Short-chain ssDNA sequencing library construction method, sequencing method and application

Abstract

The invention relates to the field of DNA sequencing, in particular to a short-chain ssDNA sequencing library construction method, a sequencing method and application. The construction method of the sequencing library of the short-chain ssDNA comprises the following steps: adding polynucleotide tails; wherein the length of the tailed short chain ssDNA is not less than 100 nt; a step of treating the tailed short-chain ssDNA and then connecting the tailed short-chain ssDNA into a ring, then carrying out product purification on the circular DNA, and carrying out amplification by taking the purified product as a template; and a DNA chain fragmentation step: fragmenting the product obtained in the step of obtaining the cyclized single-stranded DNA by using endonuclease, and establishing a sequencing library. By adopting the technical scheme provided by the invention, the short-chain ssDNA is prolonged and looped, so that the technical problems that direct library building and sequencing of the short ssDNA in the prior art cannot meet the conditions of third-generation sequencing, the accuracy rate of the third-generation sequencing is low and the like are solved, and library building of special ssDNA is realized.

Description

Technical Field

[0001] The present invention relates to the field of DNA sequencing, and in particular to a method for constructing a sequencing library of short-chain ssDNA, a sequencing method and an application thereof. Background Art

[0002] The third generation of sequencing technology refers to single-molecule sequencing technology. When sequencing DNA, PCR amplification is not required, and each DNA molecule can be sequenced separately. The third generation of sequencing technology is represented by Oxford Nanopore Technologies (ONT) nanopore single-molecule sequencing technology. Compared with the previous two generations, the biggest feature is single-molecule sequencing, and the sequencing process does not require PCR amplification.

[0003] ONT technology is mainly used for long-chain DNA sequencing. The classic sequencing library construction steps are to first break the DNA into appropriate fragment sizes, fill in the DNA ends, add A bases to the 3' end, phosphorylate the 5' end, and connect the adapter sequence containing the motor protein on the adapter. However, for short ssDNA, it is impossible to achieve third-generation sequencing library construction due to its length, which is an unresolved problem so far.

[0004] In view of this, this application is filed. Summary of the invention

[0005] The object of the present invention is to provide a method for constructing a sequencing library of short-chain ssDNA, a sequencing method and an application thereof, so as to solve at least one technical problem in the background technology.

[0006] Specifically, in the first aspect of the present application, a method for constructing a sequencing library of a short-chain ssDNA is provided, wherein the 5' end of the short-chain ssDNA is connected to a fixed carrier and the 3' end is an exposed end, and the method for constructing a sequencing library comprises the steps of: The step of adding a polynucleotide tail, using the short-chain ssDNA as a template, using terminal deoxynucleotidyl transferase to perform an enzyme reaction, adding a polynucleotide tail to the 3' end of the short-chain ssDNA, and obtaining a tailed short-chain ssDNA; wherein the length of the tailed short-chain ssDNA is not less than 100 nt; Steps for obtaining circularized single-stranded DNA: treating the tailed short-stranded ssDNA and connecting it into a circle, then purifying the circular DNA product, and using the purified product as a template for amplification; DNA chain fragmentation step: The product obtained from the step of obtaining circularized single-stranded DNA is fragmented using nuclease, and a sequencing library is established.

[0007] Preferably, the product of the step of obtaining circularized single-stranded DNA is fragmented using a nuclease, and the length of the obtained single-stranded DNA is greater than 200 bp.

[0008] Optionally, the step of treating the tailed short-chain ssDNA and connecting them into a ring comprises: PCR amplification steps of short-chain ssDNA: using the tailed short-chain ssDNA as a template, designing the first primer for PCR amplification reaction, and purifying the amplified product; End repair step: Using the purified amplified product as a template, perform 5' end repair and 3' end tailing reactions; Connector ligation step: using the product obtained in the end repair step as a template, using a ligase to react, obtaining a template with a connector, and purifying it; dsDNA PCR enrichment and purification step: using the purified product obtained in the adapter ligation step as a template, design a second primer for PCR enrichment and purification; DNA chain circularization step: dsDNA is denatured into single strands, and ssDNA is connected into a circle through clamp DNA.

[0009] Optionally, the step of treating the tailed short-chain ssDNA and connecting them into a ring comprises: 5' end phosphorylation step: phosphorylating the 5' end of the tailed short-chain ssDNA; ssDNA cyclization step: cyclize the phosphorylated ssDNA to connect its 5' end with its 3' end.

