CPVs insecticide based on bombyx mori cytoplasmic polyhedrosis virus as well as preparation and application of CPVs insecticide

Abstract

The invention discloses a CPVs insecticide based on a bombyx mori cytoplasmic polyhedrosis virus as well as preparation and application thereof. The preparation method comprises the following steps: carrying out enzyme digestion linearization on recombinant plasmids pT-S1, pT-S2, pT-S3, pT-S4, pT-S5, pT-S6, pT-S7, pT-S8 and pT-S9 with full-length cDNA (complementary deoxyribonucleic acid) of S1 to S9 fragments of the BmCPV and a plasmid pT-S10-Bt with a DNA sequence fused by a Bt gene and polyhedrosis protein ORF on an S10 fragment of the BmCPV; the method comprises the following steps of: obtaining linearized plasmids of pT-S1 to pT-S9 and pT-S10-Bt, then transfecting to obtain a recombinant virus BmCPV-Bt, and then preparing the insecticide. When the BmCPV-Bt is ingested by insects, the polyhedrosis-Bt fusion protein is dissolved in alkaline digestive tracts of the insects, and active peptides with toxicity are released to cause rapid death of the insects. According to the technical scheme disclosed by the invention, a novel, green and environment-friendly biological insecticide can be provided for prevention and control of agricultural and forestry pests.

Description

Technical Field

[0001] The invention belongs to the technical field of viral gene engineering, and specifically relates to a method and application of preparing a novel CPVs insecticide based on a reverse genetics system of silkworm cytoplasmic polyhedrosis virus. Background Art

[0002] Chemical pesticides can be used to control the number of harmful organisms and protect the safety of crops. However, due to the long-term and uncontrolled use of chemical pesticides, the resistance of pests has been significantly enhanced, which has seriously affected the ecological balance and caused increasingly severe environmental pollution. Microbial pesticides have the advantages of stable efficacy, convenient application, and environmental protection. They have become an effective means of pest control. Microbial pesticides mainly include viral pesticides, bacterial pesticides, and fungal pesticides. Bacillus thuringiensis ( Bacillus thuringiensis Bt) as a microbial insecticide has the characteristics of broad-spectrum insecticide and rapid effect, and has been widely used in production. However, Bt has the disadvantage of short field persistence in production control. As biological insecticides, insect viruses have the aftereffect of successive transmission and play an important role in pest control. Among them, cytoplasmic polyhedrosis viruses (CPVs) are an important type of agricultural and forestry pest pathogens. CPVs infection can not only be transmitted horizontally between pests, but also vertically through eggs, thereby forming a viral epidemic in the pest population, thereby effectively controlling the number of pests. The silkworm cytoplasmic polyhedrosis virus ( Bombyx mori BmCPV) is a typical species of CPVs, which can infect a variety of agricultural and forestry pests such as pine caterpillars, gypsy moths, camphor silkworms, flax moths, gypsy moths, and greater wax moths; however, the death cycle of insects infected with CPVs is relatively slow.

[0003] Therefore, it is necessary to develop new technical solutions to improve insecticidal ability through molecular methods of genetic modification and thus shorten the insecticidal cycle. Summary of the invention

[0004] In order to solve the shortcomings of existing insecticides in production and control, such as short field persistence and slow insect death cycle, the present invention fuses the toxic protein gene Bt of Bacillus thuringiensis with the polyhedral protein ORF of the S10 fragment of BmCPV to construct a plasmid pT-S10-Bt expressing the polyhedral-Bt toxic protein fusion protein, and constructs the silkworm cytoplasmic polyhedrosis virus BmCPV-Bt that can express the Bt toxin protein with the help of the reverse genetics system of the silkworm cytoplasmic polyhedral based on DNA vector, which is a new CPVs insecticide. The virus particle BmCPV-Bt constructed by the present invention can be protected from environmental influences by the polyhedral-Bt fusion protein and is suitable for field application. When BmCPV-Bt is ingested by insects, the polyhedral-Bt fusion protein dissolves in the alkaline digestive tract of the insect, releasing the active peptide with toxicity to cause the insect to die quickly. The technical scheme disclosed in the present invention can provide a new type of green and environmentally friendly biological insecticide for the prevention and control of agricultural and forestry pests.

