Application of Turnip Crinkle Virus P8 in Inhibiting RNA Silencing

Abstract

The present invention provides the use of turnip crinkle virus P8 in inhibiting RNA silencing, wherein the nucleotide sequence of the P8 gene is shown in SEQ ID NO: 1. The present invention has found that P8 has a silencing inhibition function and can inhibit the degradation of GFP mRNA, thereby increasing the expression of GFP protein; in addition, it is found that P8 can also increase the number of Arabidopsis thaliana mRNA degradation pathway Process body (a complex formed by the interaction of Dcp1 protein and Dcp2 protein) particles, and the research results will lay a foundation for clarifying the function of P8.

Description

Technical Field

[0001] The invention belongs to the technical field of gene engineering, and in particular relates to application of turnip crinkle virus P8 in inhibiting RNA silencing. Background Art

[0002] Viruses are obligate parasites that must evade or tolerate various antiviral defense mechanisms of host cells to successfully infect. How viruses evade or tolerate various immune defense mechanisms such as post-transcriptional genesilencing (PTGS) of the host and enhance pathogenicity has been a research hotspot in recent years and has made great progress. PTGS is a conserved gene expression regulation mechanism in eukaryotes. It not only plays an important role in developmental regulation, metabolism, maintaining genome stability, and responding to biotic and abiotic stresses, but is also one of the important antiviral immune mechanisms. During the evolution of plants, multiple antiviral PTGS signaling pathways have been formed, which are participated by different proteins and have different functions but overlap with each other. Viruses are obligate parasites that must evade or tolerate degradation of host cells to successfully infect. Most plant viruses have co-evolved with plants to produce one or more viral suppressors of RNA silencing (VSRs) to counteract the antiviral immune function of host PTGS. VSRs from different viruses have no homology in sequence and no similarity in structure, so their modes and mechanisms of action are also different.

[0003] Turnip crinkle virus ( Turnip crinkle virus, TCV) is a positive-sense single-stranded RNA virus belonging to the genus Carmovirus of the family Tombusviridae. It has an extremely wide host range and can infect almost all cruciferous plants and nearly 20 different plant families, causing leaf shrinkage, mottled and slightly twisted leaves, and sometimes more serious plant deformities or dwarfing, seriously endangering the production of important economic crops such as turnip and mustard. TCV encodes five proteins, namely P8, P9, P28, P88 and P38 (Carrington, JC, Heaton, LA, Zuidema, D., Hillman, BI, & Morris, TJ (1989). The genome structure of turnipcrinkle virus. Virology, 170(1), 219–226.). Among them, P8 and P9 encode movement proteins, while P28 and P88 proteins are responsible for replication and translation; recent studies have also found that P28 is also a key protein for virus repeated infection rejection. P38 is not only a structural protein of TCV, encoding coat protein (CP), but also a viral silencing suppressor. The mechanism by which CP inhibits host PTGS and increases TCV viral accumulation and pathogenicity has been reported. Whether P8 has other functions has not been reported and remains to be studied. Summary of the invention

[0004] The purpose of the present invention is to overcome the deficiencies in the prior art and provide an application of Turnip Crinkle Virus P8 in inhibiting RNA silencing.

[0005] The first aspect of the present invention is to provide the use of the P8 gene, or the protein encoded by the P8 gene, or a recombinant vector or host bacteria containing the P8 gene coding region in inhibiting GFP silencing; wherein the nucleotide sequence of the P8 gene is shown in SEQ ID NO:1.

[0006] The second aspect of the present invention is to provide the use of the P8 gene, or the protein encoded by the P8 gene, or a recombinant vector or host bacteria containing the P8 gene coding region in inhibiting the degradation of GFP, improving its expression and / or increasing the accumulation of GFP protein levels; wherein the nucleotide sequence of the P8 gene is shown in SEQ ID NO:1.

[0007] The third aspect of the present invention is to provide the use of the P8 gene, or the protein encoded by the P8 gene, or a recombinant vector or host bacteria containing the coding region of the P8 gene in increasing Process body, wherein the nucleotide sequence of the P8 gene is as shown in SEQ ID NO: 1, the Process body is a complex formed by the interaction of the Dcp1 protein and the Dcp2 protein, the nucleotide sequence of the gene encoding the Dcp1 protein is as shown in SEQ ID NO: 2, and the nucleotide sequence of the gene encoding the Dcp2 protein is as shown in SEQ ID NO: 3.

