Primer for homogenizing sequencing data volume of multi-impurity capture library and application of primer

Abstract

The invention discloses a primer for homogenizing the sequencing data volume of a multi-impurity capture library and application of the primer. The primers comprise an i5-box-wy library building primer, an i7-box-wy library building primer, a P5-box-wy homogenization primer and a P7-box-wy homogenization primer; the i5-box-wy library building primer comprises a sequencing platform sequence linker sequence P5, an Index2 sequence, a sequencing primer complementary sequence and P5-box, and the i7-box-wy library building primer comprises a sequencing platform linker sequence P7, an Index1 sequence, a sequencing primer complementary sequence and P7-box. By adopting library building sequencing, on the premise that the operation difficulty and time of the NGS library building process are not increased, the clinical problem that the library is miscellaneous and the captured data volume is not uniform is solved, the output stability of the data volume of each sample of the captured library is improved, the detection success rate of clinical pathogen capture is improved, and the reagent and time cost of redetection is reduced.

Description

Technical Field

[0001] The invention belongs to the technical field of high-throughput sequencing and relates to a primer for normalizing the sequencing data volume of a multi-hybrid capture library and an application thereof. Background Art

[0002] Next-generation sequencing technology (NGS) is a DNA sequencing technology, also known as high-throughput sequencing technology. High-throughput sequencing technology can sequence millions of random DNA molecules at a time, and can determine the genome or transcriptome sequences of animals, plants, and microorganisms in a relatively short time. In recent years, it has been widely used in the identification of pathogens in the field of infection. Due to the presence of a large amount of human host nucleic acid in clinical samples, the detection sensitivity of NGS is greatly limited. In the past two years, the application of targeted probe hybridization capture enrichment technology has significantly improved the sensitivity of NGS detection of pathogenic microorganisms, thereby improving the clinical application value of NGS detection of pathogenic microorganisms.

[0003] In multi-target hybrid capture, the capture probes often need to reach the million level to achieve wide coverage of the clinical detection range, so the cost is high. In addition, the pathogens infected in clinical samples are relatively simple or even negative, so the utilization rate of the capture probe is low when a single sample is hybridized with the probe (hereinafter referred to as single hybrid capture), resulting in high detection costs and heavy burden on patients. Therefore, hybridization of multiple samples with probes in the same reaction (hereinafter referred to as multi-hybrid capture) is the main way to effectively reduce the detection cost. In multi-hybrid capture, data preemption often occurs due to inaccurate library quantification or differences in pathogen types in clinical samples and differences in abundance of the same pathogen. This causes the number of sequencing sequences of different libraries to fluctuate greatly, so that it is impossible to ensure that the number of sequencing sequences of the samples is sufficient for downstream analysis. For example, in the multi-hybrid of 10 samples, the total number of sequences off the machine is 10M (million), of which sample 1 occupies more than 7M sequences due to the high abundance of pathogens, resulting in the number of sequences of multiple other samples in the same hybridization reaction being unqualified and unable to be analyzed and needing to be re-experimented. Since it is impossible to predict the types and abundance of pathogens in clinical samples, multi-hybrids are greatly troubled in clinical applications.

[0004] Therefore, there is an urgent need to provide a library construction primer and method that can improve the data output stability of each sample in the capture library and ensure uniform data volume of the library. Summary of the invention

[0005] In view of the deficiencies in the prior art and actual needs, the present invention provides a primer for normalizing the sequencing data volume of a multi-hybrid capture library and its application, which solves the problems of strong positives in the multi-hybrid capture pool occupying the data volume and the uneven sample data volume, improves the data volume output stability of each sample in the capture library, improves the success rate of clinical pathogen capture detection, and reduces the reagent and time costs of retesting.

[0006] In order to achieve the purpose of the invention, the present invention adopts the following technical solutions:

[0007] In a first aspect, the present invention provides a library construction primer for normalizing the amount of sequencing data of a multi-hybrid capture library, the library construction primer comprising an i5-box-wy library construction primer, an i7-box-wy library construction primer, a P5-box-wy amplification normalization primer and a P7-box-wy amplification normalization primer; the i5-box-wy library construction primer comprises a sequencing platform sequence adapter sequence P5, an Index2 sequence, a sequencing primer complementary sequence Rd1 SP and a P5 5' end sequence P5-box, the i7-box-wy library construction primer comprises a sequencing platform adapter sequence P7, an Index1 sequence, a sequencing primer complementary sequence Rd2 SP and a P7 5' end sequence P7-box; the P5-box-wy amplification normalization primer is a complementary sequence of P5-box, and the P7-box-wy amplification normalization primer is a complementary sequence of P7-box.

[0008] Without increasing the difficulty and duration of the NGS library construction process, the present invention solves the clinical problem of uneven data volume captured by multiple libraries, improves the data output stability of each sample in the captured library, improves the success rate of clinical pathogen capture detection, and reduces the reagent and time costs of retesting.