[0010] Preferably, in the step of adding the polynucleotide tail, the tailing reaction rate is controlled at 30-40 nt / min.

[0011] Furthermore, in the PCR amplification step of the short-chain ssDNA, the first primer includes a poly tail segment and a primer body segment, the poly tail segment is complementary to the polynucleotide tail, and the primer body segment is complementary to a partial sequence of the short-chain ssDNA.

[0012] Furthermore, in the step of adding the polynucleotide tail, the enzyme reaction temperature is 29-31°C, the reaction time is 8-10 minutes, and finally the enzyme is inactivated at 96-99°C. Furthermore, the enzyme reaction temperature is 30°C, the reaction time is 8-10 minutes, and finally the enzyme is inactivated at 98°C.

[0013] Furthermore, the step of adding the polynucleotide tail comprises, by volume: 5× terminal deoxynucleotidyl transferase reaction buffer (terminal deoxynucleotidyl transferase buffer) 15-25 copies; Terminal deoxynucleotidyl transferase (TdT enzyme) 4-6 copies; 70-80 parts of enzyme-free water; 10 μM dNTP 1-3 copies.

[0014] Furthermore, the step of adding the polynucleotide tail comprises, by volume: 5× terminal deoxynucleotidyl transferase reaction buffer (terminal deoxynucleotidyl transferase buffer) 20 copies; Terminal deoxynucleotidyl transferase (TdT enzyme) 5 copies; 73 parts of enzyme-free water; 10 μM dNTP 2 copies.

[0015] Furthermore, the terminal deoxynucleotidyl transferase is a muTdT enzyme derived from mice.

[0016] Furthermore, the dNTP is dATP or dGTP.

[0017] Furthermore, the PCR amplification step of the short-chain ssDNA comprises, by volume: Contains 1-3 copies of 0.02μM-2μM tailed short-chain ssDNA, 40-45 parts of enzyme-free water; 2×PCR Buffer 45-55 copies; dNTP mix 1-3 parts; 1-3 copies of DNA polymerase; 3-5 copies of the first primer mixture.

[0018] Furthermore, the PCR amplification step of the short-chain ssDNA comprises, by volume: Contains 2 copies of 0.1μM tailed short-chain ssDNA, 42 parts of enzyme-free water; 2×PCR Buffer 50 copies; dNTP mix 2 parts; DNA polymerase 2 copies; 4 copies of the first primer mixture.

[0019] Furthermore, in the PCR amplification step of the short-chain ssDNA, the reaction conditions include the steps of: Place in a PCR instrument and perform PCR amplification reaction according to the following conditions: Pre-denaturation stage: reaction temperature is 94-96°C, preferably 95°C, reaction time is 2-4min, preferably 3min; Denaturation stage: reaction temperature is 94-96°C, preferably 95°C, reaction time is 10-20s, preferably 15s; Annealing stage: reaction temperature is 45-55°C, preferably 50°C, reaction time is 10-20s, preferably 15s; Extension stage: reaction temperature is 70-75°C, preferably 72°C, reaction time is 8-12s, preferably 10s; Final extension stage: reaction temperature is 70-75°C, preferably 72°C, reaction time is 4-6 min, preferably 5 min; Storage stage: temperature is 3-5°C, preferably 4°C.

[0020] The denaturation stage to the extension stage are performed for no less than 30 cycles, and the pre-denaturation stage and the storage stage are performed once each to obtain the first dsDNA sample.

[0021] Furthermore, the PCR amplification step of the short-chain ssDNA includes a purification step of the first dsDNA sample, specifically including: Recover 50-150 copies of dsDNA samples for library construction by volume, add 150-200 copies of magnetic beads, mix by pipetting, and centrifuge at low speed to remove droplets on the wall of the reaction tube to evenly disperse the magnetic beads in the solution, and react at room temperature for 5-15 minutes; Place the reaction tube into the magnetic rack, wait for the magnetic beads to adsorb to the tube wall, remove the solution, rinse the tube wall with 60-85% alcohol, remove the solution, wait for the surface of the magnetic beads to dry without cracks, add 20-40μl enzyme-free water to mix the magnetic beads, and react at room temperature for 3-6 minutes; Place the reaction tube into the magnetic rack, recover the solution after the magnetic beads are adsorbed to the tube wall, and detect the nucleic acid concentration.

