LAMP (loop-mediated isothermal amplification) primer probe group for detecting group A streptococcus, group B streptococcus and human penicillin susceptibility gene RNA (ribonucleic acid) as well as kit and application of LAMP primer probe group

Abstract

The invention relates to the technical field of biological detection, and particularly discloses an LAMP (Loop-Mediated Isothermal Amplification) primer probe group for detecting group A streptococcus, group B streptococcus and human penicillin susceptibility gene RNA (Ribonucleic Acid) as well as a kit and application of the LAMP primer probe group. The primer group comprises a primer group designed for group A streptococcus 23S rRNA, group B streptococcus 23S rRNA and human penicillin susceptibility gene HLA-DRB1 * 09 cross-intron region RNA, the probe group can simultaneously detect group A streptococcus, group B streptococcus and human penicillin susceptibility gene amplification products, and the application effectively improves the sensitivity, reduces the detection time and operation steps, and reduces the detection cost. The detection result can assist in diagnosis so as to reduce the risk of severe rapid anaphylactic reactions such as anaphylactic shock and the like, and meanwhile, whether pathogen viable bacteria exist after medication can be known by detecting the group A streptococcus 23S rRNA and the group B streptococcus 23S rRNA, so that subsequent medication monitoring of group A streptococcus and group B streptococcus infection is facilitated.

Description

Technical Field

[0001] The invention relates to the technical field of biological detection, and in particular to a LAMP primer probe set for detecting group A streptococci, group B streptococci and human penicillin susceptibility gene RNA, a kit and an application thereof. Background Art

[0002] Group A Streptococcus (GAS), also known as pyogenic Streptococcus or hemolytic Streptococcus, causes about 90% of human streptococcal infections. It is a highly pathogenic bacterium among human streptococci, has strong invasiveness, and produces a variety of invasive enzymes and exotoxins. If a pregnant woman is infected with Group A Streptococcus, the newborn may also be infected with Group A Streptococcus through the birth canal during delivery, which may cause sepsis and even death in severe cases. The treatment of the disease mainly relies on antibacterial treatment, among which penicillin is the first choice. In addition, macrolide drugs are mainly used to treat cases of penicillin allergy.

[0003] Group B Streptococcus (GBS) is also called Streptococcus agalactiae. According to the different capsular polysaccharides of bacteria, GBS can be divided into Ia, Ib, Ic, II, III, IV, V, VI, VII, VIII and IX. All of the above serotypes can cause early-onset GBS infection in humans, among which type III is the most virulent. Group B Streptococcus can live in the mother's reproductive tract and gastrointestinal tract. Pregnant women with the bacteria usually have no clinical symptoms, but they can also cause choriomucositis, endometritis, etc. Neonatal infection is mostly transmitted from mother to child. For example, premature rupture of the amniotic membrane can cause ascending infection, or contact with bacteria in the birth canal. If the amniotic membrane is intact, the fetus inhales amniotic fluid contaminated by amnionitis, which can also cause disease. Anti-infection treatment is required after examination and diagnosis, and high-dose penicillin or ampicillin can be selected. However, it should be considered that those who are resistant to penicillin can choose antibiotics based on drug sensitivity tests to further reduce the risk of anaphylactic shock.

[0004] In summary, infants (such as newborns) need to consider the choice of antibiotics when taking medication. The detection of penicillin resistance genes is also necessary. Penicillin treatment for GBS-positive patients is currently an effective treatment option in clinical practice. However, the use of penicillin antibiotics has the highest incidence of allergic reactions among all drugs. At present, the instructions for penicillin antibiotics in my country, the "Guidelines for the Clinical Application of Antimicrobial Drugs" and the "Guidelines for Clinical Use of Pharmacopoeia of the People's Republic of China" all require routine penicillin skin tests before using penicillin antibiotics. Infants and elderly patients have poor skin reactivity and may have false negative results. A negative skin test cannot completely rule out the possibility of an allergic reaction. Therefore, even if the skin test is negative, close observation is still required during the use of the drug, and emergency preparations for allergic reactions should be made. Summary of the invention

[0005] The main purpose of the present invention is to propose a LAMP primer probe set and application for detecting RNA of group A streptococci, group B streptococci and human penicillin susceptibility gene, aiming to solve the technical problem of being able to simultaneously detect whether group A streptococci and group B streptococci are infected while also detecting the patient's penicillin susceptibility gene to avoid improper use of penicillin, wherein the RNA detected for group A streptococci and group B streptococci can be simultaneously used to monitor whether the patient is still infected with group A streptococci and group B streptococci after taking the medicine.