[0005] The present invention adopts the following technical scheme.

[0006] A method for preparing a CPVs insecticide based on Bombyx mori cytoplasmic polyhedrosis virus comprises the following steps: (1) The recombinant plasmids pT-S1, pT-S2, pT-S3, pT-S4, pT-S5, pT-S6, pT-S7, pT-S8, and pT-S9 carrying the full-length cDNA of the S1 to S9 fragments of BmCPV, and the plasmid pT-S10-Bt carrying the DNA sequence of the Bt gene fused with the polyhedrin ORF on the S10 fragment of BmCPV were linearized by enzyme digestion to obtain the linearized plasmids of pT-S1 to pT-S9 and pT-S10-Bt; (2) The linearized plasmids pT-S1 to pT-S9 and pT-S10-Bt obtained in step (1) are mixed, and then transfected into host cells expressing T7 RNA polymerase. The cells are then collected and broken, and purified by centrifugation to obtain the recombinant virus BmCPV-Bt; (3) The recombinant virus BmCPV-Bt is inoculated into cultured silkworm cells. After culture, the cells are collected and disrupted to obtain a CPVs insecticide based on the Bombyx mori cytoplasmic polyhedrosis virus; or the recombinant virus BmCPV-Bt is inoculated into silkworms. After disease occurs, the silkworms are collected and homogenized to obtain a CPVs insecticide based on the Bombyx mori cytoplasmic polyhedrosis virus; or the feed containing the recombinant virus BmCPV-Bt is fed to silkworms until the silkworms wake up from dormancy at the 3rd instar, and the silkworms are collected and homogenized to obtain a CPVs insecticide based on the Bombyx mori cytoplasmic polyhedrosis virus.

[0007] In the present invention, in step (1), the cDNA of the full-length fragments of BmCPV S1 to S9 is used as a template, PCR amplification is performed to obtain 9 fragments, and the fragments are cloned into a plasmid vector. The plasmid vector can be selected from pIZT-V5 / His vector (Invitrogen), pUC series vector (TAKATA) or pBlueScript SK II vector (Novagen), preferably pIZT-V5 / His vector.

[0008] Preferably: the full-length fragments of S1, S2 and S3 are cloned into the Sac I and Sac II sites of the pIZT-V5 / His vector, respectively, to obtain pT-S1, pT-S2 and pT-S3; the full-length fragments of S4, S5, S6, S8 and S9 are cloned into the Kpn I and Sac II sites of the pIZT-V5 / His vector, respectively, to obtain pT-S4, pT-S5, pT-S6, pT-S8 and pT-S9; the full-length fragment of S7 is cloned into the Kpn I and Xho I sites of the pIZT-v5 / His vector to obtain pT-S7; the S10-Bt DNA fragment is cloned into the pIZT-V5 / His vector to obtain the recombinant plasmid pT-S10-Bt, the sequence of which is SEQ ID NO: 1, see Appendix.

[0009] In the above technical solution, the host cell expressing T7 RNA polymerase used for transfection is a host cultured cell pre-transfected with a recombinant vector pIZT-V5 / His-T7RNApol containing a T7 RNA polymerase gene expression cassette; the host cell is a Bombyx mori BmN cultured cell. Preferably, the recombinant vector pIZT-V5 / His-T7RNApol is transfected into the Bombyx mori BmN cultured cells, and then the transformed cells expressing T7 RNA polymerase are obtained by continuous screening with Zeocin antibiotics.

