Method for regulating and controlling content of fatty acid in tobacco by using NtMFP2 gene in tobacco and application of NtMFP2 gene

Abstract

The invention provides a method for regulating and controlling the content of fatty acid in tobacco. The method comprises the step of regulating and controlling the expression level of an NtMFP2 gene in the tobacco. The invention also provides an application of the NtMFP2 gene in tobacco. The NtMFP2 gene in tobacco can regulate and control the fatty acid content of tobacco leaves, the biomass of tobacco seedlings can be increased under sugar-free and high-sugar culture conditions by regulating and controlling the expression of the gene, the fatty acid content of the leaves in the tobacco emergence stage is increased, and then high-fat leaves and excellent growth of the tobacco seedlings are achieved.

Description

Technical Field

[0001] The invention relates to the field of plant genetic engineering, and in particular to a method and application of a NtMFP2 gene in tobacco to regulate the fatty acid content in tobacco. Background Art

[0002] Tobacco is an important economic crop that is widely planted and has a long history of cultivation. As a model plant of the Solanaceae family, tobacco has important scientific value in gene function research and molecular breeding. In tobacco, the composition, content and distribution of fatty acids play an important regulatory role in its response to various adverse stresses. Fatty acids are not only important components of plant growth and development and cell structure, but also have a significant impact on the quality and flavor of tobacco leaves. As the leaves develop, the fatty acid content and composition in tobacco leaves will also change.

[0003] Therefore, studying the fatty acids in tobacco and obtaining tobacco leaves with high fatty acid content is of great significance for improving the stress resistance and quality of tobacco and obtaining excellent style. Summary of the invention

[0004] In view of this, in order to at least partially solve at least one of the above-mentioned technical problems, the present invention provides a method and application of the NtMFP2 gene in tobacco to regulate the fatty acid content in tobacco.

[0005] According to an embodiment of one aspect of the present invention, a method for regulating the fatty acid content in tobacco is provided, which comprises the step of regulating the expression level of NtMFP2 gene in tobacco.

[0006] According to an embodiment of the present invention, the base sequence of the NtMFP2 gene is shown as SEQ ID No.1.

[0007] According to an embodiment of the present invention, the NtMFP2 gene encodes the polypeptide shown in SEQ ID No.2.

[0008] According to an embodiment of the present invention, the regulation includes increasing or decreasing the expression level of the NtMFP2 gene in tobacco.

[0009] According to an embodiment of the present invention, the expression level of the NtMFP2 gene in tobacco is reduced or the NtMFP2 gene is knocked out by using CRISPR-Cas9, zinc finger nuclease, TALENs or RNAi gene silencing technology.

[0010] According to an embodiment of the present invention, reducing the expression level of the NtMFP2 gene in tobacco or knocking out the NtMFP2 gene is performed by targeting the target site shown in SEQ ID No. 3 in the NtMFP2 gene.

[0011] According to an embodiment of the present invention, the NtMFP2 gene is knocked out using the CRISPR-Cas9 gene editing technology using the sgRNA sequence shown in SEQ ID No.4.

[0012] According to another embodiment of the present invention, there is provided an application of the NtMFP2 gene in tobacco, the application comprising any of the following applications:

[0013] (1) Improve the germination rate of tobacco seedlings;

[0014] (2) Increase the biomass of tobacco seedlings;

[0015] (3) Increase the content of short-chain and / or long-chain fatty acids in tobacco seedlings at the emergence stage;

[0016] (4) Used in tobacco breeding;

[0017] (5) regulating the fatty acid content of tobacco leaves; and / or

[0018] (6) Change the flavor of tobacco.

[0019] According to another embodiment of the present invention, there is provided a method for breeding homozygous non-transgenic mutant tobacco of NtMFP2 gene, comprising:

[0020] Construct a knockout vector according to the sgRNA sequence shown in SEQ ID No. 4;

[0021] The constructed knockout vector was transferred into Agrobacterium competent cells and infected tobacco leaves;

[0022] Homozygous non-transgenic mutant tobacco strains were obtained by cultivation and screening.

[0023] According to another embodiment of the present invention, a mutant gene of tobacco NtMFP2 gene is provided. The mutant gene sequence of tobacco NtMFP2 gene is a GC base deletion at the 15th and 16th bp of the target site base sequence shown in SEQ ID No.3.

