Application of Turnip Crinkle Virus P8 in Inhibiting Degradation of mRNA Decay Substrates

Abstract

The present invention provides the use of the P8 gene, or the protein encoded by the P8 gene, or a recombinant vector or host bacteria containing the coding region of the P8 gene in increasing the expression of GFP and / or inhibiting the degradation of mRNA decay substrates with GFP as a reporter gene. The present invention has found that P8 has a silencing inhibition function, can inhibit the degradation of nonsense-mediated mRNA decay substrates with GFP as a reporter gene and the degradation of endogenous nonsense-mediated mRNA decay (NMD) substrates of Arabidopsis, can increase the mRNA expression of AT1G0106020, RPS6, SMG7, AT5G35490, AT5G64430, AT1G36730, AT4G3900, AT5G22570, and reduce the expression of AT1G72450 and AT2G400. The research results will lay a foundation for clarifying the function of P8.

Description

Technical Field

[0001] The invention belongs to the technical field of gene engineering, and in particular relates to the application of turnip crinkle virus P8 in inhibiting the degradation of mRNA decay substrates. Background Art

[0002] mRNA decay, as a highly conserved self-protection mechanism, plays an important role in resisting viral invasion (Ge L, Cao B, Qiao R, Cui H, Li S, Shan H, Gong P, Zhang M, Li H, WangA, Zhou X, Li F. SUMOylation-modified Pelota-Hbs1 RNA surveillance complexrestricts the infection of potyvirids in plants. Mol Plant. 2023,16(3):632-642.; Wu J, Zhang Y, Li F, Zhang X, Ye J, Wei T, Li Z, Tao X, Cui F, Wang X,Zhang L, Yan F, Li S, Liu Y, Li D, Zhou X, Li Y. Plant virology in the 21stcentury in China: Recent advances and future directions. J Integr Plant Biol.2023a, doi: 10.1111 / jipb.13580.). mRNA decay includes nonsense-mediated mRNA decay (NMD), Staufen1-mediated mRNA decay (SMD) and structure-mediated RNA decay (SRD). Upstream frameshift 1 (UPF1) is a key component of the three mRNA decay pathways (GeL, Cao B, Qiao R, Cui H, Li S, Shan H, Gong P, Zhang M, Li H, Wang A, Zhou X,Li F. SUMOylation-modified Pelota-Hbs1 RNA surveillance complex restricts the infection of potyvirids in plants. Mol Plant. 2023,16(3):632-642.).Studies have found that NMD, SMD and SRD are all involved in antiviral defense (May JP, Simon AE. Targeting of viral RNAs by Upf1-mediated RNA decay pathways. Curr Opin Virol. 2021, 47: 1-8.;Ge L, Cao B, Qiao R, Cui H, Li S, Shan H, Gong P, Zhang M, Li H, Wang A, Zhou X, Li F. SUMOylation-modified Pelota-Hbs1 RNA surveillance complex restricts the infection of potyvirids in plants. Mol Plant. 2023, 16 (3): 632-642.). Among them, NMD rapidly degrades unstable and defective mRNAs to achieve quantitative regulation and quality monitoring of mRNA, playing an important regulatory role in gene expression, growth and development, and adversity defense response of organisms. Viruses are obligate parasites that have evolved to evade or tolerate various immune defense mechanisms of the host in the process of mutual game with the host to achieve infection. Exploring the various immune defense mechanisms by which different viruses evade or tolerate their hosts has become a research frontier and hotspot in this field (Sun H, Jing X, WangC, Wang P, Huang Z, Sun B, Li P, Li H, Zhang C. The Great Game between Plantsand Viruses: A Focus on Protein Homeostasis. Int J Mol Sci. 2023,24(16):12582.). The research results not only have important theoretical value, but also provide new technologies for the green prevention and control of viral diseases.

