SNP (Single Nucleotide Polymorphism) molecular marker related to chest circumference of sheep and application of SNP molecular marker

Abstract

The invention relates to the technical field of molecular marker breeding, in particular to an SNP molecular marker related to the chest circumference of sheep and application of the SNP molecular marker. The SNP molecular marker provided by the invention is located at a basic group at the 809349599bp site on the No.10 chromosome of which the genomic sequence information of the sheep is ovisariesrambiiil1.0, and has A / G polymorphism. The SNP molecular marker related to the chest circumference of the sheep disclosed by the invention can explain 23.58% of chest circumference variance variation. Although the chest circumference is controlled by multiple genes, the SNP molecular marker still has a great effect. In the breeding process, AA genotype sheep is selected for variety preservation, the AA genotype is used for breeding, and G allelic genes need to be excluded when the AA genotype sheep are hybridized with other sheep. Especially, the semen of the AA genotype rams is used for artificial insemination, the breeding efficiency can be greatly improved, and the sheep flock with the chest circumference advantage can be obtained.

Description

Technical Field

[0001] The invention relates to the technical field of molecular marker breeding, and in particular to a SNP molecular marker associated with sheep chest circumference and an application thereof. Background Art

[0002] The chest circumference of sheep is one of the important indicators to measure their growth and development. This important indicator is closely related to their meat production. Generally speaking, sheep with larger chest circumference have larger bodies and more muscles, so their meat production is also higher. By measuring the chest circumference, the meat production performance of sheep can be predicted, which provides an important reference for the chest circumference trait in meat production and sheep breeding, and is widely used in genetic evaluation. By selecting sheep with excellent chest circumference traits as breeding sheep, the growth and development level and production performance of offspring can be improved. The high genetic stability of the chest circumference trait means that the chest circumference and overall growth performance of sheep can be continuously improved through genetic improvement.

[0003] At present, the cost of molecular marker detection has been greatly reduced through advanced molecular marker technology. KASP (Kompetitive Allele-Specific PCR), competitive allele-specific PCR, can accurately detect SNPs. It is a high-throughput, low-cost, low-error rate SNP typing technology that can achieve automated and platform-based operations.

[0004] Through SNP typing technology, genetic markers related to sheep chest girth traits can be identified. These genetic markers can be used to assist in the selection of sheep with excellent chest girth traits, thereby accelerating the breeding process and improving breeding efficiency. However, sheep chest girth is controlled by multiple genes, and there is currently a lack of SNP sites related to sheep chest girth. Summary of the invention

[0005] In order to solve the above problems, the present invention provides a SNP molecular marker related to sheep chest circumference and its application. The SNP molecular marker provided by the present invention is significantly correlated with the chest circumference of sheep, can explain 23.58% of the variance of chest circumference, has a large effect, and can be used to identify or assist in identifying the chest circumference of sheep.

[0006] In order to achieve the above object, the present invention provides the following technical solutions:

[0007] The invention provides a SNP molecular marker associated with sheep chest circumference. The SNP molecular marker is located at the 80934959 bp base on chromosome 10 with sheep genome sequence information of ovis_aries_rambouillet_1.0, and has A / G polymorphism.

[0008] Preferably, the nucleotide sequence of the SNP molecular marker is as shown in SEQ ID NO.1, wherein R is A or G.

[0009] The present invention provides a primer set for detecting the SNP molecular marker described in the above technical solution, comprising: F1, F2 and R; the nucleotide sequence of F1 is shown in SEQ ID NO.2, the nucleotide sequence of F2 is shown in SEQ ID NO.3, and the nucleotide sequence of R is shown in SEQ ID NO.4; F1 and F2 are marked with different fluorescent groups.

[0010] Preferably, the fluorescent group includes FAM, VIC or HEX.

[0011] Preferably, the F1 is labeled with a fluorescent group VIC, and the F2 is labeled with a fluorescent group FAM.

[0012] The present invention provides the use of the SNP molecular marker described in the above technical solution or the primer set described in the above technical solution in identifying or assisting in identifying the chest circumference size of sheep.

[0013] The present invention provides the use of the SNP molecular marker described in the above technical solution or the primer set described in the above technical solution in sheep breeding, wherein the breeding includes breeding sheep with relatively large chest circumference.