[0006] To achieve the above object, the present invention proposes a LAMP primer probe set for detecting group A streptococci, group B streptococci and human penicillin susceptibility gene RNA, the primer probe set comprising: a first primer probe set designed for the conservative region of group A streptococcus 23S rRNA target sequence, a second primer probe set designed for the conservative region of group B streptococcus 23S rRNA target sequence, and a third primer probe set designed for the intron-spanning region of human penicillin susceptibility gene HLA-DRB1*09, wherein: The first primer probe group includes a GAS-F3 primer, a GAS-B3 primer, a GAS-FIP primer, a GAS-BIP primer, a GAS-LF primer, a GAS-LB primer and a GAS-P probe, the nucleotide sequence of the GAS-F3 primer is shown in SEQ ID NO: 1, the nucleotide sequence of the GAS-B3 primer is shown in SEQ ID NO: 2, the nucleotide sequence of the GAS-FIP primer is shown in SEQ ID NO: 3, the nucleotide sequence of the GAS-BIP primer is shown in SEQ ID NO: 4, the nucleotide sequence of the GAS-LF primer is shown in SEQ ID NO: 5, the nucleotide sequence of the GAS-LB primer is shown in SEQ ID NO: 6, and the nucleotide sequence of the GAS-P probe is shown in SEQ ID NO: 7; The second primer probe set includes a GBS-F3 primer, a GBS-B3 primer, a GBS-FIP primer, a GBS-BIP primer, a GBS-LF primer, a GBS-LB primer and a GBS-P probe, the nucleotide sequence of the GBS-F3 primer is shown in SEQ ID NO:8, the nucleotide sequence of the GBS-B3 primer is shown in SEQ ID NO:9, the nucleotide sequence of the GBS-FIP primer is shown in SEQ ID NO:10, the nucleotide sequence of the GBS-BIP primer is shown in SEQ ID NO:11, the nucleotide sequence of the GBS-LF primer is shown in SEQ ID NO:12, the nucleotide sequence of the GBS-LB primer is shown in SEQ ID NO:13, and the nucleotide sequence of the GBS-P probe is shown in SEQ ID NO:14; The third primer probe group includes DRB-F3 primer, DRB-B3 primer, DRB-FIP primer, DRB-BIP primer, DRB-LF primer, DRB-LB primer and DRB-P1 probe, the nucleotide sequence of the DRB-F3 primer is shown in SEQ ID NO:15, the nucleotide sequence of the DRB-B3 primer is shown in SEQ ID NO:16, the nucleotide sequence of the DRB-FIP primer is shown in SEQ ID NO:17, the nucleotide sequence of the DRB-BIP primer is shown in SEQ ID NO:18, the nucleotide sequence of the DRB-LF primer is shown in SEQ ID NO:19, the nucleotide sequence of the DRB-LB primer is shown in SEQ ID NO:20, and the nucleotide sequence of the DRB-P1 probe is shown in SEQ ID NO:21.

[0007] In one embodiment, the GAS-P probe, the GBS-P probe and the DRB-P1 probe are all Taqman probes or molecular beacon probes, and / or, The GAS-P probe, the GBS-P probe and the DRB-P1 probe are all Taqman probes, wherein the 5′ end of the Taqman probe includes a fluorescent reporter group, and the 3′ end of the Taqman probe includes a fluorescent quencher group.

[0008] In one embodiment, the fluorescent reporter group includes a FAM fluorescent group, a VIC fluorescent group, a ROX fluorescent group or a CY5 fluorescent group.

[0009] In one embodiment, the fluorescence quenching group includes a BHQ1 quenching group, a BHQ2 quenching group or a BHQ3 quenching group.

[0010] In one embodiment, in the first primer probe set designed for the conserved region of the group A streptococcal 23S rRNA target sequence, the nucleotide sequence of the conserved region of the 23S rRNA target sequence is as shown in SEQ ID NO: 22; and / or, In the second primer probe set designed for the conservative region of the group B streptococcal 23S rRNA target sequence, the nucleotide sequence of the conservative region of the 23S rRNA target sequence is shown in SEQ ID NO: 23; and / or, In the second primer probe set designed for the human penicillin susceptibility gene HLA-DRB1*09 trans-intron region, the HLA-DRB1*09 trans-intron region includes a first exon and a second exon, the nucleotide sequence of the first exon is shown in SEQ ID NO:24, and the nucleotide sequence of the second exon is shown in SEQ ID NO:25.

[0011] The present invention also provides a kit for detecting LAMP primer probe groups for group A streptococci, group B streptococci and human penicillin susceptibility gene RNA, the kit comprising the LAMP primer probe group for detecting group A streptococci, group B streptococci and human penicillin susceptibility gene RNA as described in any one of the above items.

[0012] In one embodiment, the kit further comprises reverse transcriptase, UDG enzyme, Bst DNA polymerase, ABH blank control, ABH positive control and RNA sample preservation solution.

[0013] In one embodiment, the components of the RNA sample preservation solution include 0.5-1.5M guanidine isothiocyanate, 1%-2% sodium dodecyl sulfate, 0.1-0.2g / L xanthate, 0.02-0.03M EDTA and 0.1-0.3M Tris-HCl.

[0014] The present invention provides a method for detecting group A streptococci, group B streptococci and human penicillin susceptibility gene RNA, the detection method is for non-disease treatment or diagnosis purposes, comprising the steps of: Obtain a sample to be tested and a kit for detecting the LAMP primer probe set for group A streptococci, group B streptococci and human penicillin susceptibility gene RNA as described in any one of the above items; use the detection kit to perform a LAMP amplification reaction on the sample to be tested to obtain a fluorescent Ct value of the sample amplification; compare the fluorescent Ct value with a preset value, and judge the situation of group A streptococci, group B streptococci and human penicillin susceptibility gene according to the comparison result.

[0015] The invention provides a LAMP primer probe group for detecting group A streptococci, group B streptococci and penicillin susceptibility gene RNA. The primer group comprises a first primer probe group designed for a conservative region of a group A streptococcus 23S rRNA target sequence, a second primer probe group designed for a conservative region of a group B streptococcus 23S rRNA target sequence, and a third primer probe group designed for a human penicillin susceptibility gene HLA-DRB1*09 cross-intron region. The primer probe group can simultaneously detect group A streptococci, group B streptococci and human penicillin susceptibility gene, and improves sensitivity, reduces detection time and operation steps, and reduces the risk of severe rapid allergic reactions such as anaphylactic shock. Moreover, it can be known whether the pathogen is still in a live bacterial state after a period of time after medication, which is convenient for subsequent dynamic monitoring of the pathogen and medication monitoring. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other related drawings can be obtained based on these drawings without paying creative work.