[0010] Preferably, in step (2), the obtained linearized plasmids of pT-S1 to pT-S9 and pT-S10-Bt are mixed in equal moles, and then PEI is used to transfect host cells expressing T7 RNA polymerase, and then the cells are collected and broken, centrifuged and purified to obtain the recombinant virus BmCPV-Bt; preferably, the collected cells are repeatedly frozen and thawed 2 to 5 times to achieve breakage, centrifuged and purified, and the cell supernatant is collected to obtain the recombinant virus BmCPV-Bt; preferably, the transfection time is 100 to 500 hours, more preferably 120 to 300 hours, and further preferably 150 to 200 hours.

[0011] Preferably, in step (3), the recombinant virus BmCPV-Bt is inoculated into cultured silkworm cells. After culture, the cells are collected, and the cells are broken and then subjected to differential centrifugation to obtain polyhedrons encapsulating foreign proteins, which is a CPVs insecticide based on the silkworm cytoplasmic polyhedrosis virus.

[0012] Preferably, in step (3), the recombinant virus BmCPV-Bt is inoculated into silkworms, and after the disease occurs, the silkworms are collected, homogenized, and polyhedrons are purified by differential centrifugation to obtain polyhedrons encapsulating foreign proteins, which are CPVs insecticides based on Bombyx mori cytoplasmic polyhedrosis virus.

[0013] Preferably, in step (3), the feed containing the recombinant virus BmCPV-Bt is fed to the silkworms until they wake up from sleep at the 3rd instar, and then the midgut of the silkworms is dissected and homogenized for purification to obtain the CPVs insecticide based on the Bombyx mori cytoplasmic polyhedrosis virus; specifically, the cell supernatant containing BmCPV-Bt is applied to the sterilized feed (the ratio of feed powder to water is 1:1.5, and the application amount is 200 μL / 25 cm 2 ), followed by feeding newly emerged silkworms, and continue feeding until the 3rd instar silkworms wake up. The midgut is then removed and ground into a grinding liquid, which is then purified to obtain BmCPV-Bt polyhedron, a CPVs insecticide based on the Bombyx mori cytoplasmic polyhedrosis virus.

[0014] The invention discloses a CPVs insecticide based on Bombyx mori cytoplasmic polyhedrosis virus, which is prepared according to a preparation method of the CPVs insecticide based on Bombyx mori cytoplasmic polyhedrosis virus.

[0015] The invention further discloses the application of CPVs insecticide based on Bombyx mori cytoplasmic polyhedrosis virus in the preparation of insecticides, or the application as an insecticide.

[0016] Preferably, the insecticide acts on crops, or the insecticide kills organisms that are harmful to crops, such as pine caterpillars, gypsy moths, camphor silkworms, flax moths, gypsy moths, greater wax moths and other agricultural and forestry pests.

[0017] The invention discloses a DNA sequence of a Bt gene fused with a polyhedrin ORF on a BmCPV S10 fragment for preparing the CPVs insecticide based on Bombyx mori cytoplasmic polyhedrosis virus.

[0018] The present invention discloses a method for controlling organisms harmful to crops by using the CPVs insecticide based on Bombyx mori cytoplasmic polyhedrosis virus, wherein the control includes killing, reducing, etc. Preferably, the method comprises the following steps, wherein the CPVs insecticide based on Bombyx mori cytoplasmic polyhedrosis virus is applied to crops to kill or reduce the organisms harmful to crops.

[0019] The present invention fuses the toxin protein gene Bt of Bacillus thuringiensis with the polyhedral protein ORF of the S10 fragment of BmCPV to construct a plasmid pT-S10-Bt expressing the polyhedral-Bt toxin protein fusion protein, and constructs the silkworm cytoplasmic polyhedrosis virus BmCPV-Bt that can express the Bt toxin protein with the help of the silkworm cytoplasmic polyhedral reverse genetics system based on a DNA vector, which is a new CPVs insecticide. The disclosed technology replaces the polyhedral protein open reading frame of the S10 fragment of the BmCPV virus with an exogenous protein gene, and the constructed BmCPV virus particles lack polyhedral protein encapsulation protection, and the virus particles are easily inactivated by external influences. This technology retains the polyhedral protein open reading frame of the S10 fragment, and the constructed virus particles BmCPV-Bt can be protected from environmental influences by the polyhedral-Bt fusion protein, and are suitable for field application. When BmCPV-Bt is ingested by insects, the polyhedral-Bt fusion protein dissolves in the insect's alkaline digestive tract, releasing toxic active peptides that cause the insect to die quickly. This technology can provide a new type of green and environmentally friendly biological insecticide for the prevention and control of agricultural and forestry pests. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 This is the electrophoresis diagram of the PCR product of the fusion junction site of S10 and Bt genes amplified by specific primers Primer-Bt-F / R.

