Ensiformospora poensiformis and application thereof

Abstract

The invention discloses Lunasporgiospora chienii and application thereof, the strain number of the Lunasporgiospora chienii is JSAFC 2261, the Lunasporgiospora chienii is preserved in China General Microbiological Culture Collection Center on September 23, 2024, and the preservation number of the Lunasporgiospora chienii is CGMCC No.41524. The invention further discloses a preparation method of the Lunasporgiospora chienii. The ensiformospora strain provided by the invention is strong in pathogenicity to fall webworms and larvae of the larvae of the Artemisia cordata, is environment-friendly and pollution-free, is not easy to generate drug resistance, can be used as a living body biopesticide, and has very strong application potential in biological prevention and control of the fall webworms and / or the larvae of the Artemisia cordata.

Description

Technical Field

[0001] The invention belongs to the technical field of microorganisms and relates to Lunar spore mold and applications thereof. Background Art

[0002] Agriculture is the foundation of my country's national economy, and pest damage is one of the important factors restricting the sustainable and stable development of agricultural production. In terms of species, there are more than 800 species of crop pests, including more than 20 major epidemic and migratory pests, among which the American white moth (Hyphantria cunea) and the copper green beetle (Anomala corpulenta) are pests that need to be paid special attention to.

[0003] The gypsy moth is native to North America. It was first discovered in my country in 1979. In just 30 years, from the northeastern border to the heartland of the Central Plains, from a handful to tens of thousands, they have conquered eight provinces and cities in Liaoning. Wherever they go, the leaves are eaten up, leaving only the veins, making it impossible for the trees to photosynthesize and eventually die. The gypsy moth has a mixed diet and is a serious plant quarantine pest that harms the world. At present, the comprehensive management technology system for the gypsy moth is still imperfect, and the prevention and control technical means mainly use chemical control. The promotion and application of new sustainable biological control technologies are relatively rare, which is not conducive to my country's pesticide reduction and pest control actions.

[0004] Although the copper green beetle has a beautiful appearance, it is a very troublesome insect in agriculture. Despite its exquisite and gorgeous appearance, the copper green beetle never makes agricultural practitioners worry-free. Among them, the larvae (grubs) of the copper green beetle are one of the main underground pests. They are distributed in most parts of China and are also one of the main pests in the grain and cotton areas of the Huanghuai Plain. As a result, many areas in the country are currently in disaster. However, due to long-term dependence on highly toxic, extremely toxic, and highly residual chemical pesticides, the beetle's resistance to pesticides has increased, the number of natural enemies has sharply decreased, and environmental pollution has become increasingly prominent. In the context of developing pollution-free ecological agriculture and organic agriculture, people's management of pests has turned to their relationship with ecology. For special groups of underground pests such as copper green beetles, prevention and control is difficult, and the use of biocontrol agents with relatively good environmental safety and compatibility is undoubtedly the main means.

[0005] Therefore, it is urgent to find a green control technology with good and lasting control effect on the American white moth and the copper green beetle. Biological control has become a hot topic in current research. Exploring and screening highly targeted strains is a key link that must be overcome in the process of biological control. However, the existing technology still lacks a green and efficient probiotic for controlling such omnivorous and serious pests. Screening out such microbial resources can provide an effective way to achieve efficient, green and sustainable control of major pests. Summary of the invention

[0006] Purpose of the invention: The purpose of the present invention is to provide a Lunasporangiosporachienii and its application in controlling the gypsy moth and the copper green beetle.

[0007] Technical solution: The present invention provides a Lunasporangiospora chienii, the strain number of the Lunasporangiospora chienii is JSAFC 2261, which was deposited in the General Microbiology Center of China National Microbiological Culture Collection Administration on September 23, 2024, with a deposit number of CGMCC No.41524.

[0008] Furthermore, the nucleotide sequence of the ITS gene of Aspergillus niger is shown in SEQ ID NO.1.

[0009] The present invention also provides a biocontrol fungus agent, the active ingredient of which is the above-mentioned Lunasporangiospora chienii, its hyphae or spore suspension.