[0022] Further, in the purification step of the first dsDNA sample, 100 dsDNA samples for library construction were recovered, 180 magnetic beads were added, and after pipetting and mixing, the droplets on the wall of the reaction tube were shaken off by low-speed centrifugation to evenly disperse the magnetic beads in the solution, and the reaction was carried out at room temperature for 10 minutes.

[0023] Further, in the purification step of the first dsDNA sample, Place the reaction tube into the magnetic rack, wait for the magnetic beads to adsorb to the tube wall, then aspirate the solution, rinse the tube wall with 80% alcohol, aspirate the solution, wait for the surface of the magnetic beads to dry without cracks, add 30 μl of enzyme-free water, blow and mix the magnetic beads, and react at room temperature for 5 minutes.

[0024] Furthermore, in the end repair step, the 5' end repair reaction comprises, by volume: Ultrapure water (MQ) containing 0.04-0.06 parts of purified amplification product 30-50 parts, Reaction buffer 7-8 parts, 2-3 copies of end repair mixture; The reaction temperature of the end repair enzyme is 36-38°C, and the reaction time is 20-40min; the reaction temperature of the A-tailing enzyme is 60-70°C, and the reaction time is 10-20min.

[0025] Furthermore, in the end repair step, the 5' end repair reaction comprises, by volume: Ultrapure water (MQ) containing 0.05 parts of purified amplification product 40 parts, Reaction buffer 7.1 parts, 2.9 parts of end repair mixture; The reaction temperature of the end repair enzyme was 37°C and the reaction time was 30 min; the reaction temperature of the A-tailing enzyme was 65°C and the reaction time was 15 min.

[0026] Furthermore, in the end repair step, in the 3' end tailing reaction, the reaction conditions include: The reaction temperature is 64-66°C, and the reaction time is 12-16 minutes. Furthermore, the reaction temperature is 65°C, and the reaction time is 15 minutes.

[0027] Furthermore, the step of connecting the joints comprises: The A tail at the 3' end of the product obtained in the end repair step is complementary connected to the thymine deoxyribonucleotide tail protruding at the 5' end of the adapter sequence, the reaction temperature is 18-22° C., the reaction time is 13-16 minutes, and the reaction solution includes by volume: 40-60 copies of end repair products, Ligation Buffer 20-30 copies, DNA Ligase 1-2 copies, DNA Adapter 1-2 copies, Ultrapure water (MQ) 3-4 parts.

[0028] Furthermore, the reaction conditions in the step of connecting the joints are: reaction temperature is 20° C., and reaction time is 15 min.

[0029] Furthermore, the reaction solution in the step of connecting the joint comprises: 50 copies of end repair products, Ligation Buffer 23.4 parts, DNA Ligase 1.6 parts, DNA Adapter 1.9 parts, Ultrapure water (MQ) 3.1 parts.

[0030] Furthermore, in the PCR enrichment and purification step, the reaction solution, by volume, includes: 18-22 parts of the joint product, PCR Primer Mix 4-7 copies, PCR Enzyme Mix 20-30 copies, The PCR mixture includes a second primer.

[0031] Furthermore, in the dsDNA PCR enrichment and purification step, the reaction solution, measured by volume, includes: 19 parts of the connecting joint product, PCR Primer Mix 6 copies, PCR Amplification Mix 25 copies.

[0032] Furthermore, in the dsDNA PCR enrichment and purification step, the reaction conditions include the steps of: Place in a PCR instrument and perform PCR amplification reaction according to the following conditions: Pre-denaturation stage: reaction temperature is 94-96°C, preferably 95°C, reaction time is 2-4min, preferably 3min; Denaturation stage: reaction temperature is 97-99°C, preferably 98°C, reaction time is 15-25s, preferably 20s; Annealing stage: reaction temperature is 55-65°C, preferably 60°C, reaction time is 10-20s, preferably 15s; Extension stage: reaction temperature is 70-75°C, preferably 72°C, reaction time is 25-35s, preferably 30s; Final extension stage: reaction temperature is 70-75°C, preferably 72°C, reaction time is 4-6 min, preferably 5 min; Storage stage: temperature is 3-5°C, preferably 4°C.

[0033] The denaturation stage to the extension stage is performed for no less than 7 cycles, and the pre-denaturation stage and the storage stage are performed once each to obtain the target sequencing library.