[0024] According to the implementation scheme of the present invention, the NtMFP2 gene in tobacco can regulate the fatty acid content of tobacco leaves. By regulating the expression of this gene, the biomass of tobacco seedlings can be increased under sugar-free and high-sugar culture conditions, and the fatty acid content of tobacco leaves in the tobacco seedling stage can be increased, thereby achieving high-fat leaves and excellent growth of tobacco seedlings. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] The above and other objects, features and advantages of the present invention will become more apparent through the following description of the embodiments of the present invention with reference to the accompanying drawings, in which:

[0026] Figure 1 This is the electrophoresis diagram of NtMFP2 gene amplification in the embodiment of the present invention;

[0027] Figure 2 This is a comparison chart of the expression of NtMFP2 in different tissues according to the embodiment of the present invention;

[0028] Figure 3 This is a schematic diagram of the construction of the NtMFP2 gene knockout vector according to an embodiment of the present invention;

[0029] Figure 4 This is a schematic diagram of the editing form of the NtMFP2 target site in an embodiment of the present invention;

[0030] Figure 5 This is a statistical diagram of the germination rate of NtMFP2 mutants under different culture media in the examples of the present invention;

[0031] Figure 6 The biomass statistics of NtMFP2 mutants under different culture media in the examples of the present invention;

[0032] Figure 7 This is a diagram showing the results of the identification of the short-chain fatty acid phenotype of the NtMFP2 mutant at the seedling stage in an embodiment of the present invention;

[0033] Figure 8 The figures are the results of the phenotypic identification of medium- and long-chain fatty acids in the seedling stage of the NtMFP2 mutant according to the embodiment of the present invention; (a) is a heat map of medium- and long-chain fatty acid clustering; (b) is a bar graph of the medium- and long-chain fatty acid contents that are downregulated in NtMFP2 compared with K326; and (c) is a bar graph of the contents of the four medium- and long-chain fatty acids that are most upregulated in NtMFP2 compared with K326. DETAILED DESCRIPTION

[0034] Below, embodiments of the present invention will be described with reference to the accompanying drawings. However, it should be understood that these descriptions are exemplary only and are not intended to limit the scope of the present invention. In the following detailed description, for ease of explanation, many specific details are set forth to provide a comprehensive understanding of embodiments of the present invention. However, it is apparent that one or more embodiments may also be implemented without these specific details. In addition, in the following description, descriptions of known structures and technologies are omitted to avoid unnecessary confusion of concepts of the present invention.

[0035] The terms used herein are only for describing specific embodiments and are not intended to limit the present invention. The term "comprising" used herein indicates the existence of features, steps, operations, but does not exclude the existence or addition of one or more other features.

[0036] In the case of using expressions such as "at least one of A, B, and C, etc.", it should generally be interpreted in accordance with the meaning of the expression generally understood by those skilled in the art (for example, "a system having at least one of A, B, and C" should include but is not limited to a system having A alone, B alone, C alone, A and B, A and C, B and C, and / or A, B, C, etc.). In the case of using expressions such as "at least one of A, B, or C, etc.", it should generally be interpreted in accordance with the meaning of the expression generally understood by those skilled in the art (for example, "a system having at least one of A, B, or C" should include but is not limited to a system having A alone, B alone, C alone, A and B, A and C, B and C, and / or A, B, C, etc.).

[0037] The term "homology" refers to the level of similarity or percent identity between polynucleotide sequences in terms of percent nucleotide position identity (i.e., sequence similarity or identity). The term homology used herein also refers to the concept of similar functional properties between different polynucleotide molecules, such as promoters with similar functions may have homologous cis elements. When polynucleotide molecules specifically hybridize to form duplex molecules under specific conditions, they are homologous. Under these conditions (referred to as stringent hybridization conditions), a polynucleotide molecule can be used as a probe or primer to identify another polynucleotide molecule with a common homology.

[0038] The term "promoter" refers to a polynucleotide molecule which in its natural state is located upstream or 5' of the translation start codon of an open reading frame (or protein coding region) and is involved in the recognition and binding of RNA polymerase II and other proteins (trans-acting transcription factors) to initiate transcription.