[0014] Preferably, the sheep are Bamberg sheep.

[0015] Preferably, the sheep whose genotype of the SNP molecular marker is AA are sheep with relatively large chest circumference.

[0016] The present invention provides a method for identifying or assisting in identifying the chest circumference of a sheep, comprising the following steps:

[0017] Using the genomic DNA of the sheep to be tested as a template, PCR amplification is performed using the primer set described in the above technical solution to obtain an amplified product; determining the genotype of the sheep to be tested based on the fluorescent group on the amplified product;

[0018] If the amplified product contains only the fluorescent group labeled F1, the genotype of the sheep to be tested is GG;

[0019] If the amplified product contains only the fluorescent group labeled F2, the genotype of the sheep to be tested is AA;

[0020] If the amplified product contains fluorescent groups labeled with F1 and F2, the genotype of the sheep to be tested is GA;

[0021] The chest circumference of the sheep to be tested is determined according to the genotype of the sheep to be tested: the sheep with the genotype of AA is a sheep with a relatively large chest circumference.

[0022] Beneficial effects:

[0023] The present invention provides a SNP molecular marker for identifying or assisting in identifying the chest circumference size of sheep. The SNP molecular marker is located at the 80934959bp base on chromosome 10 of the sheep genome sequence information ovis_aries_rambouillet_1.0 (genome link: https: / / uswest.ensembl.org / Ovis_aries_rambouillet / Info / Index), and there is an A / G polymorphism. A large number of SNP and phenotypic association analysis results show that SNP sites with significant associations with complex traits are mostly located in non-coding regions, and generally can only explain 1-2% of the variation. The SNP molecular marker (chr10_80934959:G>A) related to the chest circumference of sheep discovered by the present invention can explain 23.58% of the variance of the chest circumference. Although the chest circumference is controlled by multiple genes, the SNP molecular marker still has a large effect. In the breeding process, the SNP molecular marker provided by the present invention is used to select sheep with AA genotype for variety preservation. When the AA genotype is used for breeding, the G allele needs to be excluded when crossing with other sheep. In particular, artificial insemination using AA genotype ram semen can greatly improve breeding efficiency and obtain a flock with a chest circumference advantage. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required to be used in the embodiments are briefly introduced below.

[0025] Figure 1 This is the KASP typing result diagram of chr10__80934959:G>A;

[0026] Figure 2 This is a box plot of the residual values ​​after correcting the fixed effects for chest circumference of sheep with different genotypes of chr10__80934959:G>A. DETAILED DESCRIPTION

[0027] The invention provides a SNP molecular marker for identifying or assisting in identifying the chest circumference size of sheep. The SNP molecular marker is located at the 80934959 bp base on chromosome 10 with the sheep genome sequence information of ovis_aries_rambouillet_1.0, and has A / G polymorphism.

[0028] As an embodiment, the nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.1, which is as follows:

[0029] 5'-ACTTTGTTTTCTTCAACTACTGTGCATCAGTTAGCGGCAAAGTGGTG TAGAAGATAACAAGAAGTGACAGGTGCAGCCATTCCTGCTGTGGAGGAAAGAGGGCATCAAGTAAGAAGAGGCAGTGATTGTGAAAAGATGCTTGTGAAATGTTTTTTTAAGACATAGAAGCTTAACACAGTTTTCTTTTTAGAATGATGGCTTRGTAATAGT TAATGACAAGCCATGATGTGGTGTTGACACACACGAGGGGGAAGCAGAGGGTACAGGGCTTGCACTCAGAGTCTCTATCGTTGGTCTTGTGTTCCCAGCCCGTCCTGTGCCACCTGCTTCCTGACGGCCTGGGAAGGGCCTTCCTCTCTGT-3'; where R is A or G.

