activity in the plant. This change helps reduce the content of reactive oxygen species, thereby alleviating damage caused by low temperature stress and improving the cold tolerance of tomato plants. This study not only reveals a new pathway for cold tolerance signaling in tomatoes but also provides valuable genetic resources for breeding new cold-tolerant tomato varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 Amplified tomato SlSYP51 fragment.

[0014] Figure 2 The results are verified by PCR of Escherichia coli colonies.

[0015] Figure 3 The results are verified by Agrobacterium colony PCR.

[0016] Figure 4 This is the genetic transformation of SYP51 in tomato.

[0017] Figure 5 PCR identification of T0 generation transgenic plants.

[0018] Figure 6 PCR identification of T1 generation transgenic plants.

[0019] Figure 7 Expression level analysis of different strains of SlSYP51 overexpressing plants.

[0020] Figure 8 Comparison of the phenotypes of wild-type tomato plants (MT) and SlSYP51 gene overexpressing plants before and after low temperature stress.

[0021] Figure 9 Comparison of DAB staining between wild-type tomato plants (MT) and SlSYP51 gene overexpressing plants.

[0022] Figure 10 Enzyme activity determination of wild-type tomato plants (MT) and SlSYP51 gene overexpressing plants; (a) shows the change in SOD content, and (b) shows the change in POD content. DETAILED DESCRIPTION

[0023] In order to make the purpose, technical solutions and advantages of the present invention more clearly understood, the present invention will be further described in detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.

[0024] This study used Agrobacterium-mediated transfer of the SlSYP51 gene into tomato plants, observing and comparing phenotypic differences between the transgenic and wild-type plants. Physiological indicators were also measured for comparison. These comparative studies provide insights into the impact of the SlSYP51 gene on plant cold tolerance, providing new insights and approaches for the research and application of plant cold tolerance.

[0025] The specific implementation of the present invention is described in detail below with reference to specific embodiments.

[0026] Example 1: Construction of SlSYP51 overexpression vector;

[0027] 1. Cloning of the full-length SlSYP51 gene: Total RNA was extracted from leaves of wild-type tomato (Micro Tom (MT)) and reverse transcribed to obtain cDNA. This cDNA was used as a template to amplify the CDS region of the SlSYP51 gene. Primers for SlSYP51 (SlSYP51-F and SlSYP51-R, see Table 1 for their sequences) were designed using NCBI. Protective bases were added at both ends of the restriction enzyme cleavage site and the primers were sent to Kumei Biotechnology for primer sequence synthesis.

[0028] The primers for gene cloning and amplification are as follows:

[0029] Table 1 Gene cloning and amplification primers

[0030]

[0031] The amplification reaction system is as follows:

[0032] Table 2 Amplification reaction system

[0033]

[0034] The reaction procedure is as follows:

[0035] Table 3 Reaction procedure

[0036]

[0037] After obtaining the target fragment, gel recovery was performed to obtain Inserts, which were stored at -20°C for future use. Figure 1 The 702 bp CDS sequence fragment of the SlSYP51 gene obtained by gel recovery is shown.

[0038] 2. Enzyme digestion: Use restriction endonucleases BsaI / Eco31I to digest the expression vector plasmid empty vector pBWA(V)HS, and then recover the product after digestion.

[0039] The enzyme digestion system is as follows:

[0040] Table 4 Enzyme digestion system

[0041]

[0042] Incubate at 37°C for 2 hours. After digestion, take 5 μL of the digestion product and load it onto a 1.0% agarose gel to verify the digestion effect by electrophoresis. After verification, purify the remaining digestion product using a DNA purification kit to obtain the linearized vector.

[0043] 3. Ligation: Connect the purified enzyme-digested vector and the target fragment inserts through seamless cloning. The connection system is as follows:

[0044] Table 5 Connection system

[0045]

[0046] Mix gently, incubate at 50°C for 15 min, and place the tube on ice for a few seconds. Store the recombinant product at -20°C or use it directly for transformation.

[0047] 4. Transformation of recombinant products into E. coli:

[0048] (1) Take 50 μL of Trans-T1 competent cells and thaw them on ice.

[0049] (2) Add 2 μL of the recombinant product to the competent cells, flick to mix, and incubate on ice for 30 min.

[0050] (3) Heat shock in a 42°C water bath for 40 seconds, then quickly move to an ice bath and cool for 2-3 minutes (without shaking).

[0051] (4) Add 900 μL of antibiotic-free LB liquid culture medium to each centrifuge tube, mix well, and shake at 37°C for 1 hour (180-200 rpm).

[0052] (5) Centrifuge at 6000 rpm for 1 min, collect the bacteria, discard part of the supernatant, and leave about 100 μL of the transformed competent cells in a flask containing Kan + Spread the plate evenly with a sterile glass rod, place upright to dry, and then place it upside down in a 37°C incubator for 12-16 hours (overnight) to observe the colonies.