[0034] Furthermore, the denaturing of dsDNA into single strands comprises the steps of: The dsDNA samples were placed at 90-100°C for 2-5 min, then placed on ice for 1-5 min and centrifuged.

[0035] Furthermore, the denaturing of dsDNA into single strands comprises the steps of: The dsDNA samples were placed at 98°C for 3 min, then placed on ice for 2 min and centrifuged.

[0036] Furthermore, in the step of connecting the ssDNA into a ring through the clamp DNA, the reaction solution, measured by volume, includes: 30-50 copies of denatured single-stranded DNA, Splint buffer 10-20 copies, Ligase 3-10 copies, Incubate at 36-38°C for 10-30 minutes.

[0037] Furthermore, in the step of connecting the ssDNA into a ring through the clamp DNA, the reaction solution, measured by volume, includes: 40 copies of denatured single-stranded DNA, Splint buffer 15 copies, Ligase 5 copies, Incubate at 37°C for 15 min.

[0038] Optionally, in the 5' end phosphorylation step, the reaction solution comprises, by volume: Containing 0.04-0.06 parts by weight of tailed short-chain ssDNA x parts, 10× polynucleotide kinase buffer 1-3 copies, 0.1mM ATP 0.5-2 copies, Polynucleotide kinase 0.5-2 parts, Ultrapure water (MQ) Make up to 10-30 parts, The reaction temperature is 36-38°C for 20-40 minutes, followed by inactivation at 70-80°C for 5-20 minutes.

[0039] Furthermore, in the 5' end phosphorylation step, the reaction solution comprises, by volume: Containing 0.05 parts by weight of tailed short-chain ssDNA x parts, 10× polynucleotide kinase buffer 2 copies, 0.1mM ATP 1 part, Polynucleotide kinase 1 part, Ultrapure water (MQ) Make up to 20 parts, The reaction temperature was 37°C for 30 min, followed by inactivation at 75°C for 10 min.

[0040] Furthermore, in the step of cyclizing the phosphorylated ssDNA, the reaction solution comprises, by volume: Phosphorylated ssDNA 15-20 copies, 10× circligase buffer 1-3 copies, 50mM MnCl20.5-2 parts, Single-stranded DNA cyclase (ssDNA circligase) 0.5-2 copies, The reaction temperature is 55-65°C for 30-90 min, followed by inactivation at 75-85°C for 5-20 min.

[0041] Furthermore, in the step of cyclizing the phosphorylated ssDNA, the reaction solution comprises, by volume: Phosphorylated ssDNA 16 copies, 10× circligase buffer 2 copies, 50mM MnCl2 1 part, ssDNA circligase 1 part, The reaction temperature was 60°C for 60 min, followed by 80°C for 10 min for inactivation.

[0042] Furthermore, in the step of obtaining circularized single-stranded DNA, the amplification is performed using the purified product as a template, comprising the steps of: Rolling circle amplification was performed using DNA polymerase and random hexamer primers.

[0043] The second aspect of the present application provides a third-generation sequencing method, which includes the short-chain ssDNA sequencing library construction method as described in the first aspect of the present application.

[0044] The third aspect of the present application provides an application of the short-chain ssDNA sequencing library construction method according to the first aspect of the present application in the synthesis of short-chain ssDNA.

[0045] Compared with the prior art, the present invention has the following advantages: The present invention overcomes the defect that the existing short ssDNA chain cannot be used for third-generation sequencing, provides a short-chain ssDNA library construction method for the third-generation sequencing ONT platform, solves the technical problems that the direct library construction and sequencing of short ssDNA in the existing technical means does not meet the third-generation sequencing conditions and the third-generation sequencing accuracy is low, and achieves a technical effect of a sequencing accuracy of more than 96%. BRIEF DESCRIPTION OF THE DRAWINGS

[0046] Figure 1 The electrophoresis diagram is used to verify the bands after DNA circularization using the protocol of Example 1; Figure 2 This is an electrophoresis diagram for the verification of rolling circle amplification after single-strand circularization using the protocol of Example 2. DETAILED DESCRIPTION

[0047] Exemplary embodiments will be described in detail herein, examples of which are shown in the accompanying drawings. When the following description refers to the drawings, the same numbers in different drawings represent the same or similar elements unless otherwise indicated. The implementations described in the following exemplary embodiments do not represent all implementations consistent with the present application. Instead, they are merely examples of devices and methods consistent with some aspects of the present application as detailed in the appended claims.