[0008] The present invention found that P8 has a silencing inhibitory function and can inhibit the degradation of GFP mRNA, thereby increasing the expression of GFP protein; in addition, it was found that P8 can also increase the number of Arabidopsis mRNA degradation pathway Process body (a complex formed by the interaction of Dcp1 protein and Dcp2 protein) particles. The research results will lay the foundation for clarifying the function of P8. BRIEF DESCRIPTION OF THE DRAWINGS

[0009] Figure 1 The fluorescence expression of transgenic 16C N. benthamiana co-infiltrated with single-chain green fluorescent protein (pG1300) and P8 expression vector Agrobacterium. pG1300: plant expression vector expressing GFP; CP-HA: plant expression vector pPTN-CP-HA expressing CP-HA; P8-HA: plant expression vector pPTN-P8-HA expressing P8-HA; SalI: plant expression vector pPTN-SalI with only HA tag; 16C: transgenic N. benthamiana overexpressing GFP; 5dpa: 5 days after Agrobacterium injection.

[0010] Figure 2 Western Blot detection of GFP protein accumulation level in N. benthamiana leaves after 5 dpa infiltration of pG1300, pPTN-CP-HA, empty vector pPTN-SalI and pPTN-P8-HA. pG1300: plant expression vector expressing GFP; CP-HA: plant expression vector pPTN-CP-HA expressing CP-HA; P8-HA: plant expression vector pPTN-P8-HA expressing P8-HA; SalI: plant expression vector pPTN-SalI with only HA tag; 16C: transgenic N. benthamiana overexpressing GFP; 5 dpa: 5 days after Agrobacterium injection; α-GFP: GFP antibody; CBB: Coomassie Brilliant Blue staining.

[0011] Figure 3RT-qPCR was used to detect the effect of P8 on GFP mRNA expression. GFP: GFP mRNA; CP-HA: plant expression vector pPTN-CP-HA expressing CP-HA; P8-HA: plant expression vector pPTN-P8-HA expressing P8-HA; SalI: plant expression vector pPTN-SalI with only HA tag.

[0012] Figure 4 To improve the formation of process body in the mRNA degradation pathway of Arabidopsis thaliana for P8. YN-Dcp1: pYN-Dcp1, a fluorescent bimolecular plant expression vector expressing Arabidopsis Dcp1; Dcp2-YC: Dcp2-YC1, a fluorescent bimolecular plant expression vector expressing Arabidopsis Dcp2; P8-HA: pPTN-P8-HA, a plant expression vector expressing P8-HA; SalI: pPTN-SalI, a plant expression vector with only HA tag; α-HA: HA antibody; CBB: Coomassie Brilliant Blue staining. DETAILED DESCRIPTION

[0013] The present invention will be further described below with reference to the accompanying drawings in conjunction with specific embodiments to better understand the present invention. Where specific techniques or conditions are not indicated in the embodiments, the techniques or conditions described in the literature in this area or the product specifications are used. Where the manufacturer of the reagents or instruments used is not indicated, they are all conventional products that can be obtained commercially.

[0014] 1 Plant material

[0015] 16C transgenic Nicotiana benthamiana N. benthamiana (Qu, F., Ren, T., & Morris, TJ(2003). The coat protein of turnip crinkle virus suppresses posttranscriptional gene silencing at an early initiation step. Journal of virology , 77 (1), 511–522.).

[0016] 2 Experimental methods and results

[0017] 2.1 Construction of plant expression vector

[0018] (1) pPTN-CP-HA vector

[0019] To construct a TCV CP with known silencing suppression function (Qu, F., Ren, T., & Morris, TJ (2003). The coat protein of turnip crinkle virus suppresses posttranscriptional gene silencing at an early initiation step. Journal of virology , 77 The plant expression vector pPTN-CP-HA ((1), 511–522.) was used as a template and the full-length sequence of the target fragment CP was amplified using primers CP-1F SpeI and CP-1053R MluI (see Table 1 for the specific sequence). AD-CP (Liu, L., Wang,H., Fu, Y., Tang, W., Zhao, P., Ren, Y., Liu, Z., Wu, K., & Zhang, X. (2023). Turnip crinkle virus-encoded suppressor of RNA silencing interacts withArabidopsis SGS3 to enhance virus infection. Molecular plant pathology, 24(2), 154–166) was used as a template.