[0003] Turnip crinkle virus ( Turnip crinkle virus, TCV) is a positive-sense single-stranded RNA virus belonging to the genus Carmovirus of the family Tombusviridae. It has an extremely wide host range and can infect almost all cruciferous plants and nearly 20 different plant families, causing leaf shrinkage, mottled and slightly twisted leaves, and sometimes more serious plant deformities or dwarfing, seriously endangering the production of important economic crops such as turnip and mustard. TCV encodes five proteins, namely P8, P9, P28, P88 and P38 (Carrington, JC, Heaton, LA, Zuidema, D., Hillman, BI, & Morris, TJ (1989). The genome structure of turnipcrinkle virus. Virology, 170(1), 219–226.). Among them, P8 and P9 encode movement proteins, while P28 and P88 proteins are responsible for replication and translation; recent studies have also found that P28 is also a key protein for virus repeated infection rejection. P38 is not only a structural protein of TCV, encoding coat protein (CP), but also a viral silencing suppressor. The mechanism by which CP inhibits host PTGS and increases TCV viral accumulation and pathogenicity has been reported. Whether P8 has other functions has not been reported and remains to be studied. Summary of the invention

[0004] The purpose of the present invention is to overcome the deficiencies in the prior art and provide an application of Turnip Crinkle Virus P8 in inhibiting the degradation of mRNA decay substrates.

[0005] The first aspect of the present invention is to provide the use of the P8 gene, or the protein encoded by the P8 gene, or a recombinant vector or host bacteria containing the coding region of the P8 gene in increasing the expression level of GFP and / or inhibiting the degradation of mRNA attenuation substrates with GFP as a reporter gene; wherein the nucleotide sequence of the P8 gene is shown in SEQ ID NO:1.

[0006] The second aspect of the present invention is to provide the use of the P8 gene, or the protein encoded by the P8 gene, or a recombinant vector or host bacteria containing the coding region of the P8 gene in inhibiting the degradation of endogenous nonsense-mediated mRNA decay (NMD) substrates in Arabidopsis thaliana; wherein the nucleotide sequence of the P8 gene is shown in SEQ ID NO:1.

[0007] Wherein, the target transcript of Arabidopsis endogenous nonsense-mediated mRNA attenuation is mRNA of AT1G0106020, and / or RPS6, and / or SMG7, and / or AT5G35490, and / or AT5G64430, and / or AT1G36730, and / or AT4G3900, and / or AT5G22570.

[0008] The third aspect of the present invention is to provide the use of the P8 gene, or the protein encoded by the P8 gene, or a recombinant vector or host bacteria containing the P8 gene coding region in regulating the mRNA expression level of AT1G0106020, and / or RPS6, and / or SMG7, and / or AT5G35490, and / or AT5G64430, and / or AT1G36730, and / or AT4G3900, and / or AT5G22570, and / or AT1G72450, and / or AT2G400, wherein the nucleotide sequence of the P8 gene is shown in SEQ ID NO: 1.

[0009] Among them, the P8 gene, or the protein encoded by the P8 gene, or the recombinant vector or host bacteria containing the P8 gene coding region increases the mRNA expression level of AT1G0106020, RPS6, SMG7, AT5G35490, AT5G64430, AT1G36730, AT4G3900, and AT5G22570.

[0010] Among them, the P8 gene, or the protein encoded by the P8 gene, or the recombinant vector or host bacteria containing the coding region of the P8 gene reduces the expression level of AT1G72450 and AT2G400.

[0011] The present study found that P8 has a silencing inhibitory function, which can inhibit the degradation of nonsense-mediated mRNA decay substrates with GFP as a reporter gene and the degradation of endogenous nonsense-mediated mRNA decay (NMD) substrates of Arabidopsis thaliana, and can increase the mRNA expression levels of AT1G0106020, RPS6, SMG7, AT5G35490, AT5G64430, AT1G36730, AT4G3900, and AT5G22570, and reduce the expression levels of AT1G72450 and AT2G400. The research results will lay a foundation for clarifying the function of P8. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] Figure 1 Schematic diagram of injection into Nicotiana benthamiana leaves. Reporter is the expression vector p1300-sGFP-PTC, p1300-sGFPare or pG1300; p19 is the expression vector pZP-p19; P8 is the expression vector pPTN-P8-HA.

[0013] Figure 2 Different GFP reporter vectors, expression vectors p1300-sGFP-PTC, p1300-sGFPare or pG1300, were mixed with empty vector pPTN-SalI or expression vector pPTN-P8-HA and pZPp19 in equal volumes and then injected into Nicotiana benthamiana leaves. GFP expression on the 5th day after injection. Vec is the empty vector pPTN-SalI, P8 is the expression vector pPTN-P8-HA, sGFP-PTC / P19 is the expression vector p1300-sGFP-PTC and pZP-p19 co-injected, sGFPare / P19 is the expression vector p1300-sGFPare and pZP-p19 co-injected, and sGFP / P19 is the expression vector pG1300 and pZP-p19 co-injected.