[0009] In the present invention, the sequencing primer complementary sequence is complementary to the sequencing primer, and Index1 and Index2 are specific tags for distinguishing different samples, which can theoretically target the sequencing sequence of any sequencing platform.

[0010] The present invention modifies the i5 and i7 long primer sequences of the NGS library, and designs and introduces the P5-box base sequence and the P7-box base sequence at the P5 and P7 ends of the library, respectively. The length of the P5-box base sequence and the P7-box base sequence can be a specific base sequence of 5bp to 50bp randomly combined. The primers are hereinafter referred to as i5-box-wy library construction primers (i5-box-wy) and i7-box-wy library construction primers (i7-box-wy). After three steps of library construction fragmentation, linker index addition, and PCR amplification, each sample library has a specific 5bp to 50bp P5-box and P7-box base sequence at the 5' end before capture, such as Figure 1shown.

[0011] During the Post-PCR of the multi-library capture, the P5-box sequence primer and the P7-box sequence primer are designed for the P5-box specific sequence and the P7-box specific sequence, hereinafter referred to as the P5-box-wy normalized primer (P5-box-wy) and the P7-box-wy normalized primer (P7-box-wy). The P5-box-wy normalized primer (P5-box-wy) and the P7-box-wy normalized primer (P7-box-wy) can specifically anneal with the library with the specific P5-box and P7-box sequences, and each sub-library in the reaction system is amplified separately under the action of its specific primer. When the molar amounts of different P5-box-wy and P7-box-wy normalizing primer pairs are equal, and the amplification of each pair of normalizing primers reaches the plateau phase, since the input molar amounts of different specific P5-box-wy1, 2, 3... and P7-box-wy1, 2, 3... normalizing primers are the same, that is, each sub-library can reach the plateau phase of the PCR reaction at different cycle numbers, the library molar amount or library relative yield between each sub-library is close to the same, then the data amount of the sub-libraries in the same pool can be normalized after sequencing, such as Figure 2 shown.

[0012] SEQ ID NO.1:

[0013] TCCGCACAAGCACCATTGTAAATGATACGGCGACCACCGAGATCTACACTCTATGACTCGTCGGCAGCGTC.

[0014] SEQ ID NO.2:

[0015] CGGAATGGAGCCTGATCCAGAATGATACGGCGACCACCGAGATCTACACACCGTACTTCGTCGGCAGCGTC.

[0016] SEQ ID NO.3:

[0017] AGTGCCGCTGGTTCGTATACAATGATACGGCGACCACCGAGATCTACACGTCGACAGTCGTCGGCAGCGTC.

[0018] SEQ ID NO.4:

[0019] ACCATTACGTGCGCTACCAAAATGATACGGCGACCACCGAGATCTACACAGCAGCTTTCGTCGGCAGCGTC。

[0020] SEQ ID NO.5:

[0021] ACTGGTAGCACACTTCGCTGAATGATACGGCGACCACCGAGATCTACACAGTCGTACTCGTCGGCAGCGTC。

[0022] SEQ ID NO.6:

[0023] GAACTCAGTCATGCTCGCTCAATGATACGGCGACCACCGAGATCTACACTAATGGCCTCGTCGGCAGCGTC。

[0024] SEQ ID NO.7:

[0025] GTTCAGCCGAACGTAATCGCAATGATACGGCGACCACCGAGATCTACACCGAACGTATCGTCGGCAGCGTC。

[0026] SEQ ID NO.8:

[0027] GGTCTAACGGCGATCTCCTGAATGATACGGCGACCACCGAGATCTACACCAGTAAGGTCGTCGGCAGCGTC。

[0028] SEQ ID NO.9:

[0029] CCGCACTAGAGACACAGTGCCAAGCAGAAGACGGCATACGAGATGCCATCAAGTCTCGTGGGCTCGG。

[0030] SEQ ID NO.10:

[0031] GAGCCCTAGCACCAGTGACCAAGCAGAAGACGGCATACGAGATATTGAGTCGTCTCGTGGGCTCGG。

[0032] SEQ ID NO.11:

[0033] GCGTGTCTCTCGTTGGAGACCAAGCAGAAGACGGCATACGAGATCATTCGCAGTCTCGTGGGCTCGG.

[0034] SEQ ID NO.12:

[0035] CAGAGCGATACCTCGACAGACAAGCAGAAGACGGCATACGAGATGAAGGTACGT CTCGTGGGCTCGG.

[0036] SEQ ID NO.13:

[0037] CGGTCTCACTGATAGCCCATCAAGCAGAAGACGGCATACGAGATAACCTAAGGTCTCGTGGGCTCGG.

[0038] SEQ ID NO.14:

[0039] CGCTGGGACTTGTACGGTTACAAGCAGAAGACGGCATACGAGATACAGCAGGGT CTCGTGGGCTCGG.

[0040] SEQ ID NO.15:

[0041] CAGCGATCTGTCTCCATGTCAAGCAGAAGACGGCATACGAGATCTAACGCTGTCTCGTGGGCTCGG.