[0039] The term "operably linked" refers to a first polynucleotide molecule (e.g., a promoter) being linked to a second transcribable polynucleotide molecule (e.g., a target gene), wherein the polynucleotide molecules are arranged such that the first polynucleotide molecule affects the function of the second polynucleotide molecule. Preferably, the two polynucleotide molecules are part of a single continuous polynucleotide molecule, and more preferably are adjacent. For example, if a promoter regulates or mediates transcription of a target gene in a cell, then the promoter is operably linked to the target gene.

[0040] The term "recombinant plant expression vector" refers to one or more DNA vectors used to achieve plant transformation; these vectors are often referred to as binary vectors in the art. Binary vectors, together with vectors with helper plasmids, are most commonly used for Agrobacterium-mediated transformation. Binary vectors typically include: cis-acting sequences required for T-DNA transfer, selection markers engineered to be expressed in plant cells, heterologous DNA sequences to be transcribed, etc.

[0041] The term "transformation" is a process by which a heterologous DNA sequence is introduced into a host cell or organism.

[0042] The term "expression" refers to the transcription and / or translation of an endogenous gene or a transgene in a plant cell.

[0043] The term "recombinant host cell strain" or "host cell" means a cell comprising a polynucleotide of the present invention, regardless of the method used for insertion to produce a recombinant host cell, such as direct uptake, transduction, mating, or other methods known in the art. The exogenous polynucleotide may be maintained as a non-integrating vector such as a plasmid or may be integrated into the host genome. The host cell may be a prokaryotic cell or a eukaryotic cell, and the host cell may also be a monocotyledonous or dicotyledonous plant cell.

[0044] In the process of realizing the concept of the present invention, it was found that the related art showed that in addition to its peroxisomal function, the fatty acid β-oxidation multifunctional protein (Multifunctional protein, MFP) in rice can also regulate the localization or translation of mRNA through interaction with microtubules. The seedlings of the mfp2 mutant in Arabidopsis thaliana require exogenous sucrose supply to grow normally. In the mutation of the abnormal inflorescence meristem gene AIM1 (AtMFP2 homologous gene), mature plants show abnormal inflorescence meristem phenotypes. It shows that different MFP genes have different effects, and the Arabidopsis mfp2-1 and aim1 double mutants will stop developing in the early stage of embryonic development. An MFP gene was also identified in tobacco. When NtMFP was inhibited by RNAi, transgenic tobacco showed dwarfing, early senescence and reduced expression of jasmonic acid response genes.

[0045] At present, there is no relevant technology to effectively change the fatty acid content in tobacco leaves by regulating the expression of MFP genes. Therefore, studying and applying the newly identified NtMFP2 gene can not only obtain tobacco with high fatty acid content, but also provide a new strategy for tobacco quality breeding. The present invention is proposed in this context, aiming to provide a technical solution for increasing the fatty acid content of tobacco leaves by regulating the expression of NtMFP2 gene, so as to improve the quality of tobacco, obtain high-fat, excellent style tobacco leaves, and thus achieve economic benefits.

[0046] According to an embodiment of one aspect of the present invention, a method for regulating the fatty acid content in tobacco is provided, which comprises the step of regulating the expression level of NtMFP2 gene in tobacco.

[0047] According to the implementation scheme of the present invention, the NtMFP2 gene in tobacco can regulate the fatty acid content of tobacco leaves. By regulating the expression of this gene, the biomass of tobacco seedlings can be increased under sugar-free and high-sugar culture conditions, and the fatty acid content of tobacco leaves in the tobacco seedling stage can be increased, thereby achieving high-fat leaves and excellent growth of tobacco seedlings.

[0048] In some specific embodiments of the present invention, the editing vector of the NtMFP2 gene can be constructed by conventional gene editing technology or gene knockout vector construction methods, or a recombinant plant expression vector containing the NtMFP2 gene can be constructed according to conventional methods in the art. These methods are all well known to those skilled in the art; for example, the NtMFP2 gene can be operably connected to an expression control element to obtain a recombinant plant expression vector that can express the gene in plants; the recombinant plant expression vector comprises a promoter, a CDS sequence of the NtMFP2 gene, and a terminator; the promoter can be a constitutive promoter, an inducible promoter, a tissue or organ-specific promoter, and the terminator sequence can be taken from the Ti-plasmid of Agrobacterium tumefaciens, such as the octopine synthase and nopaline synthase termination regions. The vector may also contain a selective marker gene for selecting transformed cells, which is used to select transformed cells or tissues. Marker genes include genes encoding antibiotic resistance and genes that confer herbicide resistance, etc.