[0017] Figure 1 This is an example diagram of sample amplification of GAS (positive), GBS (positive), and HLA-DRB1 (positive) in Example 4 of the present invention; Figure 2 This is an example diagram of sample amplification of GAS (positive), GBS (negative), and HLA-DRB1 (positive) in Example 4 of the present invention; Figure 3 This is an example diagram of amplification of GAS (negative), GBS (positive), and HLA-DRB1 (positive) samples in Example 4 of the present invention; Figure 4 This is an example diagram of sample amplification of GAS (positive), GBS (positive), and HLA-DRB1 (negative) in Example 4 of the present invention; Figure 5 This is an example diagram of sample amplification of GAS (positive), GBS (negative), and HLA-DRB1 (negative) in Example 4 of the present invention; Figure 6 This is an example diagram of sample amplification of GAS (negative), GBS (positive), and HLA-DRB1 (negative) in Example 4 of the present invention; Figure 7 This is an example diagram of sample amplification of GAS (negative), GBS (negative), and HLA-DRB1 (positive) in Example 4 of the present invention; Figure 8 This is an example diagram of amplification of GAS (negative), GBS (negative), and HLA-DRB1 (negative) samples in Example 4 of the present invention.

[0018] The realization of the purpose, functional features and advantages of the present invention will be further explained in conjunction with embodiments and with reference to the accompanying drawings. DETAILED DESCRIPTION

[0019] To make the purpose, technical solution and advantages of the embodiments of the present invention clearer, the technical solution in the embodiments of the present invention will be described clearly and completely below. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them.

[0020] It should be noted that, in the embodiments, those without specifying specific conditions are carried out according to normal conditions or conditions recommended by the manufacturer. Those without specifying the manufacturer of reagents or instruments used are conventional products that can be purchased commercially. In addition, the meaning of "and / or" appearing in the full text includes three parallel schemes, and "A and / or B" is taken as an example, including schemes A, B, or A and B that meet the same time. In addition, the technical schemes between the various embodiments can be combined with each other, but must be based on the ability of ordinary technicians in the field to achieve. When the combination of the technical schemes is contradictory or cannot be achieved, it should be considered that the combination of such technical schemes does not exist, and is not within the scope of protection required by the present invention. Based on the embodiments in the present invention, all other embodiments obtained by ordinary technicians in the field without making creative work, all belong to the scope of protection of the present invention.

[0021] Group A Streptococcus, also known as pyogenic Streptococcus or hemolytic Streptococcus, causes about 90% of human streptococcal infections. It is a highly pathogenic bacterium among human streptococci, has strong invasiveness, and produces a variety of invasive enzymes and exotoxins. If a pregnant woman is infected with Group A Streptococcus, the newborn may also be infected with Group A Streptococcus through the birth canal during delivery, which may cause sepsis and even death in severe cases. The treatment of the disease mainly relies on antibacterial treatment, of which penicillin is the first choice. In addition, macrolide drugs are mainly used to treat cases of penicillin allergy.

[0022] Group B Streptococcus (GBS), also known as Streptococcus agalactiae, resides in the mother's reproductive tract and gastrointestinal tract. Pregnant women with the bacteria usually have no clinical symptoms, but it can also cause choriomenitis, endometritis, etc. Neonatal infection is mostly transmitted from mother to child. For example, premature rupture of the amniotic membrane can cause ascending infection, or contact with bacteria in the birth canal. For those with intact amniotic membranes, the fetus can inhale amniotic fluid contaminated by amnionitis, which can also cause illness. Anti-infection treatment is required after examination and diagnosis. High-dose penicillin or ampicillin can be selected. However, it should be considered that those with penicillin resistance can choose antibiotics based on drug sensitivity tests to further reduce the risk of anaphylactic shock.

[0023] In view of this, the present invention proposes a LAMP primer probe set for detecting group A streptococci, group B streptococci and human penicillin susceptibility gene RNA, the primer probe set comprising: a first primer probe set designed for the conservative region of group A streptococcus 23S rRNA target sequence, a second primer probe set designed for the conservative region of group B streptococcus 23S rRNA target sequence, and a third primer probe set designed for the intron-spanning region of human penicillin susceptibility gene HLA-DRB1*09, wherein: The first primer probe group includes a GAS-F3 primer, a GAS-B3 primer, a GAS-FIP primer, a GAS-BIP primer, a GAS-LF primer, a GAS-LB primer and a GAS-P probe, the nucleotide sequence of the GAS-F3 primer is shown in SEQ ID NO: 1, the nucleotide sequence of the GAS-B3 primer is shown in SEQ ID NO: 2, the nucleotide sequence of the GAS-FIP primer is shown in SEQ ID NO: 3, the nucleotide sequence of the GAS-BIP primer is shown in SEQ ID NO: 4, the nucleotide sequence of the GAS-LF primer is shown in SEQ ID NO: 5, the nucleotide sequence of the GAS-LB primer is shown in SEQ ID NO: 6, and the nucleotide sequence of the GAS-P probe is shown in SEQ ID NO: 7; The second primer probe set includes a GBS-F3 primer, a GBS-B3 primer, a GBS-FIP primer, a GBS-BIP primer, a GBS-LF primer, a GBS-LB primer and a GBS-P probe, the nucleotide sequence of the GBS-F3 primer is shown in SEQ ID NO:8, the nucleotide sequence of the GBS-B3 primer is shown in SEQ ID NO:9, the nucleotide sequence of the GBS-FIP primer is shown in SEQ ID NO:10, the nucleotide sequence of the GBS-BIP primer is shown in SEQ ID NO:11, the nucleotide sequence of the GBS-LF primer is shown in SEQ ID NO:12, the nucleotide sequence of the GBS-LB primer is shown in SEQ ID NO:13, and the nucleotide sequence of the GBS-P probe is shown in SEQ ID NO:14; The third primer probe group includes DRB-F3 primer, DRB-B3 primer, DRB-FIP primer, DRB-BIP primer, DRB-LF primer, DRB-LB primer and DRB-P1 probe, the nucleotide sequence of the DRB-F3 primer is shown in SEQ ID NO:15, the nucleotide sequence of the DRB-B3 primer is shown in SEQ ID NO:16, the nucleotide sequence of the DRB-FIP primer is shown in SEQ ID NO:17, the nucleotide sequence of the DRB-BIP primer is shown in SEQ ID NO:18, the nucleotide sequence of the DRB-LF primer is shown in SEQ ID NO:19, the nucleotide sequence of the DRB-LB primer is shown in SEQ ID NO:20, and the nucleotide sequence of the DRB-P1 probe is shown in SEQ ID NO:21.