[0010] The present invention also provides the use of the above-mentioned Lunasporangiospora chienii and the biocontrol fungus agent in preventing and controlling the gypsy moth and / or the copper green beetle.

[0011] Furthermore, the application is specifically by spraying the spore suspension of Lunasporangiosporachienii on the larvae of the American white moth and / or the copper green beetle.

[0012] Furthermore, the preparation method of the spore suspension is as follows: (1) taking the Ensporium species from the biocontrol bacteria pool, picking up the mycelium with an inoculation needle under sterile conditions, inoculating it into a sterilized PDA culture medium, and culturing it for 5 days; (2) scraping the mycelium under sterile conditions, washing the mycelium with sterile water and filtering it with gauze.

[0013] Furthermore, the culture conditions in step (1) are 25° C., 75% humidity, and dark culture.

[0014] Further, the concentration of the spore suspension is 10 7 / ml.

[0015] Beneficial effects: Compared with the prior art, the present invention has the following outstanding advantages: The present application obtains a species of Lunasporangiosporachienii by isolating and purifying soil from Tianmen Mountain in Yongtai County, Fujian Province. The strain can be used as a biocontrol strain to control the gypsy moth and copper green beetle, has a high mortality rate, is environmentally friendly and non-toxic, and can significantly inhibit the survival activity of the gypsy moth and copper green beetle, which is of great significance for the future development of biocontrol agents for the control of the gypsy moth and copper green beetle. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 :The colony morphology of Lunasporangiospora chienii JSAFC 2261.

[0017] Figure 2 : Phylogenetic tree of Lunasporangiospora chienii JSAFC 2261.

[0018] Figure 3 :Effects of Lunasporangiosporachienii JSAFC 2261 on the growth of larvae of the American white moth and the copper green beetle. DETAILED DESCRIPTION

[0019] The technical solution of the present invention is further described below in conjunction with the accompanying drawings.

[0020] As described in the present invention, the term "biocontrol bacteria" refers to beneficial microorganisms that can prevent and control plant diseases, mainly bacteria, fungi, and actinomycetes.

[0021] Example 1: Isolation and identification of Lunasporangiosporachienii JSAFC 2261

[0022] 1. Isolation of Lunasporangiosporachienii JSAFC 2261

[0023] JSAFC 2261 was isolated from soil from Tianmen Mountain, Yongtai County, Fujian Province. The bacterial colony characteristics are as follows: When cultured on PDA plate medium, the bacterial colony grows rapidly and is flocculent. The surface color is white ( Figure 1 ).

[0024] 2. Molecular biological identification of Lunasporangiospora chienii JSAFC 2261

[0025] (1) The genomic DNA of strain JSAFC 2261 was extracted using a kit from TIANGEN.

[0026] (2) Amplification of ITS gene from genomic DNA. DNA amplification was performed in a 30 μL reaction volume, including 15 μL 2×EasyTaq PCR SuperMix (+dye), 1 μL each of the primer pairs ITS1 (SEQ ID NO.2: 5'-CTTGGTCATTTAGAGGAAGTAA-3') & ITS4 (SEQ ID NO.3: 5'-TCCTCCGCTTATTGATATGC-3') (10 μM), 2 μL template DNA and 11 μL ddHO. 2 O, PCR amplification program conditions are as follows: 94°C pre-denaturation for 5 min; 94°C denaturation for 30 s, 54°C annealing for 45 s, 72°C extension for 60 s, for a total of 35 cycles; and finally 72°C extension for 10 min.