[0042] SEQ ID NO.16:

[0043] CTGCCTAATCTGCAGTCGCACAAGCAGAAGACGGCATACGAGATTGGTAACGGTCTCGTGGGCTCGG.

[0044] Preferably, the P5 5' end sequence P5-box and the P7 5' end sequence P7-box are each independently a specific base sequence of 5bp to 50bp randomly combined (eg, 5bp, 10bp, 20bp, 40bp, 50bp), and the structural types include but are not limited to linear, hairpin, Ω and Y-shaped structures.

[0045] Preferably, the nucleic acid sequence of the i5-box-wy library construction primer includes the sequence shown in SEQ ID NO.1-SEQ ID NO.8, and the i7-box-wy library construction primer includes the sequence shown in SEQ ID NO.9-SEQ ID NO.16.

[0046] In a second aspect, the present invention provides a kit for normalizing the amount of sequencing data of a multi-hybrid capture library, the kit containing the i5-box-wy library construction primer and the i7-box-wy library construction primer described in the first aspect.

[0047] In a third aspect, the present invention provides use of the i5-box-wy library construction primer and the i7-box-wy library construction primer described in the first aspect in preparing reagents for library construction.

[0048] In a fourth aspect, the present invention provides a library construction method for normalizing the amount of capture library sequencing data, the method comprising the following steps:

[0049] (1) nucleic acid fragmentation, un-repairing, ligation, adding adapters and library amplification, wherein the library amplification system comprises the i5-box-wy library construction primer and the i7-box-wy library construction primer described in the first aspect;

[0050] (2) Multi-library hybridization, multi-library capture and multi-capture library normalization amplification, wherein the multi-capture library normalization amplification system contains the P5-box-wy normalization primer and the P7-box-wy normalization primer described in the first aspect.

[0051] Preferably, the nucleic acid fragmentation comprises mechanical shearing and / or enzymatic shearing.

[0052] Preferably, the initial input amount of nucleic acid for enzymatic shearing is 100 pg to 50 ng (eg, 100 pg, 200 pg, 400 pg, 600 pg, 1 ng, 5 ng, 40 ng, 50 ng).

[0053] Preferably, the enzymatic disruption reaction system contains fragmentation and unfragmentation enzymes and nucleic acids.

[0054] In one embodiment of the present invention, the reaction system for enzymatic disruption is 50 μL, which contains 8 μL of fragmentation enzyme and 42 μL of nucleic acid.

[0055] Preferably, the reaction procedure of the enzymatic interruption includes: maintaining at 2-6°C (e.g., 2°C, 4°C, 6°C) for 0.5-2 min (e.g., 0.5 min, 1 min, 2 min); maintaining at 28-32°C (e.g., 28°C, 30°C, 32°C) for 5-30 min (e.g., 5 min, 10 min, 20 min); maintaining at 70-74°C (e.g., 70°C, 72°C, 74°C) for 5-30 min (e.g., 5 min, 10 min, 30 min); maintaining at 2-6°C (e.g., 2°C, 4°C, 6°C).

[0056] Preferably, the reaction system for ligation and linker addition contains a ligation buffer, a ligase, a short linker and fragmented unrepaired products.

[0057] In one embodiment of the present invention, the reaction system of ligation and linker addition is 80 μL, which contains 25 μL ligation buffer, 3 μL ligase, 2 μL short linker and 50 μL fragmented unrepaired product.

[0058] Preferably, the final concentration of the short linker is 0.1-5 μM (eg, 0.1 μM, 0.5 μM, 2 μM, 5 μM).

[0059] In the present invention, the nucleic acid to which the linker has been added can be purified using 0.5×-0.8× (eg, 0.5×, 0.6×, 0.8×) magnetic beads.

[0060] Preferably, the reaction procedure of the ligation and linking includes: maintaining at 15-22°C (e.g., 15°C, 20°C, 22°C) for 5-30 min (e.g., 5 min, 10 min, 30 min); maintaining at 2-6°C (e.g., 2°C, 4°C, 6°C).

[0061] Preferably, the reaction system for library amplification contains a product with an adapter, a high-fidelity hot start enzyme mixture, an i5-box-wy library construction primer and an i7-box-wy library construction primer.

[0062] In one embodiment of the present invention, the reaction system for library amplification is 50 μL, which contains 20 μL of product with adapters, 25 μL of high-fidelity hot start enzyme, 2.5 μL of i5-box-wy library construction primer and 2.5 μL of i7-box-wy library construction primer.

[0063] Preferably, the final concentration of the i5-box-wy library construction primer is 5 to 20 μM (eg, 5 μM, 10 μM, 20 μM).

[0064] Preferably, the final concentration of the i7-box-wy library construction primer is 5 to 20 μM (eg, 5 μM, 10 μM, 20 μM).