[0049] In some specific embodiments of the present invention, a kit is provided for controlling the fatty acid content in tobacco, comprising constructing an editing vector of the NtMFP2 gene by conventional gene editing technology or a gene knockout vector construction method, or constructing a recombinant plant expression vector containing the NtMFP2 gene according to conventional methods in the art, as well as other conventional optional components, such as marker genes, etc., or essential components required for the selection of gene editing methods, etc.

[0050] According to an embodiment of the present invention, the base sequence of the NtMFP2 gene is shown as SEQ ID No.1.

[0051] The sequence of SEQ ID No.1 is as follows:

[0052] ATGAGCTCAAAGAGTAGAAGTACCATTGAGGTTGGAGCTGATGGAGTTGCTGTTATCACCATTGTTAACCCTCCTGTCAATTCTCTTCCTTAGATGTTTTGTACAGCTTGGAAGAGAAATTACAGGAAGGCTTAAGGAGAGATGATGTGAAGGCAATTGTTGTGATAGGTTATCAAGGAAATTTCTCGGGTGGTTTCCATATCTCT TCCTTTGCTGACT TGCAACA

[0053] According to an embodiment of the present invention, the NtMFP2 gene encodes the polypeptide shown in SEQ ID No.2.

[0054] The sequence of SEQ ID No.2 is as follows:

[0055] *.

[0056] According to an embodiment of the present invention, NtMFP2 is a gene encoding a multifunctional protein (MFP) for β-oxidation of fatty acids. The catabolism of fatty acids is mainly carried out through the β-oxidation cycle. The multifunctional protein MFP has hydratase, dehydrogenase, isomerase and epimerase activities, catalyzing the hydration step of β-oxidation. MFP is mainly localized in peroxisomes and is induced during development and growth.

[0057] According to an embodiment of the present invention, the regulation includes increasing or decreasing the expression level of the NtMFP2 gene in tobacco.

[0058] According to an embodiment of the present invention, the expression level of the NtMFP2 gene in tobacco is reduced or the NtMFP2 gene is knocked out by using CRISPR-Cas9, zinc finger nuclease, TALENs or RNAi gene silencing technology.

[0059] In some specific embodiments of the present invention, how to increase or decrease the expression level of the NtMFP2 gene in tobacco can be achieved by various conventional technical means by those skilled in the art; for example, by constructing an overexpression vector of the NtMFP2 gene, transforming the plant by Agrobacterium-mediated genetic transformation, and obtaining an overexpression strain of the NtMFP2 gene; or by knocking out or interfering with the NtMFP2 gene in tobacco or the NtMFP2 homologous gene in other plants by CRISPR or VIGS methods, so that the NtMFP2 gene in tobacco or the NtMFP2 homologous gene in other plants is deleted or mutated, or the expression level of the NtMFP2 gene is reduced, thereby achieving the regulation of the fatty acid content in tobacco.

[0060] According to the embodiments of the present invention, by using CRISPR-Cas9, zinc finger nuclease, TALENs or RNAi gene silencing technology, the expression of peroxidized fatty acid β-oxidation multifunctional protein can be achieved by reducing the expression level of NtMFP2 gene, thereby regulating the fatty acid content in tobacco; the fatty acid content in tobacco can also be regulated by knocking out the NtMFP2 gene. The present invention does not impose specific restrictions on the regulation method or knockout method of the expression level of the NtMFP2 gene. The target sites of the regulation method or knockout method of the expression level of multiple genes can be selected according to various methods, and one or more target sites can be selected to regulate or knock out the expression level of the gene.

[0061] According to an embodiment of the present invention, reducing the expression level of the NtMFP2 gene in tobacco or knocking out the NtMFP2 gene is performed by targeting the target site shown in SEQ ID No. 3 in the NtMFP2 gene.

[0062] According to an embodiment of the present invention, the expression level of NtMFP2 gene or the knockout of NtMFP2 gene is located at 207bp~227bp in the base sequence of NtMFP2 gene as shown in SEQ ID No.1, that is, the underlined part.

[0063] The SEQ ID No.3 sequence of the target site is as follows:

[0064] TCCTTTGCTGACTTGCAACA.

[0065] According to an embodiment of the present invention, the NtMFP2 gene is knocked out using the CRISPR-Cas9 gene editing technology using the sgRNA sequence shown in SEQ ID No.4.