[0030] The results of a large number of SNP and phenotype association analyses show that most of the SNP sites significantly associated with complex traits are located in non-coding regions, and generally can only explain 1-2% of the variation. The SNP molecular marker (chr10__80934959: G>A) associated with sheep chest circumference discovered by the present invention can explain 23.58% of the variance variation of chest circumference, which has a large effect. Using the SNP molecular markers provided by the present invention, marker-assisted selection of chest circumference traits can be performed through molecular marker-assisted selection, and the meat production traits of sheep can be estimated at an early stage, which can effectively shorten the generation interval and increase the selection intensity, thereby reducing breeding costs and improving breeding efficiency. Molecular marker-assisted selection combined with artificial insemination can be used to carry out large-scale selection of sheep populations, which can save feed and breeding costs and improve the economic benefits of mutton production. The specific operation includes: selecting sheep with SNP molecular markers as AA genotypes for seed preservation during breeding, using AA genotypes as breeding sheep during breeding, and excluding sheep with G alleles when hybridizing with other sheep. In particular, artificial insemination using AA genotype ram semen can greatly improve breeding efficiency and obtain a flock with an advantage in chest circumference.

[0031] Based on the above advantages, the present invention provides a primer set for detecting the SNP molecular marker described in the above technical solution, including: F1, F2 and R; the nucleotide sequence of F1 is shown in SEQ ID NO.2, the nucleotide sequence of F2 is shown in SEQ ID NO.3, and the nucleotide sequence of R is shown in SEQ ID NO.4; F1 and F2 are labeled with different fluorescent groups. As an embodiment, the fluorescent group includes FAM, VIC or HEX. As another embodiment, F1 is labeled with the fluorescent group VIC, and F2 is labeled with the fluorescent group FAM.

[0032] The primer set provided by the present invention can utilize competitive allele-specific polymerase chain reaction (KASP) technology to detect the SNP molecular markers described in the above technical solution, and determine the genotype of the SNP molecular marker, thereby selecting sheep with AA homozygous genotype to enter the core group, so as to improve the chest circumference trait of the sheep, which helps to increase economic benefits.

[0033] Based on the above advantages, the present invention provides the use of the SNP molecular marker described in the above technical solution or the primer set described in the above technical solution in identifying or assisting in identifying the chest circumference size of sheep.

[0034] Based on the above advantages, the present invention provides the use of the SNP molecular marker described in the above technical solution or the primer set described in the above technical solution in sheep breeding, wherein the breeding includes breeding sheep with relatively large chest circumference.

[0035] As an embodiment, the sheep are Bamberg sheep.

[0036] As an embodiment, the sheep whose genotype of the SNP molecular marker is AA have a relatively large chest circumference, that is, the chest circumference of the sheep with the genotype of AA is larger than that of the sheep with the genotype of GA or GG.

[0037] Based on the above advantages, the present invention provides a method for identifying or assisting in identifying the chest circumference of a sheep, comprising the following steps:

[0038] Using the genomic DNA of the sheep to be tested as a template, PCR amplification is performed using the primer set described in the above technical solution to obtain an amplified product; determining the genotype of the sheep to be tested based on the fluorescent group on the amplified product;

[0039] If the amplified product contains only the fluorescent group labeled F1, the genotype of the sheep to be tested is GG;

[0040] If the amplified product contains only the fluorescent group labeled F2, the genotype of the sheep to be tested is AA;

[0041] If the amplified product contains fluorescent groups labeled with F1 and F2, the genotype of the sheep to be tested is GA;

[0042] The chest circumference of the sheep to be tested is determined according to the genotype of the sheep to be tested: the sheep with the genotype of AA is a sheep with a relatively large chest circumference.

[0043] As an embodiment, the method for determining the genotype of the sheep to be tested further comprises: sequencing the amplification product, and determining the genotype of the sheep to be tested according to the sequencing result.

[0044] To further illustrate the present invention, a SNP molecular marker associated with sheep chest circumference and its application provided by the present invention are described in detail below in conjunction with the accompanying drawings and examples, but they should not be construed as limiting the scope of protection of the present invention.

[0045] Example 1

[0046] 1. Experimental Materials

[0047] A total of 179 Bamian sheep were selected as test subjects.

[0048] 2. Reagents and instruments

[0049] Reagents: 2× Taq DNA Polymerase Mix;

[0050] PCR amplification: ABI 9700196 Dual;

[0051] Fluorescence reading: FLUOstaroemga;

[0052] Fluorescence value analysis: KlusterCallergenotyping software;

[0053] All reagents and instruments were purchased from Beijing Inno Biotechnology Co., Ltd.

[0054] 3. Extraction of genomic DNA

[0055] Take blood from the jugular vein of sheep and use a DNA extraction kit to extract DNA. Extract the genomic DNA of the sheep to be tested; dilute the DNA to 20ng / μl.