[0048] The terms used in this application are for the purpose of describing specific embodiments only and are not intended to limit this application. The singular forms of "a", "said" and "the" used in this application and the appended claims are also intended to include plural forms unless the context clearly indicates other meanings. It should also be understood that the term "and / or" used herein refers to and includes any or all possible combinations of one or more associated listed items.

[0049] The present application will be described in detail below through examples.

[0050] After synthesis, short-chain ssDNA (Single-Stranded DNA) often needs to be sequenced to verify the accuracy of the sequence. However, the synthesized short-chain ssDNA is often fixed on a carrier at one end, and due to the small number of molecules, short chain length, and difficulty in connection, it is impossible to successfully build a library, making it difficult to achieve efficient third-generation sequencing.

[0051] In view of this, in order to solve the existing technical problems in the background technology, the inventive concept of the present application is to provide a method for constructing a sequencing library of a short-chain ssDNA, wherein the 5' end of the short-chain ssDNA is connected to a fixed carrier, and the sequencing library construction method comprises the following steps: a step of adding a polynucleotide tail, using the short-chain ssDNA as a template, using terminal deoxynucleotidyl transferase to perform an enzyme reaction, adding a polynucleotide tail to the 3' end of the short-chain ssDNA, and obtaining a tailed short-chain ssDNA; wherein the length of the tailed short-chain ssDNA is not less than 100 nt; a step of obtaining a circularized single-stranded DNA: treating the tailed short-chain ssDNA and connecting it into a ring, then purifying the circular DNA product, and amplifying it using the purified product as a template; a DNA chain fragmentation step: fragmenting the product of the step of obtaining the circularized single-stranded DNA using a nuclease endonuclease, and establishing a sequencing library.

[0052] According to the inventive concept, by extending the short-chain ssDNA and making it into a ring, the technical problems in the existing technical means such as the direct library construction and sequencing of short ssDNA not meeting the third-generation sequencing conditions and the low accuracy of the third-generation sequencing are solved.

[0053] In order to better understand the above technical solution, the above technical solution will be described in detail in combination with specific implementation methods. Those skilled in the art should also understand that the reaction time and component feeding involved in this application cannot be absolutely accurate in actual production or experimental processes, but are all within the allowable error range. For example, if you want to heat the sample for 30 minutes, the actual operation may be 1 second more or less than 1 second in 30 minutes; if you want to weigh 30g of sample, you may actually weigh 30.001g or 29.998g.

[0054] The following are specific embodiments of the present invention, and the embodiments are intended to further describe the present invention rather than to limit the present invention.

[0055] The reagents used in this application are usually commercially available without any description. The specific sources of the reagents are listed as follows: DNA polymerase: Novozymes product number P505-d1 Phanta Max Super-Fidelity DNA Polymerase reagent; Magnetic beads: Norwegian product number N411-03-AA VAHTS DNA Clean Beads magnetic beads; End repair kit: BGI (Cat. No. 1000006985) MGIEasy Universal DNA Library Preparation Kit DNA chain cyclization kit: Hieff NGS® Fast-Pace DNA Cyclization Kit for MGI® (Cat. No. 13341ES16) MGI® sequencing platform Fast-Pace DNA cyclization kit Circular DNA amplification polymerase: Novozyme (Cat. No. N106-01) Phi29 MAX DNA Polymerase Random hexamers for circularized DNA amplification: Biolabs (Cat. No. RFT106) Endonuclease: NEB (Cat. No. M0302S) T7 Endonuclease I Oxford Nanopore Technologies (ONT) library construction kit: SQK-LSK109 kit T4 Polynucleotide Kinase: Novagen (Cat. No. N102) T4 Polynucleotide Kinase; Cyclase: HaiGene (Cat. No. D2602A) ssDNA / RNA cyclizing ligase; Exonuclease: HaiGene (Cat. No. C5014) Exonuclease I (E.coli).

[0056] Those skilled in the art should understand that the above reagents are only provided as a reference for the source of reagents and do not limit the scope of protection of the present application. Unless otherwise specified, the above reagents are not the only choice.