[0020] The reaction system is as follows:

[0021]

[0022] The reaction procedure is as follows:

[0023]

[0024] The amplified product was double-digested with SpeI and MluI and then compared with pPTN-SalI (Qu, F., Ren, T., & Morris, TJ (2003). The coat protein of turnip crinkle virus suppresses posttranscriptional gene silencing at an early initiation step. Journal of virology , 77The ligation product was transformed into Escherichia coli, and the positive clone was named pPTN-CP-HA after being confirmed by PCR and sequencing.

[0025] (2) pPTN-P8-HA vector

[0026] The construction of pPTN-P8-HA referred to the reported TCV sequence (GenBank: NC_003821.3), and commissioned Shanghai Shenggong Biotechnology Co., Ltd. to artificially synthesize the target fragment P8-XbaI & SacI (specific sequence see Table 2). The synthetic fragment and pPTN-SalI vector were double-digested with XbaI and SacI and then connected. The ligation product was transformed into Escherichia coli, and the positive clone was named pPTN-P8-HA after being confirmed by PCR and sequencing.

[0027] (3) YN-Dcp1 vector

[0028] The construction of YN-Dcp1 was based on the reported Arabidopsis Dcp1 sequence (AT1G08370.1). Primers AtDcp1-1FSpeI and AtDcp1-1104R KpnI (specific sequences are shown in Table 1) were used to amplify AtDcp1 using Arabidopsis cDNA as a template. The reaction system and reaction procedure were the same as those described in 2.1 (1).

[0029] The PCR product was double-digested with SpeI and KpnI and ligated with the large fragment of pGN1 (Liu, L., Wang, H., Fu, Y., Tang, W., Zhao, P., Ren, Y., Liu, Z., Wu, K., & Zhang, X. (2023). Turnip crinkle virus-encoded suppressor of RNA silencing interacts with Arabidopsis SGS3 to enhance virus infection. Molecular plant pathology, 24(2), 154–166.) recovered by the same double enzyme digestion. The positive clone was named YN-Dcp1 after being sequenced and confirmed to be correct.

[0030] (4) Dcp2-YC vector

[0031] The construction of Dcp2-YC was based on the reported Arabidopsis Dcp2 sequence (AT5G13570.2). Primers AtDcp2-1FSpeI and AtDcp2-1161R KpnI (specific sequences are shown in Table 1) were used to amplify AtDcp2 using Arabidopsis cDNA as a template. The reaction system and reaction procedure were the same as those described in 2.1 (1). The PCR product was double-digested with SpeI and KpnI and ligated with the large fragment of p2GC (Liu, L., Wang, H., Fu, Y., Tang, W., Zhao, P., Ren, Y., Liu, Z., Wu, K.,& Zhang, X. (2023). Turnip crinkle virus-encoded suppressor of RNA silencinginteracts with Arabidopsis SGS3 to enhance virus infection. Molecular plantpathology, 24(2), 154–166.) recovered by the same double enzyme digestion. The positive clone was named Dcp2-YC after being sequenced and confirmed to be correct.

[0032] Table 1 Primers used

[0033] Primer Name Sequence CP-1F SpeI ATGGAAAATGATCCTAGAGTC CP-1053R MluI CCCGGGAATTCTGAGTGCTTGCCATTTAC qNbActin-128F AAAGACCAGCTCATCCGTGG qNbActin-256R CCAGCAGCTTCCATTCCGAT qsGFP-306F GGACGACGGCAACTACAAGA qsGFP-519R TTCGATGTTGTGGCGGATCT AtDcp1-1F SpeI ATGTCTCAAAACGGGAAGATAAT AtDcp1-1104R KpnI TTGTTGAAGTGCATTTTGTAAAGTT AtDcp2-1F SpeI ATGTCGGGCCTCCATCGAT AtDcp2-1158R KpnI TCAAGCTGAATTACCAGATTCCAAC

[0034] Note: Italic bold letters are restriction enzyme cutting sites.

[0035] Table 2 Target fragment sequences

[0036] Fragment Name Sequence (5′–3′) P8-XbaI & SacI ATGGATCCTGAACGAATTCCCTACAACTCTCTAAGCGACAGCGACGCAACAGGAAAACGGAAGAAAGGCGGAGAGAAAAGTGCGAAGAAGAGATTGGTAGCTAGCCACGCGGCTAGCTCTGTTTTAAACAAGAAAAGAAATGAAGGTTCTGCTAGTCACGGGGGTACTTGGGTTATTGTTGCTGATAAAGTGGAAGTCTCAATCAACTTCAACTTCGGATCCTGGAGCCACCCGCAGTTCGAAAAAGGTGGAGGTTCTGGCGGTGGATCGGGAGGTTCAGCGTGGAGCCACCCGCAGTTCGAGAAAGGTGCTTCTGGTGAAGGTTACCCATACGATGTTCCTGACTATTAA Note: Italic bold letters are restriction enzyme cutting sites.