[0065] Preferably, the reaction procedure for library amplification includes: 93-95°C (e.g., 93°C, 94°C, 95°C) for 0.5-2 min (e.g., 0.5 min, 1 min, 2 min); 96-98°C (e.g., 96°C, 97°C, 98°C) for 5-15 s (e.g., 5s, 10s, 15s), 58-60°C (e.g., 58°C, 59°C, 60°C) for 25-35 s (e.g., 25s, 30s, 35s), 70-72°C (e.g., 70°C, 71°C, 72°C) for 25-35 s (e.g., 25s, 30s, 35s), and cycled 8-20 times (e.g., 8 times, 10 times, 20 times); 70-72°C (e.g., 70°C, 71°C, 72°C) for 0.5-2 min (e.g., 0.5 min, 1 min, 2 min).

[0066] In one embodiment of the present invention, the reaction system for hybridization of the multi-library contains sub-libraries, probes, a specific linker Blocker, cot1 DNA, a hybridization buffer and a hybridization enhancer.

[0067] In one embodiment of the present invention, the reaction system for the multi-library hybridization is 50 μL, which contains 50-1000 ng of sub-library, 2 μL of probe, 2 μL of specific linker Blocker, 5 μL of cot1 DNA, 20 μL of hybridization buffer and 30 μL of hybridization enhancer.

[0068] Preferably, the reaction procedure for hybridization of the polyhybrid library includes: 93-95°C (e.g., 93°C, 94°C, 95°C) for 0.5-5 min (e.g., 0.5 min, 1 min, 5 min); 58-60°C (e.g., 58°C, 59°C, 60°C) for 0.25-1 h (e.g., 0.25 h, 0.5 h, 1 h).

[0069] Preferably, the reaction system for multi-library capture contains multi-library hybridization products and streptavidin magnetic bead suspension.

[0070] In one embodiment of the present invention, the reaction system for multi-hybrid library capture is 150 μL, which contains 50 μL of multi-hybrid library hybridization products and 100 μL of streptavidin magnetic bead suspension.

[0071] Preferably, the reaction procedure for the multi-hybrid library capture includes: maintaining at 60-65°C (e.g., 60°C, 63°C, 65°C) for 10-45min (e.g., 10min, 20min, 40min), and vortex mixing every 5-10min (e.g., 5min, 8min, 10min) during the reaction.

[0072] Preferably, the reaction system for the homogenized amplification of the heterogeneous capture library comprises: a magnetic bead suspension, a high-fidelity hot start enzyme mixture, a P5-box-wy homogenized primer and a P7-box-wy homogenized primer.

[0073] Preferably, the nucleic acid sequence of the P5-box-wy normalization primer includes the sequences shown in SEQ ID NO.17-SEQ ID NO.24.

[0074] Preferably, the nucleic acid sequence of the P7-box-wy normalization primer includes the sequences shown in SEQ ID NO.25-SEQ ID NO.32.

[0075] SEQ ID NO. 17: TCCGCACAAGCACCATTGTA.

[0076] SEQ ID NO. 18: CGGAATGGAGCCTGATCCAG.

[0077] SEQ ID NO. 19: AGTGCCGCTGGTTCGTATAC.

[0078] SEQ ID NO. 20: ACCATTACGTGCGCTACCAA.

[0079] SEQ ID NO. 21: ACTGGTAGCACACTTCGCTG.

[0080] SEQ ID NO. 22: GAACTCAGTCATGCTCGCTC.

[0081] SEQ ID NO. 23: GTTCAGCCGAACGTAATCGC.

[0082] SEQ ID NO. 24: GGTCTAACGGCGATCTCCTG.

[0083] SEQ ID NO. 25: CCGCACTAGAGACACAGTGC.

[0084] SEQ ID NO. 26: GAGCCCTAGCACCAGTGAC.

[0085] SEQ ID NO. 27: GCGGTGTCTCTCGTTGGAGAC.

[0086] SEQ ID NO. 28: CAGAGCGATACCTCGACAGA.

[0087] SEQ ID NO. 29: CAGAGCGATACCTCGACAGA.

[0088] SEQ ID NO. 30: CGCTGGGACTTGTACGGTTA.

[0089] SEQ ID NO. 31: CAGCGATCTGTCCTCCATGT.

[0090] SEQ ID NO. 32: CTGCCTAATCTGCAGTCGCA.

[0091] Preferably, the concentration of the P5-box-wy normalized primer is 0.01 to 10 μM (eg, 0.01 μM, 0.02 μM, 0.04 μM, 0.1 μM, 0.5 μM, 1 μM, 5 μM, 8 μM, 10 μM).

[0092] Preferably, the concentration of the P7-box-wy normalized primer is 0.01 to 10 μM (eg, 0.01 μM, 0.02 μM, 0.04 μM, 0.1 μM, 0.5 μM, 1 μM, 5 μM, 8 μM, 10 μM).

[0093] Preferably, the method for preparing the magnetic bead suspension comprises: washing the streptavidin magnetic beads by incubation with a preheated nucleic acid washing solution and then resuspending the streptavidin magnetic beads with nuclease-free water.