[0024] The present invention provides a LAMP primer probe group for detecting group A streptococci, group B streptococci and human penicillin susceptibility gene RNA. The primer group comprises a first primer probe group designed for group A streptococci, a second primer probe group designed for group B streptococci and a third primer probe group designed for penicillin susceptibility gene. The primer group can simultaneously detect group A streptococci, group B streptococci and penicillin susceptibility gene, and improves sensitivity, reduces detection time and operation steps, and reduces the risk of severe rapid allergic reactions such as anaphylactic shock. At the same time, pathogens can be detected to know whether there are still live pathogens after medication, which is convenient for subsequent dynamic monitoring of pathogens and medication monitoring.

[0025] It is understandable that RNA of pathogens will generally be degraded after death, but DNA may still remain for a long time, so RNA testing can distinguish between dead and live bacteria. If the bacteria are dead, the patient does not need to take medication, thus achieving the purpose of reducing drug abuse; if DNA testing will produce false positives, RNA testing can reduce the occurrence of false positives; at the same time, the number of DNA copies of pathogens is small, and the number of RNA copies is much higher than DNA, so the detection sensitivity of RNA as the target is higher. Therefore, simultaneous detection of Group A Streptococcus and Group B Streptococcus 23S rRNA in infants and young children (such as newborns) indicates whether there is an immediate infection status and the detection of human penicillin susceptibility genes, which is beneficial to the subsequent selection of antibiotics and drug monitoring, and is of long-term significance.

[0026] In one embodiment of the present invention, the GAS-P probe, the GBS-P probe and the DRB-P1 probe are Taqman probes, wherein the 5′ end of the Taqman probe comprises a fluorescent reporter group, and the 3′ end of the Taqman probe comprises a fluorescent quencher group.

[0027] The present invention does not limit the type of fluorescent group labeled with each primer. The GAS-P probe, the GBS-P probe and the DRB-P1 probe can be Taqman probes or molecular beacon probes. Preferably, the probe of the probe group is a Taqman probe, wherein the 5′ end of the Taqman probe includes a fluorescent reporter group, and the 3′ end of the Taqman probe includes a fluorescent quencher group.

[0028] Furthermore, the fluorescent reporter group includes a FAM fluorescent group, a VIC fluorescent group, a ROX fluorescent group or a CY5 fluorescent group, and the fluorescent quencher group includes a BHQ1 quencher group, a BHQ2 quencher group or a BHQ3 quencher group.

[0029] Specifically, the 5' end of the TaqMan probe is labeled with a fluorescent reporter group (Reporter, R), and the 3' end is labeled with a fluorescent quencher group (Quencher, Q). When the probe is intact, the fluorescent energy emitted by the reporter group is absorbed by the quencher group, and the instrument cannot detect the fluorescent signal. In this method, when LAMP amplifies, the 5' exonuclease activity of the Bst DNA polymerase hydrolyzes the probe, and the reporter group is away from the quencher group, and its energy is not absorbed, that is, a fluorescent signal is generated. Therefore, after each amplification cycle, the fluorescent signal also has a synchronous exponential growth process like the target fragment, and the signal intensity represents the amount of template nucleic acid amplified.

[0030] In one embodiment of the present invention, in the first primer probe set designed for the conserved region of the 23S rRNA target sequence of Group A Streptococcus, the nucleotide sequence of the conserved region of the 23S rRNA target sequence is shown in SEQ ID NO:22.

[0031] In one embodiment of the present invention, in the second primer probe set designed for the conserved region of the group B streptococcal 23S rRNA target sequence, the nucleotide sequence of the conserved region of the 23S rRNA target sequence is shown in SEQ ID NO:23.

[0032] In one embodiment of the present invention, in the third primer probe set designed for the intronic region of human penicillin susceptibility gene HLA-DRB1*09, HLA-DRB1*09 is selected as the amplified region spanning introns (exon2+exon3), as the third exon, and its nucleotide sequence is shown in SEQ ID NO:26: , Further, the HLA-DRB1*09 intron-spanning region includes a first exon and a second exon, the sequence of the first exon is named exon2, and the sequence of the second exon is named exon3. Therefore, the HLA-DRB1*09 intron-spanning region includes exon2 and exon3, the nucleotide sequence of exon2 is shown in SEQ ID NO:24, and the nucleotide sequence of exon3 is shown in SEQ ID NO:25: The specific nucleotide sequence of SEQ ID NO:24 is as follows: GAAGCAGGATAAGTTTGAGTGTCATTTCTTCAACGGGACGGAGCGGGTGCGGTATCTGCACAGAGGCATCTATAACCAAGAGGAGAACGTGCGCTTCGACAGCGACGTGGGGGAGTACCGGGCGGTGACG GAGCTGGGGCGGCCTGTCGCCGAGTCCTGGAACAGCCAGAAGGACTTCCTGGAGCGGAGGCGGGCCGAGGTGGACACCGTGTGCAGACACAACTACGGGGTTGGTGAGAGCTTCACAGTGCAGAGGCGAG.