[0021] Figure 2 The PCR product of the fusion junction site of S10 and Bt genes amplified by specific primers Primer-Bt-F / R was sequenced by Sanger sequencing.

[0022] Figure 3 This is the secondary mass spectrometry matching diagram of the specific peptide segment at the fusion site of the polyhedron-Bt fusion protein.

[0023] Figure 4 This is an observation of the recombinant virus BmCPV-Bt polyhedron obtained from the midgut of the silkworm. The red arrow indicates the BmCPV-Bt polyhedron.

[0024] Figure 5 These are silkworms that died during the virulence test of the recombinant virus BmCPV-Bt.

[0025] Figure 6 This is the G. mellonella that died during the virulence test of the recombinant virus BmCPV-Bt. DETAILED DESCRIPTION

[0026] Mixing insect viruses with Bt to develop compound preparations for field application can improve the insecticidal effect of a single drug and achieve better economic benefits. However, this synergistic effect is not obvious, and there is still a short field timeliness and the inability to form a population effect. In addition, the compound preparation needs to prepare the insect virus insecticide and the bacterial insecticide separately, and then mix them, which is relatively cumbersome. The present invention directly genetically modifies CPVs by molecular biological means to express Bt toxin protein, which can significantly enhance the insect virus insecticidal ability, play a synergistic role on the insect virus insecticide, improve its insecticidal ability, and then shorten the insecticidal cycle, realizing the integration of insect virus insecticide and bacterial insecticide.

[0027] The present invention linearizes the full-length cDNA recombinant plasmids pT-S1 to pT-S9 and plasmid pT-S10-Bt containing 9 segments (S1-S9) of BmCPV by enzyme digestion, and then mixes and transfects the stable cells expressing T7 RNA polymerase, and collects the cell supernatant to obtain the recombinant virus BmCPV-Bt. The recombinant virus BmCPV-Bt is used to inoculate silkworm culture cells, and after culture, the cells are collected and broken to obtain the CPVs insecticide based on the silkworm cytoplasmic polyhedrosis virus; or the recombinant virus BmCPV-Bt is used to inoculate silkworms, and after the disease occurs, the silkworms are collected and homogenized to obtain the CPVs insecticide based on the silkworm cytoplasmic polyhedrosis virus; or the feed containing the recombinant virus BmCPV-Bt is fed to the silkworms, and the feeding is continued until the 3rd instar sleeps, and the silkworms are collected and homogenized to obtain the CPVs insecticide based on the silkworm cytoplasmic polyhedrosis virus.

[0028] The following is a detailed description of the technical progress of the present invention. The experimental materials and reagents involved in the present invention are all existing products, such as the BmN cell transfection reagent is PEI transfection reagent (Proteintech, US), the reverse transcription kit is EasyScript First-Strand cDNA Synthesis SuperMix (Quanshijin, Beijing), serum-free medium: commercial insect medium TC-100 is purchased, serum medium: commercial insect medium TC-100 contains 10% calf serum, for example, 100 ml of medium contains 90 ml of serum-free TC-100 and 10 ml of calf serum, and greater wax moth and greater wax moth feed are purchased from Keyun Biology. Specific experimental operations and performances are all conventional techniques, such as the methods of synthesizing DNA sequences, cloning sequences into vectors, and enzyme linearization are all conventional methods in the art, and can refer to the prior art literature, such as the technical literature previously disclosed by the inventor's research group. For example, BmCPV polyhedral protein antibodies are prior art, prepared according to the reference: Zhang Ziyao. Study on the interaction between the structural protein VP7 of the silkworm cytoplasmic polyhedrosis virus and polyhedral protein. The feed and method for feeding silkworms are conventional techniques and meet the basic requirements of silkworm production.