[0027] (3) The amplified PCR products were subjected to 1% agarose gel electrophoresis and observed under ultraviolet light. The PCR products with target bands were sent to Nanjing Qingke Biotechnology Co., Ltd. for sequencing. The sequencing results were as follows: the ITS gene sequence of strain JSAFC 2261 was SEQ ID NO. 1 (ACGAAAAATCCATTCCCACCTTGTGTGCATCGTAACAAACAACCTATTTCACAGA ATATGATTTTTAGCAAGACCGTCTGAATGCATCTCATTAGCCGATCTGCGAAAGCGGAAAGGAAAAAAAAATGAAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAACGCGATATGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCATATTGCGCTCTTTGGTATTCCGAAGAGCAT GCTTGTTTGAGTATCAGAGAACCTATCTCGAACCCTTTTTTTTTTTGAAAGAGGGATCGAGGAACTGAGTAATTCCGGTTCTCGTCAACTGGGTTACTTGAAATGAGGGTGCATCAATCTCCCTTGGGTTCGAATTCCTTGGCCTGAAAGCATATCTATTTAGTCCCGTCAAAAGGATTATTACTTTGCTGAAAGCGCTATAGGGGAGCCTGAGA).

[0028] (4) Compare the sequence of SEQ ID NO.1 on the NCBI database website and establish a phylogenetic tree, see Figure 2. The comparison results are shown in Table 1. According to the results in Table 1, it can be inferred that the biocontrol bacteria JSAFC 2261 of the present invention is Lunasporangiosporachienii, named Lunasporangiosporachienii JSAFC 2261, and the strain was deposited in the General Microbiological Center of China Microbiological Culture Collection Administration on September 23, 2024, with a deposit number of CGMCC No.41524, and a classification name of Lunasporangiosporachienii JSAFC 2261. The deposit address is the Institute of Microbiology, Chinese Academy of Sciences, No. 3, Beichen 1st Courtyard, Chaoyang District, Beijing.

[0029] Table 1 Sequence alignment results of SEQ ID NO.1

[0030]

[0031] Example 2: Determination of the pathogenicity of Lunasporangiospora chienii JSAFC 2261 to larvae of the American white moth

[0032] 1. Preparation of spore suspension

[0033] (1) A 5 mm diameter mycelium block of the strain Lunasporangiospora chienii JSAFC 2261 was taken out using a borer and inoculated into a 9 cm diameter culture dish (containing 15 ml of PDA medium) and cultured in the dark at 25° C. and 75% humidity for 7 days.

[0034] (2) The mycelium of Lunasporangiospora chienii JSAFC 2261 cultured for 7 days was scraped under sterile conditions, washed with sterile water and filtered with gauze, and then the spore concentration was adjusted to 10 7 / mL.

[0035] 2. Test insect inoculation

[0036] (1) The 2nd to 3rd instar larvae of the gypsy moth were purchased from the Institute of Forest Ecology, Environment and Protection, Chinese Academy of Forestry. If they were less than 3rd instar, they were raised in an artificial climate chamber (temperature 25°C, humidity 60-70%, light-dark ratio 14:10) until they were 3rd instar, and surface-sterilized mulberry leaves were provided every day. When the gypsy moth larvae reached the 3rd instar, they were used for bioassay.

[0037] (2) Using sterile ultrapure water as negative control, the insecticidal activity of JSAFC 2261 against the gypsy moth was determined.

[0038] (3) The JSAFC 2261 spore suspension (10 7 / mL) were inoculated with 3rd instar larvae of the American moth.

[0039] Take 10mL of spore suspension and place it in a culture dish. When inoculating, immerse the test insect source in the spore suspension for 30 seconds and then take it out. The insect body after immersion inoculation is transferred to a transparent plastic box and placed in an artificial climate box (temperature 25°C, humidity 60-70%, light-dark ratio 14:10) to feed sterilized mulberry leaves. The leaves are replaced every day and the death of the larvae is observed and recorded. From the second day, the observation is made once a day for a total of 7 days. Each group has 30 test insect source larvae, and the investigation and recording are repeated 3 times.

[0040] The experimental results are shown in Table 2.

[0041] Table 2 Mortality of nymphalid moth larvae after inoculation with JSAFC 2261 (%)

[0042]

[0043] From the data in Table 2, it can be seen that the mortality rate of the larvae of the American white moth in the treatment group is significantly higher than that in the control group. The strain JSAFC 2261 of the present invention has a good killing effect on the American white moth. 7 The mortality rate of the spore suspension of the strain with spores / mL to the gypsy moth after 7 days was 100%, which shows that JSAFC 2261 has a control effect on the larvae of the gypsy moth.