[0014] Figure 3 Quantitative PCR analysis of known NMD target transcripts. A: Genes with premature stop codons (PTC: AT1G01060, RPS6 and SMG7) B: Genes with upstream open reading frames (uORFs: AT5G35490, AT5G64430 and ATG36730) C: Unknown NMD target genes (AT4G13900, AT5G22570) D: ARE target genes of AU-rich instability elements (AT1G72450, AT2G4000). DETAILED DESCRIPTION

[0015] The present invention will be further described below with reference to the accompanying drawings in conjunction with specific embodiments to better understand the present invention. Where specific techniques or conditions are not indicated in the embodiments, the techniques or conditions described in the literature in this area or the product specifications are used. Where the manufacturer of the reagents or instruments used is not indicated, they are all conventional products that can be obtained commercially.

[0016] 1 Plant material

[0017] Wild-type Nicotiana benthamiana N. benthamiana Arabidopsis thaliana A. thaliana and mutants upf1-5 （Arciga-Reyes, L., Wootton, L., Kieffer, M. & Davies, B. (2006) UPF1 is required for nonsense-mediated mRNA decay (NMD) and RNAi in Arabidopsis. ThePlant Journal: For Cell and Molecular Biology, 47(3), 480– 489 ） Reserved for this laboratory.

[0018] 2 Experimental methods and results

[0019] 2.1 Construction of plant expression vector

[0020] (1) p1300-sGFP-PTC

[0021] The construction method of the plant expression vector p1300sGFPPTC containing a premature termination codon is as follows: using pG1300 (Liu, L., Wang, H., Fu, Y., Tang, W., Zhao, P., Ren, Y., Liu, Z., Wu, K., & Zhang, X. (2023). Turnip crinkle virus-encoded suppressor of RNA silencing interacts with Arabidopsis SGS3 to enhance virus infection. Molecular plant pathology, 24 (2), 154–166) as a template, the 438th base C of GFP in the vector was mutated to A by point mutation, and after sequencing and identification, it was named p1300-sGFP-PTC.

[0022] (2) p1300-sGFPare vector

[0023] The method for constructing the plant expression vector p1300-sGFPare containing a premature stop codon is as follows: Shanghai Sangon Biotechnology Co., Ltd. was commissioned to artificially synthesize the target fragment ARE-SacI & SacI (specific sequence see Table 2), the target fragment was digested with SacI and then connected to pG1300 that had been digested with the same enzyme, the connection product was transformed into Escherichia coli, and the positive clone was identified as a forward insertion by sequencing and named p1300sGFPare.

[0024] (3) pPTN-P8-HA vector

[0025] The construction of pPTN-P8-HA was based on the reported TCV sequence (GenBank: NC_003821.3). Shanghai Shenggong Biotechnology Co., Ltd. was commissioned to artificially synthesize the target fragment P8-XbaI & SacI (see Table 2 for the specific sequence). The synthetic fragment and pPTN200 vector (Qu, F., Ren, T., & Morris, TJ (2003). The coat protein of turnip crinkle virus suppresses posttranscriptional gene silencing at an early initiation step. Journal of virology , 77 (1), 511–522.) were double-digested with XbaI and SacI and then ligated. The ligation products were transformed into Escherichia coli, and the positive clones were identified by PCR and sequencing and named pPTN-P8-HA.

[0026] (4) p1300-P8-GFP vector

[0027] The construction of p1300-P8-GFP was based on the reported TCV sequence (GenBank: NC_003821.3). Shanghai Shenggong Biotechnology Co., Ltd. was commissioned to artificially synthesize the target fragment P8-XbaI & BamHI (see Table 2 for the specific sequence). The synthetic fragment and pG1300 vector were double-digested with XbaI and BamHI and then ligated. The ligation product was transformed into Escherichia coli, and the positive clone was named p1300-P8-GFP after being identified as correct by PCR and sequencing.