[0033] The specific nucleotide sequence of SEQ ID NO:25 is as follows: TCCATCCTGAGGTGACTGTGTATCCTGCCAAGACTCAGCCCCTGCAGCACCACAACCTCCTGGTCTGCTCTGTGAGTGGTTTCTATCCAGGCAGCATTGAAGTCAGGTGGTTCCGGAACGGCCAGGAAGAGAAGGCTGGGG TGGTGTCCACAGGCCTGATCCAGAATGGAGACTGGACCTTCCAGACCCTGGTGATGCTGGAAACAGTTCCTCGGAGTGGAGAAGTTTACACCTGCCAAGTGGAGCACCCAAGTGTGATGAGCCCTCTCACAGTGGAATGGA.

[0034] The present invention also provides a kit for detecting LAMP primer probe groups for group A streptococci, group B streptococci and human penicillin susceptibility gene RNA, the kit comprising the LAMP primer probe group for detecting group A streptococci, group B streptococci and human penicillin susceptibility gene RNA as described in any one of the above items.

[0035] In one embodiment of the present invention, the kit further comprises reverse transcriptase, UDG enzyme, Bst DNA polymerase, ABH blank control, ABH positive control and RNA sample preservation solution.

[0036] Specifically, the final concentration of the reverse transcriptase is 8-16U / reaction; the final concentration of the Bst DNA polymerase is 3-8U / reaction; and the final concentration of the UDG enzyme is 1-5U / reaction. It should be noted that the total volume of 20 μL in each tube is used as a reaction. Within these concentration ranges, higher sensitivity can be provided. Too low concentrations and too high concentrations are not sufficient to inhibit the LAMP primers from generating sufficient templates.

[0037] In one embodiment of the present invention, the components of the RNA sample preservation solution include: guanidine isothiocyanate, sodium dodecyl sulfate, xanthate, EDTA and Tris-HCl. The above RNA sample preservation solution is suitable for situations where samples need to be collected on site and stored outside the laboratory. It can ensure the quality of RNA and provide high-quality RNA samples for subsequent molecular biology experiments.

[0038] In one embodiment of the present invention, the components of the RNA sample preservation solution include 0.5~1.5M guanidine thiocyanate, 1%~2% sodium dodecyl sulfate, 0.1~0.2g / L xanthate, 0.02~0.03M EDTA and 0.1~0.3M Tris-HCl. Within the above concentration range, the RNA sample preservation solution has a good preservation effect and can be stored at room temperature for 1 month and at -20°C for at least 6 months.

[0039] The present invention provides a method for detecting group A streptococci, group B streptococci and human penicillin susceptibility gene RNA, comprising the following steps: Obtain a sample to be tested and a kit of a LAMP primer probe set as described above for detecting RNA of group A streptococci, group B streptococci and human penicillin susceptibility gene; use the detection kit to perform a LAMP amplification reaction on the sample to be tested to obtain a fluorescent Ct value; compare the fluorescent Ct value with a preset value, and judge the situation of group A streptococci, group B streptococci and human penicillin susceptibility gene according to the comparison result, wherein the detection method is for non-disease treatment or diagnosis purposes.

[0040] Specifically, in one embodiment of the present invention, LAMP technology is used, Bst DNA polymerase is used to amplify the conservative region of the 23S rRNA target sequence of group A streptococcus, and a FAM-labeled probe is used to identify group A streptococcus; the conservative region of the 23S rRNA target sequence of group B streptococcus is amplified, and a VIC-labeled probe is used to identify group B streptococcus; primers are designed for the cross-intron region of the HLA-DRB1*09 site of penicillin to amplify RNA products, and a ROX-labeled probe is used to identify the HLA-DRB1*09 sequence. Only 20 cycles of 3-channel detection are required under 60-65°C to achieve RNA detection of group A streptococcus, group B streptococcus and human penicillin susceptibility gene HLA-DRB1*09 within 20 minutes, that is, through the LAMP amplification of three target targets and the identification of three probes in a one-tube system, only a single constant temperature is required for detection, and it is also suitable for the rapid detection POCT scenario of a miniaturized constant temperature amplification instrument.

[0041] The technical solution of the present invention is further described in detail below in conjunction with specific embodiments and drawings. It should be understood that the following embodiments are only used to explain the present invention and are not used to limit the present invention.

[0042] Example 1 Design of primers and probes According to the primer design principle, Primer Explorer V5 software was used to design a special primer probe for detecting Group A Streptococcus 23S rRNA, and Group A Streptococcus 23S rRNA was selected as the amplification target sequence region, and its nucleotide sequence is shown in SEQ ID NO: 22: According to the primer design principle, Primer Explorer V5 software was used to design a special primer probe for detecting Group B Streptococcus 23S rRNA, and its nucleotide sequence is shown in SEQ ID NO: 23: According to the primer design principle, PrimerExplorer V5 software was used to design a special primer probe for detecting the conserved region of HLA-DRB1*09, and HLA-DRB1*09 was selected as the amplification region spanning introns (exon2+exon3), and its nucleotide sequence is shown in SEQ ID NO: 26. Specifically, in one embodiment, the primer probe set is shown in SEQ ID NO: 1-SEQ ID NO: 21, and the specific nucleotide sequences are shown in Tables 1 to 3: Table 1

[0043] Table 2

[0044] Table 3

[0045] Example 2 Preservation effect of RNA sample preservation solution The specific formula of RNA sample preservation solution is: 1M guanidine thiocyanate, 0.2% sodium dodecyl sulfate, 0.2g / L xanthate, 0.025M EDTA stock solution, 0.25M pH7.0 Tris-HCl stock solution. Group A Streptococcus and Group B Streptococcus pseudovirus purchased from Sangon Biotech (Shanghai) Co., Ltd. were used. Group A Streptococcus and Group B Streptococcus samples were diluted to 200 copies / mL and 2000 copies / mL using PBS (control group) and RNA sample preservation solution, respectively. The samples were stored at room temperature and -20±5℃ for comparison. The test results are shown in Tables 4 to 7: 2.1 Test at room temperature Table 4 Results of samples stored in PBS at room temperature

[0046] Table 5 Results of samples preserved in RNA sample preservation solution at room temperature

[0047] Table 6 Results of samples stored in PBS at -20℃

[0048] Table 7 Results of RNA samples stored in the preservation solution at 15-25℃

[0049] The test results show that the RNA sample preservation solution and PBS were stored at room temperature and -20±5°C for comparison. The results show that the RNA sample preservation solution of the present invention can be stored for 1 month at room temperature and for 6 months at -20±5°C.