[0057] Experimental samples In this application, short-chain ssDNA refers to single-stranded DNA with a fragment length of 20-100 nt. The following examples take the following sequence as an example: 3'-TCAAGTCGCGTAGGAGTCTCTAGCC-5' (SEQ ID NO.1) The libraries were constructed using the two schemes described in Example 1 and Example 2.

[0058] Example 1 Double-chain cyclization scheme S0. Design primers According to the ssDNA sequence to be synthesized, the required primers in this example were designed taking into account factors such as secondary structure, GC content between 40-60%, and moderate length.

[0059] First primer for PCR amplification of short ssDNA: 5'-TTTTTTTTTTT-CCGATCTCTGAGGATGCGCTGAACT-3' (SEQ ID NO. 2), wherein the "TTTTTTTTTTT" sequence is a thymine segment (i.e., a poly tail segment), and the "CCGATCTCTGAGGATGCGCTGAACT" sequence is a primer body segment.

[0060] Second primer for PCR enrichment and purification step of dsDNA: 5'-AAGGATTCATTCCCGGCTAGAGACTCCTACG-3' (SEQ ID NO. 3); 5'-TTTTTTTTTTTTTTTTTT-3' (SEQ ID NO. 4).

[0061] Those skilled in the art should understand that this step can be performed before the implementation of the technical solution or during the implementation, and has no substantial impact on the realization of the technical solution.

[0062] S1. Obtain sample chip Short-chain ssDNA sequences are synthesized according to demand, wherein the 5' end of the ssDNA sequence is connected to a fixed carrier and has a length of 20-100 nt.

[0063] S2, add polynucleotide A tail The sample short-chain ssDNA obtained in step S1 is used as a template, and a polynucleotide tail of a certain length is added to the 3' end of the short-chain ssDNA using TdT enzyme. The TdT enzyme can be selected from muTdT enzyme from mouse, the tailing speed is controlled at 30-40nt / min, and the tailing length is 8-20nt.

[0064] The specific process steps of this step are as follows: cut the sample chip to be built into a 4×4 mm square and place it at the bottom of a 1.5 mL centrifuge tube. Add the reaction solution prepared with the components shown in Table 1 to ensure that the reaction solution evenly covers the chip without bubbles.

[0065] Table 1

[0066] The reaction temperature of the muTdT enzyme was 30°C, the reaction time was 8-10 min, and finally the enzyme was inactivated at 98°C and centrifuged at 12000 rpm for 2 min to obtain the supernatant.

[0067] S3. Obtaining circularized single-stranded DNA S301, PCR amplification of short-chain ssDNA In this step, the product obtained in step S2 is used as a template, and a PCR amplification reaction is performed using a Novozymes product number P505-d1 reagent and a first primer mixture complementary to the template to enrich the target fragment.

[0068] The specific process steps of this step are: wash the remaining reaction liquid in the product obtained in step S2, then wash it twice with enzyme-free water, and then add the reaction liquid formed by the components shown in Table 2 to ensure that the reaction liquid covers the product and there are no bubbles.

[0069] Table 2

[0070] Place in a PCR instrument and perform PCR amplification reaction according to the following conditions: Pre-denaturation stage: reaction temperature is 95°C, reaction time is 3 min; Denaturation stage: reaction temperature is 95°C, reaction time is 15s; Annealing stage: reaction temperature is 50°C, reaction time is 15s; Extension stage: reaction temperature is 72°C, reaction time is 10s; Final extension stage: reaction temperature was 72°C and reaction time was 5 min; Storage stage: The reaction temperature is 4°C.

[0071] Among them, 30 cycles were performed from the denaturation stage to the extension stage, and the pre-denaturation stage and the final extension stage were performed once each. After the PCR amplification reaction was completed, the product was recovered, and the DNA fragments were purified to obtain the dsDNA sample for library construction.

[0072] Furthermore, the obtained dsDNA sample for library construction is purified, and the operation in this step is as follows: Recover 100 μl of dsDNA sample for library construction, add 180 μl of magnetic beads (1.8×), mix well by pipetting, and centrifuge at low speed to remove droplets on the tube wall so that the magnetic beads are evenly dispersed in the solution. React at room temperature for 10 min.

[0073] Insert the EP tube into the magnetic rack, wait for the magnetic beads to adsorb to the tube wall, then suck off the solution, rinse the tube wall with 80% alcohol, and suck off the solution, taking care not to suck up the magnetic beads. Wait until the surface of the magnetic beads is dry and without cracks, add 30 μl of enzyme-free water, blow and mix the magnetic beads, and react at room temperature for 5 minutes.