[0044] Example 3: Determination of the pathogenicity of Lunasporangiospora chienii JSAFC 2261 to the larvae of the copper green beetle

[0045] 1. Preparation of spore suspension

[0046] Prepare JSAFC 2261 spore suspension according to Example 2, adjust the spore concentration to 10 7 / mL.

[0047] 2. Test insect inoculation

[0048] (1) The larvae of A. copperi (collected from the fields of Sizhuang Village, Houbai Town, Jurong City) were raised in an artificial climate chamber (temperature 26±1°C, humidity 80%, light-dark ratio 14:10) and bred to the second age for use.

[0049] (2) Using sterile ultrapure water as negative control, the insecticidal activity of JSAFC 2261 against A. cooperi was determined.

[0050] (3) The JSAFC 2261 spore suspension (10 7 / mL) were inoculated with 2-instar A. cooperi larvae.

[0051] Take the larvae of the copper green scarab beetle, set up 3 replicate areas in each group, with 20 larvae in each area. Dip each larvae in the spore suspension for 30 seconds, place them on sterile filter paper, let them crawl to dry the moisture on their bodies, and then put them in a breeding box filled with sterile soil. Feed them with sterilized feed every day, observe and record the infection and mortality of the larvae every day, and observe for 28 consecutive days.

[0052] The experimental results are shown in Table 3.

[0053] Table 3 Mortality of A. corydalis after inoculation with JSAFC 2261 (%)

[0054]

[0055] From the data in Table 3, it can be seen that 28 days after inoculation, the larval mortality rate of the treatment group was significantly higher than that of the control group. The JSAFC 2261 strain of the present invention had a mortality rate of more than 93% on A. corydalis, with the peak period of mortality being 14-20 days, and dead insects appeared 3 days after inoculation. The above results show that the strain JSAFC 2261 of the present invention has a good killing effect on the larvae of A. corydalis.

[0056] In summary, the JSAFC 2261 provided by the present invention provides a biological control resource for controlling the larvae of the American white moth and / or the copper green beetle, and has the characteristics of strong toxicity and fast insecticidal speed. At the same time, it solves the problems of pesticide residues and environmental pollution caused by the use of chemical pesticides to control pests, and has good development potential and production value.

Claims

1. A Lunasporangiospora chienii, characterized in that The strain number of the Lunasporangiospora chienii is JSAFC 2261, which was deposited in the General Microbiology Center of the China Microbiological Culture Collection Administration on September 23, 2024, with a deposit number of CGMCC No.41524.

2. Lunasporangiospora chienii according to claim 1, characterized in that The nucleotide sequence of the ITS gene of Aspergillus niger is shown in SEQ ID NO.

1.

3. A biocontrol agent, characterized in that: The active ingredient of the biocontrol fungus agent is the Lunasporangiospora chienii, or its hyphae or spore suspension as described in any one of claims 1 to 2.

4. Use of Lunasporangiospora chienii according to any one of claims 1 to 2 and the biocontrol fungus agent according to claim 3 in controlling the gypsy moth and / or the copper beetle.

5. The use according to claim 4, characterized in that: The application is specifically to spray the spore suspension of Lunasporangiospora chienii according to any one of claims 1 to 2 on the larvae of the American white moth and / or the copper green beetle.

6. The use according to claim 5, characterized in that: The preparation method of the spore suspension is as follows: (1) taking Ensporium species from a biocontrol fungus pool, picking up hyphae with an inoculation needle under sterile conditions, inoculating the hyphae with a sterilized PDA culture medium, and culturing for 5 days; (2) scraping the hyphae under sterile conditions, washing the hyphae with sterile water, and filtering with gauze.

7. The use according to claim 6, characterized in that: The culture conditions in step (1) are 25° C., 75% humidity, and dark culture.

8. The use according to claim 5, characterized in that: The concentration of the spore suspension is 10 7 / mL.

Images