[0029] Preparation Example The construction of stable cells expressing T7 RNA polymerase is specifically the prior art, which is briefly described as follows: the recombinant vector pIZT-V5 / His-T7RNApol of the T7 RNA polymerase gene expression cassette is transfected into Bombyx mori BmN cells (host cells). After 72 days, about 10% of the cells are observed under an inverted fluorescence microscope, and green fluorescence is observed, proving that the transfection is successful. Then, zeocin antibiotics with a final concentration of 400 μg / mL are added for screening. As the number of screenings increases, the proportion of green fluorescence also increases. After 5 weeks, the fluorescence remains stable and the proportion is maintained at about 70%, indicating that stable cells expressing T7 RNA polymerase have been obtained, which are called BmT7 cells. Synthesis example

[0030] The S10-Bt DNA fragment was cloned into the pIZT-V5 / His vector by conventional methods to obtain the recombinant plasmid pT-S10-Bt, the sequence of which is SEQ ID NO:1.

[0031] Example 1 A method for preparing a CPVs insecticide based on Bombyx mori cytoplasmic polyhedrosis virus comprises the following steps.

[0032] The construction of pT-S1 to pT-S9 recombinant plasmids is an existing technology, and refers to an in vitro construction method of Bombyx mori cytoplasmic polyhedrosis virus based on a DNA vector, which is briefly described as follows: using the cDNA of the full-length fragments of BmCPV S1 to S9 as templates, PCR amplification was performed to obtain 9 fragments, which were cloned into the pIZT-V5 / His vector. The full-length fragments of S1, S2 and S3 were cloned into the Sac I and Sac II sites of the pIZT-v5 / His vector, respectively, to obtain pT-S1, pT-S2 and pT-S3; the full-length fragments of S4, S5, S6, S8 and S9 were cloned into the Kpn I and Sac II sites of the pIZT-v5 / His vector, respectively, to obtain pT-S4, pT-S5, pT-S6, pT-S8 and pT-S9; the full-length fragment of S7 was cloned into the Kpn I and Xho I sites of the pIZT-v5 / His vector, to obtain pT-S7.

[0033] The DNA sequence S10-Bt, which is a fusion of the Bt gene and the polyhedrin ORF on the S10 fragment, is synthesized by conventional methods. The S10-Bt DNA fragment is cloned into the pIZT-V5 / His vector to obtain the recombinant plasmid pT-S10-Bt. The sequence is shown in Appendix SEQ ID NO:2. A sequence for BT virus detection is added to SEQ ID NO:1, and specific primers are used to detect whether BmCPV-Bt is successfully constructed. As common sense, in actual production, if no verification is required, the sequence of the recombinant plasmid pT-S10-Bt is SEQ ID NO:1.

[0034] Plasmid linearization and transfection: The full-length cDNA recombinant plasmids pT-S1 to pT-S9 containing 9 segments (S1-S9) of BmCPV and plasmid pT-S10-Bt were linearized by restriction digestion. pT-S1 to pT-S6 and pT-S8 were digested with Sac Ⅱ, pT-S7 was digested with Xba Ⅰ, and pT-S10-Bt was digested with Age Ⅰ. The 10 linearized plasmids were mixed into a 1.5 mL EP tube (1 µg of each segment was transfected), and insect serum-free medium was added to make up to 100 µL. Then 20 µL of PEI transfection reagent was added to another 1.5 mL EP tube and made up to 100 µL with serum-free medium. After mixing the two tubes, let them stand for 30 min. Then the mixture was added to serum-free BmT7 cells and cultured in a 26 °C incubator for 6 h. Then the serum-free medium was discarded and 10 mL insect serum culture medium. After 168 h, the cells were collected and frozen and thawed three times, and the cell supernatant was collected to obtain the recombinant virus BmCPV-Bt for detection and construction of insecticides.