[0028] Table 1 Primers used

[0029] Primer name Sequence qNbActin-128F AAAGACCAGCTCATCCGTGG qNbActin-256R CCAGCAGCTTCCATTCCGAT qsGFP-306F GGACGACGGCAACTACAAGA qsGFP-519R TTCGATGTTGTGGCGGATCT

[0030] Table 2 Target fragment sequences

[0031] Fragment name Sequence (5′–3′) ARE-SacI &SacI GATCTAGTAATATTTAATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTAAAGGATCGCTAG P8-XbaI & SacI ATGGATCCTGAACGAATTCCCTACAACTCTCTAAGCGACAGCGACGCAACAGGAAAACGGAAGAAAGGCGGAGAGAAAAGTGCGAAGAAGAGATTGGTAGCTAGCCACGCGGCTAGCTCTGTTTTAAACAAGAAAAGAAATGAAGGTTCTGCTAGTCACGGGGGTACTTGGGTTATTGTTGCTGATAAAGTGGAAGTCTCAATCAACTTCAACTTCGGATCCTGGAGCCACCCGCAGTTCGAAAAAGGTGGAGGTTCTGGCGGTGGATCGGGAGGTTCAGCGTGGAGCCACCCGCAGTTCGAGAAAGGTGCTTCTGGTGAAGGTTACCCATACGATGTTCCTGACTAT P8-XbaI & BamHI ATGGATCCTGAACGAATTCCCTACAACTCTCTAAGCGACAGCGACGCAACAGGAAAACGGAAGAAAGGCGGAGAGAAAAGTGCGAAGAAGAGATTGGTAGCTAGCCACGCGGCTAGCTCTGTTTTAAACAAGAAAAGAAATGAAGGTTCTGCTAGTCACGGGGGTACTTGGGTTATTGTTGCTGATAAAGTGGAAGTCTCAATCAACTTCAACTTCGGATCCTGGAGCCACCCGCAGTTCGAAAAAGGTGGAGGTTCTGGCGGTGGATCGGGAGGTTCAGCGTGGAGCCACCCGCAGTTCGAGAAAGGTGCTTCTGGTGAAGGTTACCCATACGATGTTCCTGACTAT

[0032] Note: Italic bold letters are restriction enzyme cutting sites.

[0033] 2.2 Detection of P8 silencing suppression function

[0034] 2.2.1 P8 inhibits the degradation of mRNA substrates using GFP as a reporter gene

[0035] The single-stranded green fluorescent protein expression vector pG1300 (Liu, L., Wang, H., Fu, Y., Tang, W.,Zhao, P., Ren, Y., Liu, Z., Wu, K., & Zhang, X. (2023). Turnip crinkle virus-encoded suppressor of RNA silencing interacts with Arabidopsis SGS3 to enhance virus infection. Molecular plant pathology, 24(2), 154–166), the empty vector pPTN-SalI, and the expression vector pZP-p19 containing the silencing suppressor p19 that does not interfere with mRNA decay (Qu, F., Ren, T.,& Morris, TJ (2003). The coat protein of turnip crinkle virus suppressesposttranscriptional gene silencing at an early initiation step. Journal of virology , 77 (1), 511–522.) are all preserved in our laboratory.

[0036] (1) Transformation of recombinant plasmid into Agrobacterium (GV3101) competent cells

[0037] According to the instructions of GV3101 Chemically Competent Cell, plant expression vectors pG1300, p1300-sGFP-PTC, p1300-sGFPare, pPTN-P8-HA and pZP-p19 were transformed into Agrobacterium GV3101 competent cells. After transformation, the resuspended bacterial blocks were evenly spread on LB plates containing corresponding antibiotics. pG1300, p1300-sGFP-PTC, p1300-sGFPare were spread on LB plates containing Kan and Rif resistance, and pPTN-P8-HA and pZP-p19 were spread on LB plates containing Spec and Rif resistance). Place them upside down in a 28℃ constant temperature incubator and culture for 72-90 hours. After 2-3 days, 2-3 mm Agrobacterium colonies were grown, and single colonies were selected for PCR identification.

[0038] (2) Infiltration of wild-type Nicotiana benthamiana

[0039] The resuspended Agrobacterium containing the recombinant vector was mixed and injected into transgenic wild-type Nicotiana benthamiana leaves. The operation steps are as follows:

[0040] (a) Use a pipette tip to pick up a single colony that is positive by colony PCR and place it in 5 ml of LB liquid culture medium containing the corresponding antibiotics. Place it in a constant temperature shaker at 28°C and 200 r / min for overnight culture.