[0056] 4. The sequences of the primers used for PCR amplification are as follows:

[0057] F1 (SEQ ID NO.2): 5'-GAAGGTCGGAGTCAACGGATTATCATGGCT TGTCATTAACTATTACC-3';

[0058] F2 (SEQ ID NO.3): 5'-GAAGGTGACCAAGTTCATGCTCATCATGGC TTGTCATTAACTATTACT-3';

[0059] R (SEQ ID NO.4): 5'-GCTTAACACAGTTTTCTTTTTAGAATG-3';

[0060] Among them, 5'-GAAGGTCGGAGTCAACGGATT-3' (SEQ ID NO.5) in F1 is a universal fluorescent linker sequence, and the 5' end is labeled with a VIC fluorescent group, and the reverse complementary sequence of 5'-ATCATGGCTTGTCATTAACTATTACC-3' (SEQ ID NO.6) is nucleotides 201 to 226 in the sequence shown in SEQ ID NO.1. 5'-GAAGGTGACCAAGTTCATGCT-3' (SEQ ID NO.7) in F2 is a universal fluorescent linker sequence, and the 5' end is labeled with a FAM fluorescent group, and the reverse complementary sequence of 5'-CATCATGGCTTGTCATTAACTATTACT-3' (SEQ ID NO.8) is nucleotides 201 to 227 of SEQ ID NO.1.

[0061] The above primers were synthesized by Beijing Yinuo Zhongda Biotechnology Co., Ltd. After synthesis, the primer powder was diluted to 100 μl / ml, and then the three sequences were diluted according to the volume ratio of F1:F2:R:water=24:24:48:100 to obtain a diluted primer mixture.

[0062] 5. The PCR reaction system is as follows: 2× Taq DNA Polymerase Mix 2 μl, diluted primer mixture 1 μl and genomic DNA 2 μl;

[0063] The mixed PCR reaction system was used according to the protocol described in Table 1 using ABI 9700196Dual for amplification.

[0064] Table 1 PCR thermal cycling conditions

[0065]

[0066] 6. Fluorescence value reading

[0067] After the PCR amplification cycle, the fluorescence value was read using the FLUOstaroemga device from LGC Genomics Ltd at a temperature below 40°C. SNP site detection uses the fluorescent groups VIC and FAM to distinguish the two isogenic sites G and A. The passive reference dye ROX is used to correct the signal differences between different wells due to reaction volume errors. The relevant excitation and emission wavelengths are shown in Table 2.

[0068] Table 2 Excitation and emission wavelengths of fluorescent groups used

[0069] Fluorophore Excitation light (nm) Emitted light (nm) FAM 485 520 VIC 535 556 ROX 575 610

[0070] Note: If the fluorescence scanning instrument selects the HEX fluorophore as the detection signal, no modification is required to the settings because the excitation and emission wavelengths of VIC and HEX are very similar.

[0071] 7. Determination of chr10_80934959:G>A genotype

[0072] The fluorescence values ​​were analyzed using the KlusterCaller genotyping software that comes with the FLUOstar OEM device from LGC Genomics Ltd. In this software, VIC and FAM data are plotted on the x-axis and y-axis, respectively. The fluorescence values ​​of VIC and FAM in each reaction well were corrected and standardized by the fluorescence values ​​of ROX to obtain the relative fluorescence values ​​corresponding to VIC and FAM in each PCR reaction well. Based on the relative fluorescence values, the samples were clustered, and the genotypes were further determined based on the sample clusters and fluorescence types. The specific results are shown in Figure 2. Figure 1 As shown, red represents GG type, blue represents AA type, and green represents GA type. The genotype frequencies are shown in Table 3 below. The gene frequency of GG type is 0.19, the gene frequency of GA type is 0.17, and the gene frequency of AA type is 0.66.