[0050] Example 3 Formula of a test kit for rapid detection of group A streptococci, group B streptococci and human penicillin susceptibility gene RNA The kit comprises the following components and concentrations: The kit comprises components such as GAS-F3 primer, GAS-B3 primer, GAS-FIP primer, GAS-BIP primer, GAS-LF primer, GAS-LB primer, GAS-P detection probe, GBS-F3 primer, GBS-B3 primer, GBS-FIP primer, GBS-BIP primer, GBS-LF primer, GBS-LB primer, GBS-P detection probe, DRB-F3 primer, DRB-B3 primer, DRB-FIP primer, DRB-BIP primer, DRB-LF primer, DRB-LB primer, DRB-P detection probe, Bst DNA polymerase, reverse transcriptase and UDG enzyme.

[0051] Wherein, the GAS-F3 primer, GAS-B3 primer, GAS-FIP primer, GAS-BIP primer, GAS-LF primer, GAS-LB primer, GAS-P detection probe, GBS-F3 primer, GBS-B3 primer, GBS-FIP primer, GBS-BIP primer, GBS-LF primer, GBS-LB primer, GBS-P detection probe, DRB-F3 primer, DRB-B3 primer, DRB-FIP primer, DRB-BIP primer, DRB-LF primer, DRB-LB primer, and DRB-P detection probe are present in ABH reaction solution I; The Bst DNA polymerase, reverse transcriptase and UDG enzyme are present in ABH reaction solution II. The kit also includes RNA sample preservation solution, blank control and ABH positive control. The RNA sample preservation solution is: 1M guanidine isothiocyanate, 0.2% sodium dodecyl sulfate, 0.2g / L xanthate, 0.025M EDTA mother solution, 0.25M pH7.0 Tris-HCl mother solution.

[0052] ABH reaction solution I: contains 0.8-2mM dNTP (preferably 1-1.4mM), 0.1-0.5mM dUTP (preferably 0.2-0.3mM), primers and probes, wherein the concentration of GAS-F3 primer is preferably 0.15μmol / reaction, the concentration of GAS-B3 primer is preferably 0.15μmol / reaction, the concentration of GAS-FIP primer is preferably 1.4 μmol / reaction, the concentration of GAS-BIP primer is preferably 1.4 μmol / reaction, the concentration of GAS-LF primer is preferably 0.3 μmol / reaction, the concentration of GAS-LB primer is preferably 0.3 μmol / reaction, and the concentration of GAS-P detection probe is preferably 0.25 μmol / reaction; the concentration of GBS-F3 primer is preferably 0.2μmol / reaction, the concentration of GBS-B3 primer is preferably 0.2μmol / reaction, and the concentration of GBS-FIP primer is preferably 1.6 μmol / reaction, the GAS-BIP primer concentration is preferably 1.6 μmol / reaction, the GBS-LF primer concentration is preferably 0.3 μmol / reaction, the GBS-LB primer concentration is preferably 0.3 μmol / reaction, and the GBS-P detection probe concentration is preferably 0.3 μmol / reaction; the DRB-F3 primer concentration is preferably 0.25 μmol / reaction, the DRB-B3 primer concentration is preferably 0.25 μmol / reaction, the DRB-FIP primer concentration is preferably 1.3 μmol / reaction, the DRB-BIP primer concentration is preferably 1.3 μmol / reaction, the DRB-LF primer concentration is preferably 0.25 μmol / reaction, the DRB-LB primer concentration is preferably 0.25 μmol / reaction, and the DRB-P detection probe concentration is preferably 0.3 μmol / reaction.

[0053] ABH reaction solution II: contains 3-8U / reaction of Bst DNA polymerase (preferably 4-6U / reaction), 8-16U / reaction of reverse transcriptase (preferably 10-12U / reaction) and 1-5U / reaction of UDG enzyme (preferably 2U / reaction); ABH blank control: 1xTE solution.

[0054] ABH positive control: contains 2*10 6copies / mL pseudoviral RNA of group A streptococcal 23S rRNA target fragment, containing 2*10 6 copies / mL pseudoviral RNA of group B streptococcal 23S rRNA target fragment, containing 1*10 6 copies / mL human HLA-DRB1:09 target fragment pseudoviral RNA. All reagents included in the above kit can be prepared by conventional methods according to the instructions or purchased commercially.

[0055] Example 4 A group Streptococcus and group B Streptococcus and human penicillin susceptibility gene amplification detection method 4.1 Collect a pharyngeal swab from the newborn: Use a swab to gently wipe the newborn's pharynx, especially the tonsils and posterior pharyngeal wall area. Pay attention to the strength when wiping to avoid overstimulating the newborn. After wiping, place the swab in RNA sample preservation solution and send it for testing as soon as possible.

[0056] 4.2 RNA nucleic acid extraction: The nucleic acid extraction reagent produced by Shenzhen Huizhong Biotechnology Co., Ltd. ([Medical Device Registration Certificate Number / Product Technical Requirements Number] Guangdong Shenzhen Xiebei 20231029) was used for extraction, which contains DNase I for digestion of genomic DNA.