[0053] 5. Colony PCR verification: Pick a single colony of E. coli in the clean bench and perform colony PCR (see Figure 2 ) and mark the serial number. At the same time, add the corresponding colony to 10mL LB liquid culture medium (Kan + Incubate at 37°C (200 rpm) for 12 hours. Load 6 μL of PCR product on an agarose gel for electrophoresis. Positive colonies detected were sent to Kumei Biotech for sequencing. Mix the positive bacterial solution with 50% glycerol in a 1:1 ratio and store in a -80°C freezer until ready for use.

[0054] The colony PCR system is as follows:

[0055] Table 6 Colony PCR system

[0056]

[0057]

[0058] The reaction system is as follows:

[0059] Table 7 Reaction system

[0060]

[0061] The plasmid was extracted from the correctly sequenced E. coli to obtain the successfully connected plasmid pBWA(V)HS-SISYP51, which was stored at -20°C.

[0062] 6. Transform Agrobacterium;

[0063] (1) Thaw Agrobacterium GV3101 at room temperature or in the palm of your hand for a while, then place on ice for a while.

[0064] (2) Prepare in advance an ice box, liquid nitrogen, a water bath at 37°C, ultra-clean, sterile centrifuge tubes, and LB liquid culture medium (without resistance).

[0065] (3) In a clean bench: add 1-2 μL of successfully connected plasmid to 50 μL of Agrobacterium and flick gently to mix.

[0066] (4) Place on ice for 5 min, in liquid nitrogen for 5 min, in a 37°C water bath for 5 min, and in an ice bath for 5 min.

[0067] (5) Ultra-clean: Add 700 μL of antibiotic-free LB liquid culture medium, pipette to mix, and shake in a shaker at 28°C for 2-3 hours.

[0068] (6) Centrifuge at 10000 rpm for 1 min to collect bacteria and cleanse: take about 100 μL of the supernatant and apply it on Kan + 、Rif + Seal the plate, place upright to dry, and invert it in a 28°C incubator for 2 days. Observe the colonies.

[0069] (7) Pick a single Agrobacterium colony in the clean bench and perform colony PCR verification (see Figure 3 ), screen the positive clones, and place them in a shaking incubator at 28°C for storage.

[0070] Example 2: Agrobacterium-mediated genetic transformation of tomato;

[0071] 1. Seed disinfection: Soak the seeds in clean water for 2-3 hours in advance. Under a sterile environment, wash with 75% alcohol for 30 seconds, shake with NaClO for 13 minutes, and rinse with sterile water 5-6 times.

[0072] 2. Sowing: Aseptically sow sterilized tomato seeds in 1 / 2 of the culture medium. Incubate in the dark at 24°C for 3-4 days. Once the tomato seeds turn white, move the culture medium to 24°C with 16 hours of light and 8 hours of darkness. Seven to eight days after sowing, seedlings can be used for experiments when both cotyledons are fully expanded.

[0073] 3. Preparation and pre-culture of explants: After the cotyledons of the germinated tomato seedlings are fully expanded, the petioles and tips of the cotyledons are removed with a scalpel, and the middle part is cut into 2-3 sections and inoculated into the pre-culture medium. Pre-culture at 24°C for 2-3 days.

[0074] 4. Agrobacterium infection and co-cultivation: Pick Agrobacterium and place it in the infection solution. Culture it with shaking at 28℃ until OD600≈0.8. Dilute the Agrobacterium resuspension until OD600=0.3-0.4, infect the leaves for 10-15 minutes, inoculate the dried explants in the co-culture medium, and culture it in the dark at 24℃ for 2 days.

[0075] 5. Screening and Rooting: Inoculate the recovered callus onto screening medium and incubate at 24°C with a 16h / 8h light / dark cycle for 15-30 days. Inoculate the selected callus onto differentiation medium and incubate at 24°C with a 16h / 8h light / dark cycle for 30-40 days. Once the seedlings to be differentiated have grown to approximately 2-3 cm, excise them from the callus and inoculate them onto 1 / 2 MS rooting medium and incubate at 24°C with a 16h / 8h light / dark cycle for 10-15 days.

[0076] 6. Transplantation: After 1-2 weeks of rooting culture, open the cover of the rooted tissue culture seedlings and harden them for 1 day, then transplant them into vermiculite for growth.

[0077] Example 3: Cold resistance identification;

[0078] 1. Plant material cultivation: To further investigate the function of the SlSYP51 gene, Agrobacterium tumefaciens (pBWA(V)HS-SISYP51) was introduced into wild-type tomato (MT) using the Agrobacterium-mediated leaf disc method. After the root system of the plant was fully developed, the transgenic lines were hardened and cultured to obtain T0-generation transgenic tomato plants overexpressing SISYP51 (see Figure 4 Positive T0-generation tissue culture seedlings were identified. Positive T0-generation plants were transplanted from vermiculite into a substrate and harvested to obtain T1-generation seeds. After further screening, positive seedlings were sown to obtain T2-generation seeds, which served as the research subjects. Wild-type tomato MT and T2-generation seeds from the same period were germinated in darkness for 3 days. Once the seeds turned white, they were sown in plug trays and incubated at 24°C with a 16 / 8 hour humidity. After 4 weeks, the mature seedlings were cold-treated at 4°C.