[0035] Transfer of cell supernatant: Inoculate normal BmN cells (silkworm ovary cells) with cell supernatant containing the recombinant virus BmCPV-Bt. After 10 days of culture, extract total RNA and use random primers for reverse transcription. Use specific primers (Primer-Bt-F / R) to amplify the linker sequence of the fusion of the BmCPV polyhedron fragment and the Bt gene fragment, and sequence the amplified product to verify the successful construction of the virus BmCPV-Bt. Alternatively, extract total protein, enrich it with BmCPV polyhedron antibody, and identify the enriched protein by mass spectrometry to detect whether the recombinant virus BmCPV-Bt is successfully constructed.

[0036] CPVs insecticide based on Bombyx mori cytoplasmic polyhedrosis virus: First, disinfect the silkworm eggs with cotton balls containing 4% formaldehyde solution, then place them in a ventilated place. After the formaldehyde smell dissipates, place the silkworm eggs in a sterilized glass culture dish and place them in a 26 ℃ incubator to accelerate greening. Apply the cell supernatant containing BmCPV-Bt on the sterilized feed: weigh 100 g of feed powder, then add 150 ml of water to dissolve the feed powder, roll the prepared feed into a 2cm×1cm×0.5cm rectangular block, and then apply the cell supernatant containing BmCPV-Bt on its surface, with an application amount of 200 μL / 25 cm 2 , then feed the newly hatched silkworms as usual, and continue feeding until the 3rd instar silkworms wake up. When the silkworms become sick, dissect the midgut (collect the midgut of silkworms infected with BmCPV-Bt) and grind it into a grinding liquid, and purify the BmCPV-Bt virus polyhedron according to the following method.

[0037] (1) Filter the grinding liquid through four layers of gauze to remove larger tissue fragments, collect the filtrate, and repeat the filtration once; (2) Centrifuge at 500 r / min for 5 min and discard the precipitate; (3) Centrifuge at 5000 r / min for 5 min and discard the supernatant; (4) Wash the precipitate with 0.1% SDS, pipette and drain to mix well, centrifuge at 5000 r / min for 5 min, and discard the supernatant: (5) Repeat step (4) and wash away the residual SDS with dd H2O. The white precipitate at the bottom of the tube is the BmCPV-Bt virus polyhedron. Typical polyhedral protein crystals can be observed. Store at 4°C.

[0038] BmCPV-Bt toxicity test: The polyhedral concentration of BmCPV-Bt virus was calculated by using a blood cell counting plate under an optical microscope using two-instar silkworms (cultivar Jingsong, n=55), and then sterile water was added to prepare a BmCPV-Bt polyhedral concentration of 10 6 / ml virus suspension, cut fresh mulberry leaves into 3×3cm size, cut 7 pieces in total, evenly apply 200 μl virus suspension on the back of each mulberry leaf, dry it, starve the larvae for 6 hours before feeding, feed the poisonous leaves for 48 hours continuously, and then change to fresh non-toxic mulberry leaves. After feeding the poisonous leaves, observe and count the number of insects killed by the virus every day; at the same time, set up a normal feeding group, a group fed with the same amount of wild BmCPV, and a group fed with commercial Bacillus thuringiensis as controls.

[0039] The larvae of G. mellonella were raised for 20 days after hatching as the test insects (n=37). 5 g of G. mellonella pellet feed was mixed with 50 μL of 10 6 The larvae were starved for 6 h before feeding, and then fed with the poisoned feed for 48 h before switching to normal pelleted feed. After the poisoned feed treatment, the number of insects killed by the virus was observed and counted daily. At the same time, the wax moths in the normal feeding group, the group fed with the same amount of wild BmCPV, and the group fed with commercial Bacillus thuringiensis were set up as controls.