[0057] 4.3 Detection method: 1. Reaction solution preparation (reagent preparation area): Take out ABH reaction solution I and ABH reaction solution II from the kit, thaw at room temperature, shake and mix, and centrifuge briefly for 5 to 10 seconds for later use. Calculate the amount of each component according to the detection requirements of this experiment. The required amount of reaction solution = the number of samples to be tested + 1 ABH positive control + 1 blank control. The total system preparation for a single reaction is shown in Table 8 below: Table 8 Single-person reaction system

[0058] After preparation, vortex to mix, centrifuge for 10-20 seconds, dispense the reaction solution into PCR tubes at 20 μL per person, and label them.

[0059] 2. Sample addition (specimen preparation area): Add 5 μL of the mixed sample, negative control, positive control, and blank control to the above ABH reaction tube, with a total reaction volume of 25 μL. Close the tube cap, centrifuge instantly, and move to the amplification area for detection.

[0060] 3. LAMP amplification (amplification area): Place in fluorescent PCR instrument for amplification: Set the cycle conditions as shown in Table 9 and the quality control standards as shown in Table 10: Table 9

[0061] Table 10

[0062] Result judgment: According to the set baseline and threshold, the instrument will automatically display the detection Ct value. The result can be interpreted according to the Ct value. The test sample results are interpreted according to Table 11. The demonstration pictures corresponding to the serial numbers 1 to 8 in Table 11 are as follows: Figure 1 to Figure 8 shown.

[0063] Table 11

[0064] [Positive judgment value]: The ROC curve method was used to determine the positive judgment value of Ct for each channel of this kit, which was 15 based on the clinical sample test results.

[0065] Example 5 Sensitivity and specificity The kit of Example 2 and the detection method of Example 3 were used to perform sensitivity detection. The RNA fragments of Group A Streptococcus (GAS) 23S rRNA and Group B Streptococcus (GBS) 23S rRNA genes were mixed at a concentration of 1:1 and diluted to 100 copies / mL, 200 copies / mL, and 500 copies / mL, wherein each concentration contained 1000 copies / mL of HLA-DRB1:09 RNA. The detection method and judgment criteria of Example 4 were used for detection. The sensitivity detection results are shown in Table 12 below: Table 12

[0066] It can be seen from the above test results that when the template RNA concentration is greater than or equal to 200 copies / mL, the test results are all positive, and the detection rate is 100%. The value greater than 95% indicates that the sensitivity of the kit is high, wherein " / " represents no Ct value; in addition, the group A Streptococcus (GAS) strain and the group B Streptococcus (GBS) serotype III strain are mixed at a concentration of 1:1, each diluted to 100 CFU / mL, and the test is repeated 20 times. The detection method and judgment criteria of Example 4 are used for detection, and the sensitivity test results are all positive, and the group B Streptococcus (GBS) serotypes Ia, Ib, and V can also be detected at a sensitivity of 100 CFU / mL; samples of group C Streptococcus, group G Streptococcus, Streptococcus pneumoniae, viridans Streptococcus, Enterococcus faecalis, Enterococcus faecium, Neisseria gonorrhoeae, Lactobacillus acidophilus, Treponema pallidum, Chlamydia trachomatis, and Candida albicans are used to prepare 1*10 6 The simulated clinical sample concentration of CFU / mL was 1*10 6 CCU / mL of Mycoplasma hominis, 1*10 6The detection method of Example 3 was used to detect Trichomonas vaginalis and herpes simplex virus type II at a concentration of copies / mL. The results showed that the primer set and probe set of the present invention were negative for other common respiratory pathogens and group A streptococci and group B streptococci, and had no cross-talk, indicating that the primer set and probe set had specificity.

[0067] Example 6 Clinical sample testing Ten clinical samples were collected for testing using the detection method of Example 4. The test results of the clinical samples are shown in Table 13 below.

[0068] Table 13 Clinical sample test results

[0069] Note: (+) represents positive, (-) represents negative, and ( / ) represents no Ct value.

[0070] The test results of clinical samples are shown in Table 13. The results show that among the 10 clinical samples, 2 cases of GAS infection and 2 cases of GBS infection were detected, one of which was positive for the HLA-DRB1:09 gene, and penicillin should be used with caution, and other second-line antibiotics should be used instead to prevent the risk of allergic rescue. The remaining 3 cases of GAS or GBS common infection can use penicillin according to the skin test results. The above results show that the primer probe set of the present invention can effectively detect the detection of group A streptococcus 23S rRNA and group B streptococcus 23S rRNA in the sample to know whether there are still live pathogens after medication, which is convenient for subsequent medication monitoring of group A streptococcus and group B streptococcus infections.

[0071] The above are only preferred embodiments of the present invention, and do not limit the patent scope of the present invention. For those skilled in the art, the present invention may have various changes and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the patent protection scope of the present invention.