[0074] Insert the EP tube into the magnetic rack, recover the solution after the magnetic beads are adsorbed to the tube wall, and use Qubit4.0 to detect the nucleic acid concentration.

[0075] S302, end repair step The following steps can be completed using the reagents in the MGIEasy Universal DNA Library Preparation Kit. They are as follows: Using the purified product obtained in step S301 as a template, the two enzyme mixtures in the MGIEasy Universal DNA Library Preparation Reagent Kit are used to perform end repair enzyme reaction and A-tailing reaction on the DNA fragment on the template to achieve the flattening of the 5' end protrusion of the DNA fragment and the addition of A-tail at the 3' end.

[0076] In the specific process steps, 50 ng was added according to the concentration of the purified product in step 301, and after the total volume was supplemented with MQ to 40 μl, the reaction solution shown in Table 3 was prepared: Table 3

[0077] Use a pipette to draw 10 μl of the prepared end repair reaction solution into the PCR tube, vortex and shake 3 times, 3 seconds each time, centrifuge briefly to collect the reaction solution to the bottom of the tube, place it in a PCR instrument, and perform the following reaction: The temperature of the end repair enzyme reaction was 37°C and the reaction time was 30 min; the temperature of the A-tailing enzyme reaction was 65°C and the reaction time was 15 min.

[0078] S303, Connecting joint steps The product obtained in step S302 is used as a template and a ligase is used to react to connect the A added to the 3' end and the T protruding from the 5' end of the adapter sequence to form a "adapter-fragment-adapter" structure.

[0079] In this step, in the specific process steps, a reaction solution formed by the components shown in Table 4 is prepared and mixed by blowing.

[0080] Table 4

[0081] Use a pipette to slowly draw 25 μl of the prepared adapter ligation reaction solution into the PCR tube in the previous step, vortex and shake 6 times, 3 seconds each time, and centrifuge to collect the reaction solution to the bottom of the tube. Place it in a PCR instrument. The optimal reaction temperature for this step is 20°C and the reaction time is 15 minutes. After the adapter ligation step is completed, purification is required. The purification operation is as follows: Recover 80 μl of sample, add 40 μl of Novozyme magnetic beads (0.5×), mix thoroughly by pipetting, and centrifuge at low speed to remove droplets on the tube wall so that the magnetic beads are evenly dispersed in the solution. React at room temperature for 10 min.

[0082] Insert the EP tube into the magnetic rack, wait for the magnetic beads to adsorb to the tube wall, then suck off the solution, rinse the tube wall with 80% alcohol, and suck off the solution, taking care not to suck up the magnetic beads. Wait until the surface of the magnetic beads is dry and without cracks, add 22ul of enzyme-free water, blow and mix the magnetic beads, and react at room temperature for 5 minutes.

[0083] Insert the EP tube into the magnetic rack and pipette 20 μl of solution after the magnetic beads are adsorbed to the tube wall.

[0084] S304, dsDNA PCR enrichment and purification steps Using the purified product obtained in step S303 as a template, PCR amplification is performed to enrich the target fragments and obtain a DNA sequencing library.

[0085] In the specific process steps of this step, the components shown in Table 5 below are added to the PCR tube for PCR amplification.

[0086] Table 5

[0087] Place in a PCR tube and follow the following conditions: Pre-denaturation stage: reaction temperature is 95°C, reaction time is 3 min; Denaturation stage: reaction temperature is 98°C, reaction time is 20s; Annealing stage: reaction temperature is 60°C, reaction time is 15s; Extension stage: reaction temperature is 72°C, reaction time is 30s; Final extension stage: reaction temperature was 72°C and reaction time was 10 min; Storage stage: The reaction temperature is 4°C.

[0088] Among them, 7 cycles were performed from the denaturation stage to the extension stage, and the preliminary denaturation stage and the final extension stage were performed once each. After the PCR amplification was completed, the product was recovered.

[0089] Further, the DNA fragments are purified, wherein the purification is performed as follows: Recover 50 μl of sample, add 75 μl of Novozyme magnetic beads (1.2×), mix well by pipetting, and centrifuge at low speed to remove droplets on the tube wall so that the magnetic beads are evenly dispersed in the solution. React at room temperature for 10 minutes.