[0079] 2. Identification of transgenic positive seedlings: After obtaining T0 generation plants, the whole genomic DNA of the plants was extracted and used as a template for PCR reaction using the vector universal upstream primer (35SF) and the gene downstream primer (SlSYP51-R0).

[0080] The primers are as follows:

[0081] 35SF: GACGCACAATCCCACTATCC (as shown in SEQ ID No. 5)

[0082] SlSYP51-R0: CAGATACTTAATCAACATATATATATTGCC (as shown in SEQ ID No. 6)

[0083] The PCR reaction system (10 μL) is as follows:

[0084] Table 8 PCR reaction system

[0085]

[0086] The reaction conditions are as follows:

[0087] Table 9 Reaction conditions

[0088]

[0089] Prepare electrophoresis solution using agarose and TAE buffer (at a ratio of 1g:100mL), add EB instead of dye, and then perform electrophoresis on the PCR product, using the plasmid as a positive control and the wild-type tomato MT as a negative control. Plants with corresponding bands to the positive control are positive plants, and the positive plants are selected and retained. Figure 5 As shown, M represents Marker, lanes 1 to 11 are different overexpression plants, lanes 12 and 13 are positive plasmid controls, and lane 14 is a wild-type tomato MT negative control. According to the PCR identification results, 10 overexpression lines showed bands in the PCR electrophoresis results, indicating positive, while the wild-type tomato MT electrophoresis results did not show bands, indicating negative, indicating that all 10 overexpression lines were successfully transformed. Subsequently, the T0 generation plants were propagated and the positive rate of the T1 generation plants was 83% (see Figure 6 ), and select positive plants for subsequent experiments.

[0090] 3. Expression in wild-type tomato plants and plants with different SlSYP51 overexpression;

[0091] The expression of SlSYP51 in overexpression plants of different strains (OE-2, OE-3, OE-4, and OE-5) was detected by real-time fluorescence quantitative PCR. Figure 7 As shown, it can be seen that the expression levels of SlSYP51 in overexpressing plants of different strains are significantly higher than that in wild-type tomato plants.

[0092] 4. Comparison of phenotypic observations between wild-type tomato plants and SlSYP51 overexpressing plants;

[0093] Wild-type tomato plants and SlSYP51 overexpressing plants were placed in a 4°C incubator with 16 hours of light and 8 hours of darkness for 2 days. After treatment, the leaves of wild-type tomato plants showed severe wilting and curling, while the leaves of SlSYP51 overexpressing plants showed no obvious changes (see Figure 8 ).

[0094] 5. DAB staining of leaves of wild-type tomato plants and SlSYP51 overexpressing plants after cold treatment;

[0095] After 2 days of cold treatment at 4°C, the leaves were stained with DAB. It was found that the damage degree of the wild-type tomato plants that were not cold-treated was similar to that of the SlSYP51 overexpressing plants, while the damage degree of the wild-type tomato plants that were cold-treated was significantly more serious than that of the SlSYP51 overexpressing plants (see Figure 9 ).

[0096] 6. Determination of physiological indicators after 2 days of cold treatment;

[0097] After 2 days of cold treatment at 4°C, the contents of superoxide dismutase (SOD) and peroxidase (POD) in the leaves of wild-type tomato plants and SlSYP51 overexpressing plants increased significantly, and the increase in the SlSYP51 overexpressing plants was greater than that in the wild-type tomato plants (see Figure 10 This suggests that overexpression of the SlSYP51 gene can increase the activity of antioxidant enzymes in plants, thereby reducing the content of reactive oxygen species, further alleviating stress damage, and thus improving plant cold tolerance.

[0098] In summary, the cold tolerance of SlSYP51 overexpressing plants was higher than that of wild-type tomato plants.

[0099] The above are only preferred embodiments of the present invention. It should be pointed out that for those skilled in the art, several variations and improvements can be made without departing from the concept of the present invention. These should also be regarded as the scope of protection of the present invention. These will not affect the effect of the implementation of the present invention and the practicality of the patent.

Claims

1. Overexpression SlSYP51 The use of a gene or a protein encoded by the gene in improving the cold tolerance of tomatoes is characterized in that: described SlSYP51 The nucleotide sequence of the gene is shown in SEQ ID No.

1. SlSYP51 The amino acid sequence of the protein encoded by the gene is shown in SEQ ID No. 2.

Images