[0073] Table 3 Statistics of chest circumference and chr10__80934959:G>A genotype frequency of tested sheep

[0074]

[0075] 8. Calculate the relationship between chr10__80934959:G>A genotype and sheep chest circumference

[0076] First, the general linear model (GLM) was used to correct the effects of age and sheep farm in the chest circumference data, and the residuals were derived as phenotypic values ​​( Figure 2) Then, principal component analysis was performed, and the first three principal components obtained from the principal component analysis were used as covariates. Then, the BLINK function in the BLINK software package (https: / / github.com / YaoZhou89 / BLINK) was used to calculate the effect of single-point SNP on chest phenotype according to the mixed linear model (MLM) based on the chr10__80934959:G>A genotype. The mixed linear model is shown in Formula I:

[0077] y=Q+K+S+e Formula I;

[0078] Wherein, y is the phenotypic data; Q is the first three principal components obtained by principal component analysis of the residuals derived from the correction of the effects of age and sheep farm in the chest circumference data using the ordinary linear model; K is the kinship matrix between individuals, S is the coefficient matrix composed of the chr10__80934959:G>A genotype (0 represents homozygous AA, 1 represents heterozygous GA, and 2 represents homozygous GG); e is the random residual effect.

[0079] The results are shown in Table 4.

[0080] Table 4 Association analysis between the tested sheep chr10__80934959:G>A genotype and chest circumference of Bamei sheep

[0081] SNP total P-value Effects of mutations Phenotypic variance explained by SNPs chr10__80934959:G>A 179 <![CDATA[1.99×10 -16 ]]> 6.01922 23.58％

[0082] The results showed that the molecular marker chr10__80934959:G>A was significantly correlated with the chest circumference of Bamei sheep. The chest circumference of sheep carrying the GA genotype was lower than that of sheep carrying the AA genotype (P=1.99×10 -16 ). The A allele increases the chest circumference of sheep, and its effect value is 6.01922. This SNP site can explain 23.58% of the phenotypic variance. Although chest circumference is controlled by multiple genes, this SNP site still has a large effect. It can be seen from this that the AA genotype is selected for seed preservation during breeding, and the AA genotype is used as breeding sheep during breeding. When crossing with other sheep, the G allele needs to be excluded. In particular, artificial insemination using semen from AA genotype rams can greatly improve breeding efficiency and obtain a flock with an advantage in chest circumference.

[0083] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A SNP molecular marker associated with sheep chest circumference, characterized in that: The SNP molecular marker is located at the 80934959 bp base on chromosome 10 with the sheep genome sequence information of ovis_aries_rambouillet_1.0, and has an A / G polymorphism.

2. The SNP molecular marker according to claim 1, characterized in that: The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.1, wherein R is A or G.

3. A primer set for detecting the SNP molecular marker according to claim 1 or 2, characterized in that: include: F1, F2 and R; the nucleotide sequence of F1 is shown in SEQ ID NO.2, the nucleotide sequence of F2 is shown in SEQ ID NO.3, and the nucleotide sequence of R is shown in SEQ ID NO.4; F1 and F2 are labeled with different fluorescent groups.

4. The primer set according to claim 3, characterized in that: The fluorescent group includes FAM, VIC or HEX.

5. The primer set according to claim 4, characterized in that: The F1 is labeled with a fluorescent group VIC, and the F2 is labeled with a fluorescent group FAM.

6. Use of the SNP molecular marker according to claim 1 or 2 or the primer set according to any one of claims 3 to 5 in identifying or assisting in identifying the chest circumference of sheep.

7. Use of the SNP molecular marker according to claim 1 or 2 or the primer set according to any one of claims 3 to 5 in sheep breeding, wherein the breeding includes selecting sheep with relatively large chest circumference.

8. The use according to claim 6 or 7, characterized in that: The sheep are Bamberg sheep.

9. The use according to claim 6 or 7, characterized in that: Sheep whose genotype of the SNP molecular marker is AA have relatively large chest circumference.

10. A method for identifying or assisting in identifying the chest circumference of a sheep, characterized in that: The following steps are involved: Using the genomic DNA of the sheep to be tested as a template, and using the primer set described in any one of claims 3 to 5 to perform PCR amplification to obtain an amplified product; determining the genotype of the sheep to be tested according to the fluorescent group on the amplified product; If the amplified product contains only the fluorescent group labeled F1, the genotype of the sheep to be tested is GG; If the amplified product contains only the fluorescent group labeled F2, the genotype of the sheep to be tested is AA; If the amplified product contains fluorescent groups labeled with F1 and F2, the genotype of the sheep to be tested is GA; The chest circumference of the sheep to be tested is determined according to the genotype of the sheep to be tested: the sheep with the genotype of AA is a sheep with a relatively large chest circumference.

Images