[0041] (b) Centrifuge the bacterial solution at 7000 rpm for 15 min and discard the supernatant.

[0042] (c) Prepare injection buffer: take 2 mL of 1 mol / L MgCl2, 2 mL of 1 mol / L MES, and 200 μL of 100 mg / mL AS, and finally make up to 200 mL with ultrapure water.

[0043] (d) Resuspend the bacterial pellet in 5 mL of injection buffer, vortex thoroughly to evenly distribute the pellet, measure the OD600 value of the bacterial pellet, and dilute the bacterial pellet to an OD600 of 0.5.

[0044] (e) After the diluted bacterial solution is placed at room temperature for 2-3 hours, mix it in equal volumes according to the required mixing system (see Table 3 for specific combinations)

[0045] (f) Select wild-type Nicotiana benthamiana plants with good growth at the 5-7 leaf stage and inject about 2 cm2 with a 1 mL syringe. Inject the same reporter gene with an empty vector or P8 as shown in Figure 1 The injections shown were made on the same leaf, and 10 leaves were injected. The injected Nicotiana benthamiana were kept in the dark overnight and then cultured under normal conditions.

[0046] (g) Five days after injection, total RNA was extracted from tobacco according to the instructions of TRNzol Universal Total RNA Extraction Reagent produced by Tiangen Company, and then the RNA sample was reverse transcribed using a two-step method according to the instructions of the reverse transcription kit. Real-time fluorescence quantitative PCR (qRT-PCR) was performed using the obtained cDNA sample as a template, qNbActin-128F and qNbActin-256R as internal reference primers, and qsGFP-306F and qsGFP-519R as GFP detection primers.

[0047] The results are as follows Figure 2As shown, when P8 was co-expressed with sGFP expression vectors p1300-sGFP-PTC and p1300-sGFPare with long chains at the 3' end, the GFP expression level increased, and the GFP expression level increased significantly when co-expressed with p1300-sGFPare, while it had no obvious effect on the sGFP expression vector p1300-sGFP without long chains. The transient expression results showed that P8 inhibited the degradation of mRNA decay substrates with GFP as the reporter gene, indicating that the TCV encoded protein P8 has the function of inhibiting host mRNA decay.

[0048] Table 3 Combinations of wild-type Nicotiana benthamiana injected with different plasmids by Agrobacterium

[0049]

[0050] 2.2.2 P8 inhibits the degradation of endogenous nonsense-mediated mRNA decay (NMD) substrates in Arabidopsis

[0051] To further determine the inhibitory effect of TCV P8 on host mRNA decay, the expression vector p1300-P8-GFP was transformed into wild-type Arabidopsis by the pollen tube pathway to obtain transgenic Arabidopsis overexpressing P8-GFP, named 35S:P8-GFP. Four-week-old seedlings were collected, including 35S:P8-GFP, Col-0, and mutants with partial loss of function of the key mRNA decay gene UPF1. upf1-5 RNA was extracted and real-time quantitative PCR (RT-qPCR) was performed to study the effect of overexpression of P8 on the mRNA expression levels of NMD substrates and AU-rich instability elements (ARE) in transgenic plants.