[0066] According to an embodiment of the present invention,

[0067] The sgRNA sequence is shown below in SEQ ID No. 4:

[0068] TCCTTTGCTGACTTGCAACAAGG.

[0069] According to the implementation scheme of the present invention, the NtMFP2 gene in tobacco is knocked out by CRISPR-Cas9 gene editing technology, and corresponding primers are designed for the sgRNA sequence corresponding to the target site, which can quickly and efficiently achieve efficient gene editing in a variety of cell types and species, thereby improving the success rate and efficiency of gene editing. The sgRNA sequence shown in SEQ ID No.4 can specifically identify and cut the target site SEQ ID No.3 sequence in the NtMFP2 gene, thereby achieving precise gene knockout.

[0070] According to another embodiment of the present invention, there is provided an application of the NtMFP2 gene in tobacco, the application comprising any of the following applications:

[0071] (1) Improve the germination rate of tobacco seedlings;

[0072] (2) Increase the biomass of tobacco seedlings;

[0073] (3) Increase the content of short-chain and / or long-chain fatty acids in tobacco seedlings at the emergence stage;

[0074] (4) Used in tobacco breeding;

[0075] (5) regulating the fatty acid content of tobacco leaves; and / or

[0076] (6) Change the flavor of tobacco.

[0077] According to the embodiment of the present invention, knocking out the NtMFP2 gene by CRISPR-Cas9 technology can significantly improve the germination rate of tobacco seedlings. This is because the knockout of the NtMFP2 gene may reduce the impact of certain adverse factors in the fatty acid metabolism process, thereby promoting the germination of seedlings; after knocking out the NtMFP2 gene, the biomass of tobacco seedlings increased significantly, which may be due to changes in the fatty acid metabolic pathway, allowing more energy and nutrients to be allocated to the growth and development process; knocking out the NtMFP2 gene through CRISPR-Cas9 technology can increase the content of short-chain and long-chain fatty acids in tobacco seedlings during the emergence period, which helps to improve the stress resistance and quality of tobacco; knocking out or regulating the NtMFP2 gene can be used as an important means of tobacco breeding. Through gene editing technology, tobacco varieties with higher germination rate, larger biomass and better stress resistance can be cultivated; knocking out the NtMFP2 gene through CRISPR-Cas9 technology can effectively regulate the fatty acid content in tobacco leaves, which helps to optimize the chemical composition of tobacco and improve its quality and economic value; changes in the fatty acid metabolic pathway may affect the flavor of tobacco. By knocking out the NtMFP2 gene, the flavor of tobacco can be changed to make it more in line with market demand.

[0078] According to another embodiment of the present invention, there is provided a method for breeding homozygous non-transgenic mutant tobacco of NtMFP2 gene, comprising:

[0079] Construct a knockout vector according to the sgRNA sequence shown in SEQ ID No. 4;

[0080] The constructed knockout vector was transferred into Agrobacterium competent cells and infected tobacco leaves;

[0081] Homozygous non-transgenic mutant tobacco strains were obtained by cultivation and screening.

[0082] According to an embodiment of the present invention, by knocking out the NtMFP2 gene in tobacco breeding, homozygous non-transgenic mutant tobacco plants can be obtained quickly and efficiently. Agrobacterium competent cells are used as host cells to screen strains in which the NtMFP2 gene is homozygous edited, and T0 generation transgenic positive strains are obtained. One non-transgenic homozygous strain can be obtained in the T1 generation.

[0083] According to another embodiment of the present invention, a mutant gene of tobacco NtMFP2 gene is provided. The mutant gene sequence of tobacco NtMFP2 gene is a GC base deletion at the 15th and 16th bp of the target site base sequence shown in SEQ ID No.3.

[0084] According to an embodiment of the present invention, the NtMFP2 gene was edited by CRISPR-Cas9 technology, thereby achieving a "GC" base deletion at the target site of the NtMFP2 gene, and the mutation type was a frameshift mutation.

[0085] The scheme of the present invention will be further explained below with reference to specific examples. Unless otherwise stated in the following examples, conventional commercial reagents are used.

[0086] Example 1 Amplification of NtMFP2 gene

[0087] Based on the genome and expression information of tobacco genome database and RNA-seq database, specific primers were designed and CDS of tobacco buds was used as template to specifically amplify NtMFP2 gene. The electrophoresis diagram is shown in Figure 1 shown.