[0040] Experimental Results 1. Identification of nucleic acid level of recombinant virus BmCPV-Bt Normal BmN cells were inoculated with cell supernatant containing the recombinant virus BmCPV-Bt. After culturing for 10 days, the cell supernatant was collected again, and total RNA was extracted and reverse transcribed. The specific primers Primer-Bt-F / R were used to verify the fusion junction site of S10 and Bt genes. The results of PCR product electrophoresis showed that the specific primers Primer-Bt-F / R could amplify specific bands that met the theoretical value ( Figure 1 ), Sanger sequencing results showed that the sequence at the junction site was consistent with expectations ( Figure 2), indicating that the recombinant virus BmCPV-Bt was obtained in the cells; the sequences of the specific primers Primer-Bt-F / R are shown in Appendix SEQ ID NO:3 and SEQ ID NO:4.

[0041] 2. Identification of protein levels of recombinant virus BmCPV-Bt The midgut of silkworms infected with BmCPV-Bt was collected, and the total protein was extracted. The polyhedral-Bt fusion protein was enriched with BmCPV polyhedral protein antibody, and the enriched protein was routinely identified by mass spectrometry. The secondary mass spectrometry matching map of the protein peptide segment showed that the mass spectrometry identified the specific peptide SNRQMDNN ( Figure 3 ), indicating that the recombinant virus BmCPV-Bt can infect the midgut of silkworm and correctly express the polyhedrin-Bt fusion protein.

[0042] 3. Observation of polyhedron of recombinant virus BmCPV-Bt The polyhedron of the recombinant virus BmCPV-Bt obtained from the midgut of the silkworm was observed under a microscope. The results showed that typical polyhedral protein crystals could be observed ( Figure 4 ).

[0043] 4. Virulence detection of recombinant virus BmCPV-Bt The results of BmCPV-Bt toxicity test showed that 2-year-old silkworms fed with 1.4×10 6 The death rate of silkworms after 6 days of feeding with BmCPV-Bt polyhedrosis was 49, and the survival rate was 10.91%. 6 After 6 days of feeding with wild-type BmCPV polyhedra, 25 silkworms died, and the survival rate was 54.55%; after 6 days of feeding with commercial Bacillus thuringiensis, 39 silkworms died, and the survival rate was 29.09%; after 6 days of feeding with normally raised silkworms, 0 silkworms died, and the survival rate was 100% ( Figure 5 ). Using G. mellonella as the test insect, the results showed that after feeding with BmCPV-Bt polyhedra for 6 days, 30 G. mellonella died, and the survival rate was 18.92%; after feeding with wild-type BmCPV for 6 days, 18 G. mellonella died, and the survival rate was 51.35%; after feeding with commercial Bacillus thuringiensis for 6 days, 24 G. mellonella died, and the survival rate was 35.14%; after 6 days of feeding with normally raised G. mellonella, 0 G. mellonella died, and the survival rate was 100% ( Figure 6 ).

[0044] The sequence of the recombinant plasmid pT-S10-Bt is SEQ ID NO: 1: Example 1 The sequence of the recombinant plasmid pT-S10-Bt is SEQ ID NO: 2: Primers used to detect Bt and S10 linker sequences: SEQ ID NO:3:Primer-Bt-F:agtcattactttgaactacc SEQ ID NO:4: Primer-Bt-R:ttggttcctagcgaattctt.