[0052] RT-qPCR was used to detect and analyze eight known NMD target transcripts in three major categories (Wu, K., Fu, Y., Ren, Y., Liu, L., Zhang, X., & Ruan, M. (2023). Turnip crinkle virus-encoded suppressor of RNA silencing suppresses mRNA decay by interacting with Arabidopsis XRN4. The Plant journal : for cell and molecular biology, 116(3), 744–755.): (A) AT1G0106020 containing a premature stop codon (Gloggnitzer, J., Akimcheva, S., Srinivasan, A., Kusenda, B., Riehs, N., Stampfl, H. et al. (2014) Nonsense-mediated mRNA decay modulates immune receptor levels to regulate plantantibacterial defense. Cell Host & Microbe, 16(3), 376–390.), RPS6(Garcia, D., Garcia, S. & Voinnet, O. (2014) Nonsense-mediated decay serves as a generalviral restriction mechanism in plants. Cell Host & Microbe, 16(3), 391–402.) or SMG7 with long 3'UTR(Kerényi, Z., Mérai, Z., Hiripi, L., Benkovics, A., Gyula, P., Lacomme, C. et al. (2008) Inter-kingdom conservation of mechanism of nonsense-mediated mRNA decay. The EMBO Journal, 27(11), 1585–1595.); (B) AT5G35490, AT5G64430, AT1G36730 with upstream open reading frame (uORF)(Rayson, S., Arciga-Reyes, L.,Wootton, L., De Torres Zabala, M., Truman, W., Graham, N. et al. (2012) Arole for nonsense-mediated mRNA decay in plants: pathogen responses are induced in Arabidopsis thaliana NMD mutants. PLoS One, 7(2), e31917.) and (C) two mRNAs of AT4G3900 and AT5G22570 carrying unknown NMD cis-elements (Rayson, S., Arciga-Reyes,L., Wootton, L., De Torres Zabala, M., Truman, W., Graham, N. et al. (2012) Arole for nonsense-mediated mRNA decay in plants: pathogen responses are induced in Arabidopsis thaliana NMD mutants. PLoS One, 7(2), e31917.). .

[0053] Two target transcripts (AT1G72450 and AT2G400) containing AU unstable elements were analyzed by RT-qPCR (Gutierrez, RA, Ewing, RM, Cherry, JM & Green, PJ (2002) Identification of unstable transcripts in Arabidopsis by cDNA microarray analysis: rapid decay is associated with a group of touch- and specific clock-controlled genes. Proceedings of the National Academy of Sciences of the United States of America, 99(17), 11513–11518.)

[0054] The results showed that upf1-5 The mutant plants were similar ( Figure 3), the mRNA expression levels of AT1G0106020, RPS6, SMG7, AT5G35490, AT5G64430, AT1G36730, AT4G3900, and AT5G22570 in P8-overexpressing plants were significantly increased. In contrast, the other two target transcripts containing AU unstable elements (AT1G72450 and AT2G400) were sharply decreased in P8-overexpressing plants. This indicates that TCV P8 can inhibit the degradation of endogenous nonsense-mediated mRNA decay (NMD) substrates in Arabidopsis thaliana and has the function of an mRNA decay suppressor.

[0055] The specific embodiments of the present invention are described in detail above, but they are only examples, and the present invention is not limited to the specific embodiments described above. For those skilled in the art, any equivalent modification and substitution of the practical is also within the scope of the present invention. Therefore, the equalization transformation and modification made without departing from the spirit and scope of the present invention should be included in the scope of the present invention.

Claims

1. Application of the P8 gene, or the protein encoded by the P8 gene, or a recombinant vector or host bacteria containing the coding region of the P8 gene in increasing the expression of GFP and / or inhibiting the degradation of mRNA attenuation substrates with GFP as a reporter gene in Nicotiana benthamiana; wherein: The nucleotide sequence of the P8 gene is shown in SEQ ID NO:

1.

2. Application of the P8 gene, or the protein encoded by the P8 gene, or a recombinant vector or host bacteria containing the coding region of the P8 gene in inhibiting the degradation of endogenous nonsense-mediated mRNA attenuation substrates in Arabidopsis thaliana; wherein the nucleotide sequence of the P8 gene is shown in SEQ ID NO: 1; the target genes of endogenous nonsense-mediated mRNA attenuation in Arabidopsis thaliana are AT1G0106020, and / or RPS6, and / or SMG7, and / or AT5G35490, and / or AT5G64430, and / or AT1G36730, and / or AT4G3900, and / or AT5G22570.

3. Use of the P8 gene, or the protein encoded by the P8 gene, or a recombinant vector or host bacteria containing the coding region of the P8 gene in regulating the mRNA expression of AT1G0106020, and / or RPS6, and / or SMG7, and / or AT5G35490, and / or AT5G64430, and / or AT1G36730, and / or AT4G3900, and / or AT5G22570, and / or AT1G72450, and / or AT2G400, wherein: The nucleotide sequence of the P8 gene is shown in SEQ ID NO: 1; The regulation is to increase the mRNA expression levels of AT1G0106020, RPS6, SMG7, AT5G35490, AT5G64430, AT1G36730, AT4G3900, and AT5G22570; or, the regulation is to reduce the expression levels of AT1G72450 and AT2G400.

Images