[0088] Amplification primers:

[0089] BD-NtMFP2 F, the sequence is shown in SEQ ID No.5:

[0090] GCCATGGAGGCCGAATTC ATGAGCTCAAAGAGT .

[0091] BD-NtMFP2 R, the sequence is shown in SEQ ID No.6:

[0092] CTGCAGGTCGACGGATCC TCAGAACATAACAGA .

[0093] The first half of the amplification primer is the specific primer of the target gene, and the underlined part in the second half is the homology arm of the sequencing vector.

[0094] Figure 1 This is the electrophoresis diagram of NtMFP2 gene amplification in the embodiment of the present invention.

[0095] according to Figure 1 It can be seen that the NtMFP2 gene was successfully amplified, with a size of approximately 2000 bp.

[0096] After constructing the gene into a sequencing vector, the sequence information of the gene is obtained through first-generation sequencing.

[0097] NtMFP2 is 1944 bp in length, and its sequence is shown in SEQ ID No. 1. It encodes 647 amino acids, and its amino acid polypeptide sequence is shown in SEQ ID No. 2. Sequence comparison revealed that this gene has three homologous genes in tobacco, and they are similar to each other.

[0098] Example 2 Tissue-specific expression detection

[0099] Samples of different tissues were collected from different tobacco plants, including young leaves, mature leaves, petioles, veins, stems, roots and buds.

[0100] The extracted RNA was sequenced using high-throughput sequencing technology to obtain the expression data of the NtMFP2 gene in different tissues. Figure 2 shown.

[0101] Figure 2 This is a comparison chart of the expression of NtMFP2 in different tissues according to the embodiment of the present invention.

[0102] according to Figure 2 It can be seen that the expression level of NtMFP2 gene is highest in the flower bud, and the expression level in other parts is relatively low, that is, TPM<1.

[0103] Example 3 Construction of NtMFP2 gene knockout vector

[0104] Primers were designed according to the sgRNA sequence shown in SEQ ID No.4.

[0105] The double-stranded sgRNA primers are as follows:

[0106] The sequence of BsaI-sgRNA-F is as follows SEQ ID No.7:

[0107] 5'-TGCATCCTTTTGCTGACTTGCAACA.

[0108] The sequence of BsaI-sgRNA-R is as follows SEQ ID No.8:

[0109] 5'-AAACTGTTGCAAGTCAGCAAAGGA.

[0110] After annealing, a double-stranded sgRNA target product with a linker is obtained, and the target product is purified. The linearized gene editing vector and the target product are ligated using T4 DNA ligase, and the ligated product is transformed into DH5α E. coli competent cells. The transformed E. coli is spread on an LB resistance screening plate containing antibiotics (kanamycin, Kan) and inverted at 37°C overnight to screen positive clones. The positive monoclonal colonies with accurate sequencing are selected for culture, and the plasmid is extracted to complete the construction. Figure 3 shown.

[0111] Figure 3 This is a schematic diagram of the construction of the NtMFP2 gene knockout vector according to an embodiment of the present invention.

[0112] Example 4 NtMFP2 homozygous non-transgenic mutant

[0113] The NtMFP2 gene knockout vector plasmid obtained in Example 3 was transformed into the competent Agrobacterium LBA4404 by the electroporation transformation method. After transformation, SOC medium was added and cultured at 30°C and 100 rpm for 1 h. After culture, the bacterial solution was spread on a resistant LB plate containing rifampicin (Rif) and kanamycin (Kan). After inverted culture at 30°C for 48 h, a single colony was selected and cultured in an LB liquid medium containing the same resistance at 28°C and 200 rpm for 16 h. After culture, the bacteria were maintained (600 µL bacterial solution + 600 µL 50% glycerol). After PCR verification, the bacterial solution was expanded and genetic transformation of tobacco was carried out.

[0114] The K326 variety was used as the chassis, and tobacco leaves were infected by the leaf disc method. T0 generation transgenic positive lines were selected by kanamycin resistance screening and transgenic molecular identification, and sequenced using target site detection primers. The target site detection primer sequences are as follows.

[0115] The sgRNA JC-F sequence is shown in SEQ ID No.9:

[0116] 5′-TTAGGTTTACCCGCCAATA-3′.