[0037] 2.2 Detection of P8 silencing suppression function

[0038] 2.2.1 Observation of P8 silencing suppression function

[0039] The single-stranded green fluorescent protein expression vector pG1300 (Liu, L., Wang, H., Fu, Y., Tang, W.,Zhao, P., Ren, Y., Liu, Z., Wu, K., & Zhang, X. (2023). Turnip crinkle virus-encoded suppressor of RNA silencing interacts with Arabidopsis SGS3 to enhance virus infection. Molecular plant pathology, 24(2), 154–166) and the empty vector pPTN-SalI (Qu, F., Ren, T., & Morris, TJ (2003). The coat protein of turnipcrinkle virus suppresses posttranscriptional gene silencing at an earlyinitiation step. Journal of virology , 77 (1), 511–522.) are all preserved in our laboratory.

[0040] (1) Transformation of recombinant plasmid into Agrobacterium (GV3101) competent cells

[0041] Refer to the GV3101 Chemically Competent Cell product manual to transform the plant expression vectors pG1300, pPTN-SalI, pPTN-CP-HA and pPTN-P8-HA into Agrobacterium GV3101 competent cells. After transformation, resuspend the bacterial blocks and evenly spread them on LB plates containing the corresponding antibiotics (pG1300 is spread on LB plates containing Kan and Rif resistance, and pPTN-SalI, pPTN-CP-HA and pPTN-P8-HA are spread on LB plates containing Spec and Rif resistance), and invert them in a 28℃ constant temperature incubator for 72-90 hours. After 2-3 days, when 2-3 mm Agrobacterium colonies grow, select single colonies for PCR identification.

[0042] (2) Infiltration of transgenic 16C Nicotiana benthamiana

[0043] The resuspended Agrobacterium containing the recombinant vector was mixed and injected into the transgenic 16C Benthani tobacco leaves. The operation steps are as follows:

[0044] (a) Use a pipette tip to pick up a single colony that is positive by colony PCR and place it in 5 ml of LB liquid culture medium containing the corresponding antibiotics. Place it in a constant temperature shaker at 28°C and 200 r / min for overnight culture.

[0045] (b) The bacterial solution was centrifuged at 7000 rpm for 15 min and the supernatant was discarded.

[0046] (c) Prepare injection buffer: take 2 mL of 1 mol / L MgCl2, 2 mL of 1 mol / L MES, and 200 μL of 100 mg / mL AS, and finally make up to 200 mL with ultrapure water.

[0047] (d) Resuspend the bacterial pellet in 5 mL of injection buffer, vortex thoroughly to evenly distribute the pellet, measure the OD600 value of the bacterial pellet, and dilute the bacterial pellet to an OD600 of 0.5.

[0048] (e) After the diluted bacterial solution was placed at room temperature for 2-3 h, it was mixed in a 1:1 volume ratio according to the required mixing system (see Table 3 for specific combinations).

[0049] (f) Take the transgenic 16C N. benthamiana plants that are growing vigorously and at the 5-7 leaf stage and inject them into the leaves with good growth using a 1 mL needle syringe. The injection area is about 2 cm 2 All the combinations were injected on the same leaf, 10 leaves were injected, and the injected Nicotiana benthamiana were kept in dark overnight and then cultured under normal conditions.

[0050] (g) On the 5th day after injection, a handheld fluorescent protein observation lamp (LUYOR-3415RG) was used with LUV-30A yellow glasses to observe the expression of GFP fluorescence in each combination under blue excitation light (495 nm), and photos were taken. After the photos were taken, the tobacco infection range was circled with a marker.

[0051] The results are as follows Figure 1 As shown, the results are Figure 1 As shown in the figure, leaves co-infiltrated with pG1300 and pPTN-P8-HA or pPTN-CP-HA showed strong GFP fluorescence, while leaves co-injected with pPTN-mAC2-HA or empty vector pPTN-SalI showed only weak fluorescence. It was preliminarily judged that P8 inhibited GFP silencing like the known silencing suppressor CP and had silencing suppressor function. Figure 1As shown, leaves co-infiltrated with pG1300 and pPTN-P8-HA or pPTN-CP-HA showed strong GFP fluorescence, while only weak fluorescence was detected in tobacco leaves co-injected with pPTN-mAC2-HA or empty vector pPTN-SalI. It was preliminarily judged that P8, like the known silencing suppressor CP, inhibits GFP silencing and has silencing suppression function.