Claims

1. A LAMP primer probe set for detecting group A streptococci, group B streptococci and human penicillin susceptibility gene RNA, characterized in that: The primer probe set comprises: a first primer probe set designed for the conservative region of the 23S rRNA target sequence of group A streptococci, a second primer probe set designed for the conservative region of the 23S rRNA target sequence of group B streptococci, and a third primer probe set designed for the intron-spanning region of the human penicillin susceptibility gene HLA-DRB1*09, wherein: The first primer probe group includes a GAS-F3 primer, a GAS-B3 primer, a GAS-FIP primer, a GAS-BIP primer, a GAS-LF primer, a GAS-LB primer and a GAS-P probe, the nucleotide sequence of the GAS-F3 primer is shown in SEQ ID NO: 1, the nucleotide sequence of the GAS-B3 primer is shown in SEQ ID NO: 2, the nucleotide sequence of the GAS-FIP primer is shown in SEQ ID NO: 3, the nucleotide sequence of the GAS-BIP primer is shown in SEQ ID NO: 4, the nucleotide sequence of the GAS-LF primer is shown in SEQ ID NO: 5, the nucleotide sequence of the GAS-LB primer is shown in SEQ ID NO: 6, and the nucleotide sequence of the GAS-P probe is shown in SEQ ID NO: 7; The second primer probe set includes GBS-F3 primer, GBS-B3 primer, GBS-FIP primer, GBS-BIP primer, GBS-LF primer, GBS-LB primer and GBS-P probe, the nucleotide sequence of the GBS-F3 primer is shown in SEQ ID NO:8, the nucleotide sequence of the GBS-B3 primer is shown in SEQ ID NO:9, the nucleotide sequence of the GBS-FIP primer is shown in SEQ ID NO:10, the nucleotide sequence of the GBS-BIP primer is shown in SEQ ID NO:11, the nucleotide sequence of the GBS-LF primer is shown in SEQ ID NO:12, the nucleotide sequence of the GBS-LB primer is shown in SEQ ID NO:13, and the nucleotide sequence of the GBS-P probe is shown in SEQ ID NO:14; The third primer probe group includes DRB-F3 primer, DRB-B3 primer, DRB-FIP primer, DRB-BIP primer, DRB-LF primer, DRB-LB primer and DRB-P1 probe, the nucleotide sequence of the DRB-F3 primer is shown in SEQ ID NO:15, the nucleotide sequence of the DRB-B3 primer is shown in SEQ ID NO:16, the nucleotide sequence of the DRB-FIP primer is shown in SEQ ID NO:17, the nucleotide sequence of the DRB-BIP primer is shown in SEQ ID NO:18, the nucleotide sequence of the DRB-LF primer is shown in SEQ ID NO:19, the nucleotide sequence of the DRB-LB primer is shown in SEQ ID NO:20, and the nucleotide sequence of the DRB-P1 probe is shown in SEQ ID NO:

21.

2. The LAMP primer probe set for detecting Group A Streptococcus, Group B Streptococcus and human penicillin susceptibility gene RNA according to claim 1, characterized in that: The GAS-P probe, the GBS-P probe and the DRB-P1 probe are all Taqman probes or molecular beacon probes, and / or, The GAS-P probe, the GBS-P probe and the DRB-P1 probe are all Taqman probes, wherein the 5′ end of the Taqman probe includes a fluorescent reporter group, and the 3′ end of the Taqman probe includes a fluorescent quencher group.

3. The LAMP primer probe set for detecting Group A Streptococcus, Group B Streptococcus and human penicillin susceptibility gene RNA according to claim 2, characterized in that: The fluorescent reporter group includes a FAM fluorescent group, a VIC fluorescent group, a ROX fluorescent group or a CY5 fluorescent group.

4. The LAMP primer probe set for detecting Group A Streptococcus, Group B Streptococcus and human penicillin susceptibility gene RNA according to claim 2, characterized in that: The fluorescence quenching group includes a BHQ1 quenching group, a BHQ2 quenching group or a BHQ3 quenching group.

5. The LAMP primer probe set for detecting Group A Streptococcus, Group B Streptococcus and human penicillin susceptibility gene RNA according to claim 1, characterized in that: In the first primer probe set designed for the conservative region of the 23S rRNA target sequence of Group A Streptococcus, the nucleotide sequence of the conservative region of the 23S rRNA target sequence is shown in SEQ ID NO: 22; and / or, In the second primer probe set designed for the conservative region of the group B streptococcal 23S rRNA target sequence, the nucleotide sequence of the conservative region of the 23S rRNA target sequence is shown in SEQ ID NO: 23; and / or, In the second primer probe set designed for the human penicillin susceptibility gene HLA-DRB1*09 trans-intron region, the HLA-DRB1*09 trans-intron region includes a first exon and a second exon, the nucleotide sequence of the first exon is shown in SEQ ID NO:24, and the nucleotide sequence of the second exon is shown in SEQ ID NO:

25.

6. A kit for detecting group A streptococci, group B streptococci and human penicillin susceptibility gene RNA using a LAMP primer probe set, characterized in that: The kit comprises the LAMP primer probe set for detecting group A streptococci, group B streptococci and human penicillin susceptibility gene RNA as described in any one of claims 1 to 5.

7. The kit for detecting the LAMP primer probe set of group A streptococci, group B streptococci and human penicillin susceptibility gene RNA according to claim 6, characterized in that: The kit also includes reverse transcriptase, UDG enzyme, Bst DNA polymerase, ABH blank control, ABH positive control and RNA sample preservation solution.

8. The kit for detecting the LAMP primer-probe set of group A streptococci, group B streptococci and human penicillin susceptibility gene RNA according to claim 7, characterized in that: The components of the RNA sample preservation solution include: guanidine isothiocyanate, sodium dodecyl sulfonate, xanthate, EDTA and Tris-HCl.

9. The kit for detecting group A streptococci, group B streptococci and human penicillin susceptibility gene RNA using a LAMP primer probe set according to claim 8, characterized in that: The components of the RNA sample preservation solution include 0.5-1.5M guanidine isothiocyanate, 1%-2% sodium dodecyl sulfate, 0.1-0.2g / L xanthate, 0.02-0.03M EDTA and 0.1-0.3M Tris-HCl.

10. A method for detecting Group A Streptococcus, Group B Streptococcus and human penicillin susceptibility gene RNA, wherein the detection method is for non-disease treatment or diagnosis purposes, characterized in that: Includes steps: Obtain a sample to be tested and a kit for detecting the LAMP primer probe group for detecting RNA of group A streptococci, group B streptococci and human penicillin susceptibility gene as described in any one of claims 6 to 9; use the detection kit to perform LAMP amplification reaction on the sample to be tested to obtain a fluorescent Ct value; compare the fluorescent Ct value with a preset value, and judge the situation of group A streptococci, group B streptococci and human penicillin susceptibility gene according to the comparison result.

Images