[0094] Preferably, the preheating temperature is 40-70°C (eg, 40°C, 50°C, 70°C).

[0095] Preferably, the incubation time is 1 to 5 min (eg, 1 min, 3 min, 5 min).

[0096] Preferably, the cleaning is performed 2-5 times (eg, 2 times, 3 times, 5 times).

[0097] In one embodiment of the present invention, the reaction system for the normalized amplification of the polyheterogeneous capture library is 25 μL, which contains 10 μL of magnetic bead suspension, 12.5 μL of high-fidelity hot start enzyme mixture, 1.25 μL of P5-box-wy normalized primer and 1.25 μL of P7-box-wy normalized primer.

[0098] Preferably, the reaction procedure for the homogenized amplification of the heterogeneous capture library includes: maintaining at 93-95°C (e.g., 93°C, 94°C, 95°C) for 0.5-2 min (e.g., 0.5 min, 1 min, 2 min); maintaining at 96-98°C (e.g., 96°C, 97°C, 98°C) for 5-15 s (e.g., 5s, 10s, 15s), maintaining at 58-60°C (e.g., 58°C, 59°C, 60°C) for 25-35 s (e.g., 25s, 30s, 35s), maintaining at 70-72°C (e.g., 70°C, 71°C, 72°C) for 25-35 s (e.g., 25s, 30s, 35s), and cycling 8-40 times (e.g., 8 times, 10 times, 20 times, 40 times); maintaining at 70-72°C (e.g., 70°C, 71°C, 72°C) for 0.5-2 min (e.g., 0.5 min, 1 min, 2 min).

[0099] Compared with the prior art, the present invention has the following beneficial effects:

[0100] Without increasing the difficulty and duration of the NGS library construction process, the present invention solves the clinical problem of uneven data volume captured by multiple libraries, improves the data output stability of each sample in the captured library, improves the success rate of clinical pathogen capture detection, and reduces the reagent and time costs of retesting. BRIEF DESCRIPTION OF THE DRAWINGS

[0101] Figure 1 Schematic diagram of library construction primers, normalized primer design and adapter library structure;

[0102] Figure 2 Schematic diagram of the restriction homogenization amplification principle. DETAILED DESCRIPTION

[0103] To further illustrate the technical means and effects of the present invention, the present invention is further described below in conjunction with the embodiments and drawings. It should be understood that the specific implementation methods described herein are only used to explain the present invention, rather than to limit the present invention.

[0104] If no specific techniques or conditions are specified in the examples, the techniques or conditions described in the literature in the field or the product instructions are used. If no manufacturer is specified for the reagents or instruments used, they are all conventional products that can be purchased through regular channels.

[0105] Example 1

[0106] Preparation of primers for library construction and amplification normalization primers.

[0107] This example uses 8 hybrid libraries, library construction and sequencing on the Illumina sequencing platform as examples for explanation.

[0108] (1) Taking the 8-hybrid capture library as an example, the downstream primers were synthesized by Shanghai Sangon Biotechnology Co., Ltd. and the dissolved concentration was 100 μM; the library primer sequences were for the Illumina sequencing platform, as shown in Table 1.

[0109] Table 1

[0110]

[0111]

[0112]

[0113] (2) Preparation of downstream primers: i5-box-wy and i7-box-wy primers were diluted to 10 μM with nuclease-free water for later use; 8 P5-box-wy primers were mixed in equal volumes and each primer was diluted to 1 μM with nuclease-free water to obtain 1 μM P5-box-wy uniform primers; 8 P7-box-wy primers were mixed in equal volumes and each primer was diluted to 1 μM with nuclease-free water to obtain 1 μM P7-box-wy uniform primers.

[0114] Example 2

[0115] Library construction technology to normalize the amount of sequencing data from heterogeneous capture libraries (simulated capture followed by normalized amplification).

[0116] This embodiment is described by taking the library construction of the Illumina sequencing platform, the simulated capture after library construction and the normalized amplification, and the sequencing of the simulated capture pool after normalization as an example.

[0117] (1) Nucleic acid fragmentation and unrepairing

[0118] The nucleic acid was fragmented by enzyme method. Eight DNA nucleic acid samples with different pathogen abundance were taken, with an input amount of 10 ng of DNA nucleic acid. The shearing and unrepairing system was a 50 μL reaction system. 8 μL of fragmentation and unrepairing enzymes were added in sequence as required. The total volume of nucleic acid was 42 μL and the samples were placed in a PCR instrument for reaction. The reaction procedure was: 4°C for 1 min, 30°C for 5 min, 72°C for 20 min, and 4°C.

[0119] (2) Connector connection

[0120] The ligation and adapter system is an 80μL reaction system. Add 25μL of ligation buffer, 3μL of ligase, 2μL of 0.25μM short adapter, and 50μL of fragmented unrepaired product in sequence as required, and place it in a PCR instrument for reaction; the reaction procedure is: keep at 20℃ for 15min, and keep at 4℃; the nucleic acid with added adapters needs to be purified with 0.6× magnetic beads and eluted with 20μL of nuclease-free water.