[0052] Table 3 Combinations of different plasmids injected into 16C Nicotiana benthamiana by Agrobacterium

[0053]

[0054] 2.2.2 Western blot analysis of the effect of P8 on GFP protein expression

[0055] Total protein was extracted from tobacco leaves of the above different injection combinations on the 5th day, and Western Blot was performed to detect GFP protein expression to verify the fluorescence observation results. Plant total protein extraction and Western Blot refer to the literature (Liu Linyu's master's thesis "Cassava mosaic virus silencing suppressor AC4 hijacks UPF1 to promote virus infection").

[0056] The results are as follows Figure 2 As shown in the figure above, samples co-infiltrated with pG1300 and pPTN-P8-HA or pPTN-CP-HA all have high GFP protein accumulation, while samples co-infiltrated with empty vector pPTN-SalI have weak GFP signal bands. Rubiso Coomassie Brilliant Blue staining shows that the loading amount is basically the same ( Figure 2 (Figure below). WB detection results confirmed the fluorescence observation results, indicating that P8 has the function of inhibiting GFP degradation and increasing its expression.

[0057] 2.2.3 Real-time fluorescence quantitative detection of the effect of P8 on GFP mRNA expression

[0058] Total RNA was extracted from tobacco according to the instructions of Tiangen's TRNzol Universal Total RNA Extraction Reagent, and then the RNA sample was reverse transcribed using a two-step method according to the instructions of the reverse transcription kit. The obtained cDNA sample was used as a template, qNbActin-128F and qNbActin-256R were used as internal reference primers, and qsGFP-306F and qsGFP-519R were used as GFP detection primers for real-time fluorescence quantitative PCR (qRT-PCR). The results are shown in Figure 3As shown, consistent with the Western Blot results, the samples co-infiltrated with pG1300 and pPTN-P8-HA or pPTN-CP-HA had higher GFP protein accumulation levels, while the GFP signal band of the sample co-infiltrated with the empty vector pPTN-SalI was weak.

[0059] 2.2.4 P8 enhances the formation of process bodies in the Arabidopsis mRNA degradation pathway

[0060] The complex formed by the interaction of Dcp1 and Dcp2 is called the process body. We used fluorescent bimolecular complementation experiments to observe the fluorescent particles that form the process body through the interaction between Dcp1 and Dcp2 to study the effect of P8 on Dcp1 and Dcp2 Whether it has an inhibitory silencing effect, the specific method is as follows: first, use the method of 2.2.1 (1) to transform the expression vector into Agrobacterium; secondly, refer to the method of 2.2.1 (2) to inject the two combinations of recombinant plasmids in Table 4 into wild-type Nicotiana benthamiana for injection expression; then, on the third day after the injection, take about 1-2 cm2 of each sample and use a laser confocal microscope (Olympus FV3000) to observe the fluorescence of tobacco cells. The GFP excitation light is 488 nm, and protein extraction and Western blot detection are performed.

[0061] The results are as follows Figure 4 As shown in a, the number of Process body fluorescent particles co-expressed with pPTN-P8-HA is significantly more than that of tobacco leaves co-injected with the empty vector pPTN-SalI, and Figure 4 The Western blot results in b showed that P8 was expressed, indicating that the increase in Process body was caused by P8. This result further proves that P8 has a silencing inhibitory function.

[0062] Table 4 Combinations of wild-type Nicotiana benthamiana injected with different plasmids by Agrobacterium

[0063]

[0064] The specific embodiments of the present invention are described in detail above, but they are only examples, and the present invention is not limited to the specific embodiments described above. For those skilled in the art, any equivalent modifications and substitutions made to the invention are also within the scope of the present invention. Therefore, the equalization changes and modifications made without departing from the spirit and scope of the present invention should be included in the scope of the present invention.

Claims

1. Application of the P8 gene, or the protein encoded by the P8 gene, or a recombinant vector or host bacteria containing the coding region of the P8 gene in increasing the expression of GFP and / or inhibiting GFP silencing in transgenic 16C Nicotiana benthamiana, wherein: The nucleotide sequence of the P8 gene is shown in SEQ ID NO:1.

Images