[0117] The sgRNA JC-R sequence is shown in SEQ ID No.10:

[0118] 5′-CGGTGCCACTTTTTCAAGTT-3′.

[0119] The strains with homozygous editing of NtMFP2 gene were screened to obtain the T0 generation transgenic positive strains. In the T1 generation, transgenic and target site sequencing was performed to identify and screen a non-transgenic homozygous strain. The first generation sequencing confirmed that the target site of NtMFP2 gene of this strain had a "GC" base deletion, and the mutation type was a frameshift mutation, as follows Figure 4 shown.

[0120] Figure 4 Schematic diagram of the editing format of the NtMFP2 target site in an embodiment of the present invention.

[0121] according to Figure 4 It can be seen that the 15th and 16th bp of the NtMFP2 target site have "GC" base deletions.

[0122] Example 5 Phenotypic Analysis of NtMFP2 Mutants

[0123] The germination rate of the NtMFP2 mutant was determined by preparing different MS culture media, that is, adding 4.43 g of M519 and 25 g of sucrose to 1000 mL of culture medium, adjusting the pH value to 5.8 and adding 9 g of agar, and analyzing the changes in germination rate under different culture conditions.

[0124] Among them, normal MS medium was used as the control group, high-sugar MS medium with twice the amount of sucrose (50 g sucrose) and sugar-free MS medium without sucrose were used as the experimental groups. The seeds were vernalized at 4°C for three days and then cultured in different culture media in a tissue culture room at 25°C with a constant temperature and long daylight. The results are as follows Figure 5 shown.

[0125] The phenotypes of 18-day-old seedlings of NtMFP2 mutants grown on different culture media were analyzed and statistically analyzed. Figure 6 shown.

[0126] Figure 5 This is a statistical diagram of the germination rate of NtMFP2 mutants under different culture media in the examples of the present invention; Figure 6 This is a statistical graph of the biomass of the NtMFP2 mutant under different culture media in the examples of the present invention.

[0127] according to Figure 5 It can be seen that in normal culture medium, the germination rates of NtMFP2 and the control group K326 (CK) are similar, and K326 is slightly higher than NtMFP2; under sugar-free culture conditions, both the control and NtMFP2 germinate in advance, and NtMFP2 germinates almost completely on the fifth day, and the germination rate of NtMFP2 is higher than that of the control; in 2-fold sucrose culture medium, the germination of both the control and NtMFP2 is inhibited, and the germination rate on the fourth day is much lower than that of sugar-free culture medium and normal culture medium, and the germination rate of NtMFP2 is higher than that of the control. This shows that the NtMFP2 mutant has a phenotype with increased germination rate under sugar-free and high-sugar culture conditions.

[0128] according to Figure 6 It can be seen that under the culture condition of 2 times sugar, the leaf area of ​​the mutant was significantly higher than that of the control group, and under the culture condition of no sugar, the maximum leaf length of the mutant was significantly higher than that of the control group, indicating that the NtMFP2 mutant has a phenotype of increased biomass under the culture conditions of no sugar and 2 times sugar.

[0129] Example 6 Identification of short-chain fatty acid phenotypes of NtMFP2 mutants at the seedling stage

[0130] The content of short-chain fatty acids in the seedling leaves of the NtMFP2 mutant and the control chassis material K326 at the seedling stage, that is, the seedlings 10 days after germination, with two cotyledons fully expanded, was measured. Targeted metabolomics was used to detect short-chain fatty acids and medium-chain fatty acids respectively. The detection method used an LC / MS platform based on multiple reaction monitoring mode (MRM) to detect the content. After sample collection, target metabolite extraction, standard curve establishment, method validation, and LC-MS / MS detection steps, data analysis was performed, and a total of 10 short-chain fatty acids were detected. The results are as follows Figure 7 shown.

[0131] Figure 7 This is a diagram showing the results of identifying the short-chain fatty acid phenotype of the NtMFP2 mutant at the seedling stage in an example of the present invention.

[0132] according to Figure 7 It can be seen that 9 out of 10 short-chain fatty acids were significantly upregulated in NtMFP2 compared with K326 (FC>1.2 or FC<0.833 and P-value<0.05), the isovaleric acid content of K326 was 0.06 μg / g, and that of NtMFP2 mutant was 0.08 μg / g, which was increased by 1.33 times. This indicates that the NtMFP2 mutant has a phenotype with high short-chain fatty acid content in leaves at the seedling stage, and it can be proved that the NtMFP2 gene can regulate the content of short-chain fatty acids in tobacco leaves.