[0121] (3) Library amplification

[0122] The library amplification system was a 50 μL reaction system, with 20 μL of the product with the adapter, 25 μL of KAPA HiFi Ready Mix, 2.5 μL of 10 μM i5-box-wy primer, and 2.5 μL of 10 μM i7-box-wy primer. The mixture was mixed evenly and placed in a PCR instrument for reaction. The reaction procedure was: 95°C for 1 min; 98°C for 15 s, 60°C for 30 s, 72°C for 30 s, 15 cycles, and 72°C for 1 min. After the library was purified with magnetic beads, Qubit was used to quantify the library.

[0123] (4) Simulated capture followed by homogenized amplification

[0124] The eight constructed library samples 1 to 8 were pooled according to Table 2, and the simulated library of the pool was diluted to 0.1 ng / μL, and the obtained library was simulated after capture. The PP5 / PP7 universal amplification primer and the P5 / P7-box-wy normalized amplification primer were used to simulate post-PCR respectively; the universal primer PP5 / PP7 was amplified into 25 μL, and the reaction system was: 10 μL simulated library after capture, KAPA HiFi Ready Mix 12.5 μL, 10 μM PP5 primer 1.25 μL, 10 μM PP7 primer 1.25 μL, mixed evenly, and placed in a PCR instrument for reaction. The reaction program was: 95°C 1 min; 98°C 15 s, 60°C 30 s, 72°C 30 s, 13 cycles, 72°C 1 min; P5 / P7-box-wy normalized amplification was 25 μL, and the reaction system was: 10 μL magnetic bead suspension, KAPA HiFi Ready Mix 12.5μL, 1μM P5-box-wy normalized primer 1.25μL, 1μM P7-box-wy normalized primer 1.25μL, mixed evenly, placed in a PCR instrument for reaction, the reaction program is: 95℃1min; 98℃15s, 60℃30s, 72℃30s, 25 cycles; 72℃1min. The amplified product was purified with purification magnetic beads, diluted, denatured and sequenced with Illumina MiniSeq. The sequencing results are shown in Table 2.

[0125] Table 2

[0126]

[0127] The results show that when there are strong positive samples such as sample 1, sample 2, and sample 4 in the simulation pool, the traditional universal primer post-PCR sequencing results are used to capture the data volume of the pool. When the data volume is corrected to 8M, the data volume allocated to each sample in the same pool varies greatly, the ratio of the maximum data volume to the minimum data volume is as high as 49.41 times, and the average data volume deviation reaches 93.33%; while the sequencing results of the P5 / P7-box-wy normalized amplification primer post-PCR of the present invention, the data volume allocated to each sample in the same pool differs less, the ratio of the maximum data volume to the minimum data volume is 1.37 times, and the average data volume deviation reaches 8.62%, which greatly reduces the risk of unqualified data volume captured in the same pool.

[0128] Example 3

[0129] Application of the present invention in sequencing detection of multi-homogeneous captured pathogens (comparative analysis with conventional capture library construction).

[0130] Clinical pathogen sequencing involves a variety of clinical sample types, including peripheral blood, alveolar lavage fluid, cerebrospinal fluid, tissue, etc. The abundance of pathogens contained in different sample types varies greatly. Conventional multi-complex capture has a high frequency of strong positive preemption, and the frequency of re-testing with unqualified data volume is high, and the detection cycle is extended during re-testing.

[0131] This embodiment takes the construction of a library on an Illumina sequencing platform, hybridization capture after library construction, uniform amplification after capture, and sequencing of the captured pool as an example for explanation.

[0132] (1) Nucleic acid fragmentation and unrepairing

[0133] The nucleic acid was fragmented by enzyme method. A total of 8 samples were taken, including 2 alveolar lavage fluids, 2 peripheral bloods, 2 cerebrospinal fluids, and 2 tissues, and their DNA nucleic acids were extracted. After the nucleic acid extraction was completed, 10 ng of DNA nucleic acid was taken, and 42 μL was added for the less than 10 ng. The fragmentation and final repair system was a 50 μL reaction system. 8 μL of fragmentation and final repair enzymes were added in sequence as required, and the total volume of nucleic acid was 42 μL, and it was placed in a PCR instrument for reaction; the reaction procedure was: 4℃1min, 30℃5min, 72℃20min, and maintained at 4℃.

[0134] (2) Connector connection

[0135] The ligation and adapter system is an 80μL reaction system. Add 25μL of ligation buffer, 3μL of ligase, 2μL of 0.25μM short adapter, and 50μL of fragmented unrepaired product in sequence as required, and place it in a PCR instrument for reaction; the reaction procedure is: 20℃15min, maintain at 4℃; the nucleic acid with added adapters needs to be purified with 0.6× magnetic beads and eluted with 20μL of nuclease-free water.