Claims

1. A method for preparing a CPVs insecticide based on Bombyx mori cytoplasmic polyhedrosis virus, comprising the following steps: (1) The recombinant plasmids pT-S1, pT-S2, pT-S3, pT-S4, pT-S5, pT-S6, pT-S7, pT-S8, and pT-S9 carrying the full-length cDNA of the S1 to S9 fragments of BmCPV, and the plasmid pT-S10-Bt carrying the DNA sequence of the Bt gene fused with the polyhedrin ORF on the S10 fragment of BmCPV were linearized by enzyme digestion to obtain the linearized plasmids of pT-S1 to pT-S9 and pT-S10-Bt; (2) The linearized plasmids pT-S1 to pT-S9 and pT-S10-Bt obtained in step (1) are mixed, and then transfected into host cells expressing T7 RNA polymerase. The cells are then collected and broken, and purified by centrifugation to obtain the recombinant virus BmCPV-Bt; (3) Inoculate silkworm culture cells with the recombinant virus BmCPV-Bt, collect and disrupt the cells after culture to obtain a CPVs insecticide based on the Bombyx mori cytoplasmic polyhedrosis virus; or inoculate silkworms with the recombinant virus BmCPV-Bt, collect the silkworms after disease onset, and homogenize to obtain a CPVs insecticide based on the Bombyx mori cytoplasmic polyhedrosis virus; or feed silkworms with feed containing the recombinant virus BmCPV-Bt until they wake up from sleep, collect the silkworms, and homogenize to obtain a CPVs insecticide based on the Bombyx mori cytoplasmic polyhedrosis virus.

2. The method for preparing the CPVs insecticide based on Bombyx mori cytoplasmic polyhedrosis virus according to claim 1, characterized in that: In step (1), the plasmid vector includes one or more of pIZT-V5 / His vector, pUC series vector, and pBlueScript SK II vector.

3. The method for preparing the CPVs insecticide based on Bombyx mori cytoplasmic polyhedrosis virus according to claim 1, characterized in that: The host cell expressing T7 RNA polymerase is a host culture cell pre-transfected with a recombinant vector pIZT-V5 / His-T7RNApol containing a T7 RNA polymerase gene expression cassette.

4. The method for preparing the CPVs insecticide based on Bombyx mori cytoplasmic polyhedrosis virus according to claim 1, characterized in that: In step (2), the obtained linearized plasmids of pT-S1 to pT-S9 and pT-S10-Bt are mixed in equal moles, and then transfected into host cells expressing T7 RNA polymerase using PEI. The cells are then collected and disrupted, and purified by centrifugation to obtain the recombinant virus BmCPV-Bt.

5. The method for preparing the CPVs insecticide based on Bombyx mori cytoplasmic polyhedrosis virus according to claim 1, characterized in that: In step (3), the recombinant virus BmCPV-Bt is inoculated into cultured silkworm cells, and after culture, the cells are collected, and the cells are disrupted and then subjected to differential centrifugation to obtain polyhedrons encapsulating foreign proteins, which is a CPVs insecticide based on the Bombyx mori cytoplasmic polyhedrosis virus; or, the recombinant virus BmCPV-Bt is inoculated into silkworms, and after disease occurs, the silkworms are collected, homogenized, and then the polyhedrons are purified by differential centrifugation to obtain polyhedrons encapsulating foreign proteins, which is a CPVs insecticide based on the Bombyx mori cytoplasmic polyhedrosis virus; or, feed containing the recombinant virus BmCPV-Bt is fed to ant silkworms, and the feeding is continued until the third instar silkworms wake up, and then the midgut of the silkworms is dissected and homogenized for purification, thereby obtaining a CPVs insecticide based on the Bombyx mori cytoplasmic polyhedrosis virus.

6. A CPVs insecticide based on Bombyx mori cytoplasmic polyhedrosis virus prepared according to the method for preparing a CPVs insecticide based on Bombyx mori cytoplasmic polyhedrosis virus according to claim 1.

7. Use of the CPVs insecticide based on Bombyx mori cytoplasmic polyhedrosis virus according to claim 6 in the preparation of insecticides, or as an insecticide.

8. The use according to claim 7, characterized in that: Pesticides act on crops, or pesticides kill organisms that are harmful to crops.

9. A DNA sequence of a Bt gene fused to the polyhedrin ORF on the BmCPV S10 fragment for preparing the CPVs insecticide based on Bombyx mori cytoplasmic polyhedrosis virus as claimed in claim 6.

10. A method for controlling organisms harmful to crops using the CPVs insecticide based on Bombyx mori cytoplasmic polyhedrosis virus as claimed in claim 6.

Images