[0133] Example 7 Identification of long-chain fatty acid phenotypes of NtMFP2 mutants at the seedling stage

[0134] The same method as in Example 6 was used to determine the content of medium and long chain fatty acids. The results of the 39 fatty acids determined were as follows: Figure 8 shown.

[0135] Figure 8 The figures are the results of the phenotypic identification of medium- and long-chain fatty acids in the seedling stage of the NtMFP2 mutant according to the embodiment of the present invention; (a) is a heat map of medium- and long-chain fatty acid clustering; (b) is a bar graph of the medium- and long-chain fatty acid contents that are downregulated in NtMFP2 compared with K326; and (c) is a bar graph of the contents of the four medium- and long-chain fatty acids that are most upregulated in NtMFP2 compared with K326.

[0136] exist Figure 8 In the fatty acid nomenclature, C numbers reflect the number of carbon atoms, the number and position of double bonds.

[0137] according to Figure 8 It can be seen that among the 39 fatty acids measured, NtMFP2 had two fatty acids significantly downregulated compared with K326, namely C12:0 downregulated to 0.74 times and C18:1(n-7)T downregulated to 0.43 times; 24 substances were significantly upregulated, upregulated to 1.23-7.80 times, among which the four substances with the highest degree of upregulation were C15:1 upregulated to 4.07 times, C19:1(n-9)T upregulated to 4.73 times, C22:2 upregulated to 6.83 times, and C20:5 upregulated to 7.80 times. Cluster analysis showed that the content of medium- and long-chain fatty acids in NtMFP2 was higher than that in K326 except for two fatty acids, which proved that the NtMFP2 gene could regulate the content of long-chain fatty acids in tobacco leaves.

[0138] The above specific embodiments further illustrate the purpose, technical solutions and beneficial effects of the present invention in detail. It should be understood that the above are only specific embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the protection scope of the present invention.

Claims

1. A method for regulating the fatty acid content in tobacco, comprising the step of regulating the expression level of NtMFP2 gene in tobacco.

2. The method according to claim 1, wherein: The base sequence of the NtMFP2 gene is shown in SEQ ID No.

1.

3. The method according to claim 1, wherein: The NtMFP2 gene encodes the polypeptide shown in SEQ ID No.

2.

4. The method according to any one of claims 1 to 3, wherein The regulation includes increasing or decreasing the expression level of the NtMFP2 gene in tobacco.

5. The method according to any one of claims 1 to 3, wherein: The method comprises reducing the expression level of the NtMFP2 gene in tobacco or knocking out the NtMFP2 gene by using CRISPR-Cas9, zinc finger nuclease, TALENs or RNAi gene silencing technology.

6. The method according to claim 5, wherein: Reducing the expression level of the NtMFP2 gene in tobacco or knocking out the NtMFP2 gene is carried out by targeting the target site shown in SEQ ID No. 3 in the NtMFP2 gene.

7. The method according to claim 6, wherein: The NtMFP2 gene was knocked out using CRISPR-Cas9 gene editing technology using the sgRNA sequence shown in SEQ ID No.

4.

8. Application of NtMFP2 gene in tobacco, wherein: The application includes any of the following applications: (1) Improve the germination rate of tobacco seedlings; (2) Increase the biomass of tobacco seedlings; (3) Increase the content of short-chain and / or long-chain fatty acids in tobacco seedlings at the emergence stage; (4) Used in tobacco breeding; (5) regulating the fatty acid content of tobacco leaves; and / or (6) Change the flavor of tobacco.

9. A method for breeding homozygous non-transgenic mutant tobacco of NtMFP2 gene, comprising: Construct a knockout vector according to the sgRNA sequence shown in SEQ ID No. 4; The constructed knockout vector was transferred into Agrobacterium competent cells and infected tobacco leaves; Homozygous non-transgenic mutant tobacco strains were obtained by cultivation and screening.

10. A mutant gene of tobacco NtMFP2 gene, wherein: The mutant gene sequence of the tobacco NtMFP2 gene is a GC base deletion at the 15th bp and the 16th bp of the target site base sequence shown in SEQ ID No.3.

Images