[0136] (3) Library amplification

[0137] The library amplification system is a 50μL reaction system, with 20μL of the product with the adapter, 25μL of KAPAHiFi Ready Mix, 2.5μL of 10μM i5-box-wy primer, and 2.5μL of 10μM i7-box-wy primer. Mix them evenly and place them in a PCR instrument for reaction. The reaction program is: 95℃1min; 98℃15s, 60℃30s, 72℃30s, 15 cycles; 72℃1min; after the library is purified by magnetic beads, Qubit is used to quantify the library.

[0138] (4) Library hybridization

[0139] The hybridization system of the multi-library is a 50μL reaction system: 500ng of each sub-library, 2μL of 0.2fmol / μL probe, 2μL of 500μM specific adapter Blocker, 5μL of 1mg cot1 DNA, and concentrated dry powder after pooling into the same capture pool; concentrated library probe group dry powder; 20μL of hybridization buffer and 30μL of hybridization enhancer, mix well to remove bubbles, and place in a PCR instrument for reaction; the reaction program is: 95℃5min, 60℃30min.

[0140] (5) Library capture

[0141] The multi-hybrid library capture system is a 150 μL reaction system: 50 μL of library hybridization product and 100 μL of streptavidin magnetic bead suspension are mixed evenly and placed in a PCR instrument for reaction. The reaction procedure is: 65°C for 30 min, vortex mixing every 10 min during the reaction; incubate and wash 4 times with 65°C preheated nucleic acid washing solution, each incubation at 65°C for 5 min; finally, resuspend the streptavidin magnetic beads with 11 μL of nuclease-free water to obtain a magnetic bead suspension.

[0142] (6) Capture library homogenization amplification

[0143] The multi-hybrid capture library was amplified in a 25 μL reaction system: 10 μL of magnetic bead suspension, 12.5 μL of KAPA HiFi ReadyMix, 1.25 μL of 1 μM P5-box-wy normalization primer, and 1.25 μL of 1 μM P7-box-wy normalization primer. The mixture was mixed evenly and placed in a PCR instrument for reaction. The reaction program was: 95°C for 1 min; 98°C for 15 s, 60°C for 30 s, 72°C for 30 s, 25 cycles; 72°C for 1 min. The amplified product was purified with purified magnetic beads, diluted, denatured, and sequenced with Illumina MiniSeq. The sequencing results are shown in Table 3.

[0144] Table 3

[0145]

[0146]

[0147] The results show that when there are strong positive pathogens in the bronchoalveolar lavage fluid of clinical samples, when the traditional universal primer post-PCR sequencing results are used and the capture pool data volume is corrected to 8M, the data volume allocated to each sample in the same pool varies greatly, the ratio of the maximum data volume to the minimum data volume is as high as 69.5 times, and the average data volume deviation reaches 88.28%; while using the P5 / P7-box-wy normalized amplification primer post-PCR sequencing results of the present invention, the data volume allocated to each sample in the same pool differs less, the ratio of the maximum data volume to the minimum data volume is as high as 1.73 times, and the average data volume deviation is only 11.84%, which greatly reduces the risk of unqualified data volume captured in the same pool.

[0148] In summary, the present invention solves the clinical problem of uneven data volume captured by multiple libraries without increasing the difficulty and duration of the NGS library construction process, improves the data output stability of each sample in the capture library, improves the success rate of clinical pathogen capture detection, and reduces the reagent and time costs of retesting.

[0149] The applicant declares that the protection point of the present invention is the joint structure. The present invention illustrates the detailed method of the present invention through the above-mentioned embodiments, but the present invention is not limited to the above-mentioned detailed method, that is, it does not mean that the present invention must rely on the above-mentioned detailed method to be implemented. Those skilled in the art should understand that any improvement to the joint structure of the present invention, not limited to linear, hairpin, Ω, Y-shaped and other structures, the product sequence of the present invention, the equivalent replacement of each raw material and the addition of auxiliary components, the selection of specific methods, etc., all fall within the protection scope and disclosure scope of the present invention.

Claims

1. A library construction primer for normalizing the amount of sequencing data of a heterogeneous capture library, characterized in that: The library construction primers include i5-box-wy library construction primer, i7-box-wy library construction primer, P5-box-wy normalization primer and P7-box-wy normalization primer; The i5-box-wy library construction primer includes a sequencing platform sequence adapter sequence P5, an Index2 sequence, a sequencing primer complementary sequence Rd1 SP, and a P5 5' end sequence P5-box; the i7-box-wy library construction primer includes a sequencing platform adapter sequence P7, an Index1 sequence, a sequencing primer complementary sequence Rd2 SP, and a P7 5' end sequence P7-box; The normalized primer P5-box-wy is a complementary sequence to P5-box, and the normalized primer P7-box-wy is a complementary sequence to P7-box.

2. The library construction primer according to claim 1, characterized in that The P5 5' end sequence P5-box and the P7 5' end sequence P7-box are each independently a specific base sequence of 5 bp to 50 bp randomly combined, and the structural types include but are not limited to linear, hairpin, Ω and Y-shaped structures.

3. The library construction primer according to claim 1 or 2, characterized in that The nucleic acid sequence of the i5-box-wy library construction primer includes the sequence shown in SEQ ID NO.1-SEQ ID NO.8, and the i7-box-wy library construction primer includes the sequence shown in SEQ ID NO.9-SEQ ID NO.

16.

4. A kit for normalizing the amount of sequencing data of a heterogeneous capture library, characterized in that: The kit contains the i5-box-wy library construction primer and the i7-box-wy library construction primer according to any one of claims 1 to 3.

5. Use of the i5-box-wy library construction primer and the i7-box-wy library construction primer according to any one of claims 1 to 3 in preparing reagents for library construction.

6. A library construction method for normalizing the amount of sequencing data of a capture library, characterized in that: The method comprises the following steps: (1) nucleic acid fragmentation, un-repairing, ligation, adding adapters and library amplification, wherein the library amplification system comprises the i5-box-wy library construction primer and the i7-box-wy library construction primer described in any one of claims 1 to 3; (2) Multi-library hybridization, multi-library capture and multi-capture library normalization amplification, wherein the multi-capture library normalization amplification system contains the P5-box-wy normalization primer and the P7-box-wy normalization primer described in claim 1.

7. The method according to claim 6, characterized in that The nucleic acid fragmentation comprises mechanical shearing and / or enzymatic shearing; Preferably, the initial nucleic acid input amount for the enzymatic shearing is 100 pg to 50 ng; Preferably, the enzymatic disruption reaction system contains fragmentation and unfragmentation enzymes and nucleic acids; Preferably, the reaction procedure of the enzymatic interruption includes: maintaining at 2-6°C for 0.5-2 min; maintaining at 28-32°C for 5-30 min; maintaining at 70-74°C for 5-30 min; maintaining at 2-6°C; Preferably, the reaction system for ligation and linker addition contains a ligation buffer, a ligase, a short linker and a fragmented unrepaired product; Preferably, the final concentration of the short linker is 0.1 to 5 μM; Preferably, the reaction procedure of the ligation and linking comprises: maintaining at 15-22°C for 5-30 min; maintaining at 2-6°C.

8. The method according to claim 6 or 7, characterized in that: The reaction system for library amplification contains the product with the adapter, a high-fidelity hot start enzyme mixture, i5-box-wy library construction primers and i7-box-wy library construction primers; Preferably, the final concentration of the i5-box-wy library construction primer is 5 to 20 μM; Preferably, the final concentration of the i7-box-wy library construction primer is 5 to 20 μM; Preferably, the reaction procedure for library amplification includes: 93-95°C for 0.5-2 min; 96-98°C for 5-15 s, 58-60°C for 25-35 s, 70-72°C for 25-35 s, and 8-20 cycles; 70-72°C for 0.5-2 min.

9. The method according to any one of claims 6 to 8, characterized in that: The reaction procedure of the multi-hybrid library hybridization includes: maintaining at 93-95° C. for 0.5-5 min; maintaining at 58-60° C. for 0.25-1 h; Preferably, the reaction system for multi-library capture contains multi-library hybridization products and streptavidin magnetic bead suspension; Preferably, the reaction procedure of the multi-hybrid library capture includes: maintaining at 60-65° C. for 10-45 min, and vortex mixing every 5-10 min during the reaction.

10. The method according to any one of claims 6 to 9, characterized in that: The reaction system for the homogenized amplification of the heterogeneous capture library comprises: a magnetic bead suspension, a high-fidelity hot start enzyme mixture, a P5-box-wy homogenized primer and a P7-box-wy homogenized primer; Preferably, the nucleic acid sequence of the P5-box-wy normalization primer includes the sequences shown in SEQ ID NO.17-SEQ ID NO.24; Preferably, the nucleic acid sequence of the P7-box-wy normalization primer includes the sequences shown in SEQ ID NO.25-SEQ ID NO.32; Preferably, the concentration of the P5-box-wy normalized primer is 0.01 to 10 μM; Preferably, the concentration of the P7-box-wy normalized primer is 0.01 to 10 μM; Preferably, the method for preparing the magnetic bead suspension comprises: washing the streptavidin magnetic beads by incubation with a preheated nucleic acid washing solution and then resuspending the streptavidin magnetic beads with nuclease-free water; Preferably, the preheating temperature is 40-70°C; Preferably, the incubation time is 1 to 5 minutes; Preferably, the cleaning is performed 2-5 times; Preferably, the reaction procedure for homogenized amplification of the heterogeneous capture library includes: maintaining at 93-95°C for 0.5-2 min; maintaining at 96-98°C for 5-15 s, maintaining at 58-60°C for 25-35 s, maintaining at 70-72°C for 25-35 s, and cycling for 8-40 times; maintaining at 70-72°C for 0.5-2 min.

Images