[0090] Insert the EP tube into the magnetic rack, wait for the magnetic beads to adsorb to the tube wall, then suck off the solution, rinse the tube wall with 80% alcohol, and suck off the solution, taking care not to suck up the magnetic beads. Wait until the surface of the magnetic beads is dry and without cracks, add 22ul of enzyme-free water, blow and mix the magnetic beads, and react at room temperature for 5 minutes.

[0091] Insert the EP tube into the magnetic rack and recover the solution after the magnetic beads are adsorbed to the tube wall.

[0092] S305, DNA chain circularization step The following steps can be completed using reagents in the Hieff NGS® Fast-Pace DNA Cyclization Kit for MGI® to perform chain circularization.

[0093] In this step, the double strand is first denatured into a single strand, and then the single strand is subsequently cyclized.

[0094] The specific process steps are: transfer the sample obtained in step S304 to a PCR tube, add MQ to supplement to 34ul, and place the reagents on ice to prepare the reaction system shown in Table 6 below.

[0095] Table 6

[0096] After mixing, denature at 98°C for 3 min in a PCR instrument, immediately place on ice, and centrifuge after an ice bath for 2 min to denature the dsDNA into a single strand for subsequent DNA chain cyclization reaction.

[0097] In the specific process steps, the reaction solution of the previous step was placed on ice to prepare the reaction system shown in Table 7 below.

[0098] Table 7

[0099] Place it in a PCR instrument for chain cyclization reaction, the optimal reaction temperature of the enzyme is 37°C, and the reaction time is 15 minutes.

[0100] After the circularization, the uncircularized fragments were digested by enzyme cleavage. In the specific process steps, the sample was placed on ice to prepare the reaction system shown in Table 8 below.

[0101] Table 8

[0102] Place in PCR instrument for digestion reaction, the optimal reaction temperature of enzyme is 37℃, the reaction time is 10min, and the sample after reaction is purified. The purification operation is as follows: Recover 70ul of sample, add 112ul of Novozyme magnetic beads (1.6×), mix well by pipetting, and centrifuge at low speed to remove droplets on the tube wall, so that the magnetic beads are evenly dispersed in the solution, and react at room temperature for 10 minutes.

[0103] Insert the EP tube into the magnetic rack, wait for the magnetic beads to adsorb to the tube wall, then suck off the solution, rinse the tube wall with 80% alcohol, and suck off the solution, taking care not to suck up the magnetic beads. Wait until the surface of the magnetic beads is dry and without cracks, add 22ul of enzyme-free water, blow and mix the magnetic beads, and react at room temperature for 5 minutes.

[0104] Insert the EP tube into the magnetic rack and recover the solution after the magnetic beads are adsorbed to the tube wall.

[0105] In this step, the DNA chain is circularized by the complementarity between the single-stranded DNA and the bridging oligonucleotide (Splint oligo).

[0106] S306, circularized DNA amplification In this step, phi29 DNA polymerase and random hexamer primers are used to perform rolling circle amplification to amplify the circular single-stranded DNA chain obtained in step S305.

[0107] The specific process steps are: transfer the sample from the previous step into a PCR tube as a replication template and prepare the system shown in Table 9 below.

[0108] Table 9

[0109] Mix well by pipetting, centrifuge to the bottom instantly, incubate at 30°C overnight, and add the reaction solution to 300 μl for later use.

[0110] The gel image of the verification band after using the splint DNA to form a circle is as follows Figure 1 As shown, Figure 1 The one on the middle left is the marker, and the other four are samples after ring formation.

[0111] S4, DNA chain fragmentation The product obtained in step S306 is cut into fragments using T7 endonuclease.

[0112] The specific process steps are: transfer the product obtained in step S306 to a PCR tube, prepare the system shown in Table 10 below, and place on ice for use: Table 10

[0113] Pipette 0.5× Novozyme magnetic beads into the product, discard the supernatant, add the prepared reaction solution to the magnetic beads, mix well by pipetting, incubate the magnetic beads in a 37°C metal bath for 2 hours, shake continuously, separate the magnetic beads on a magnetic stand, recover the supernatant, and add magnetic beads for purification. Purification is performed as follows: Recover 105μl of sample, add 52.5μl of Novozyme magnetic beads (0.5×), mix well by pipetting, and centrifuge at low speed to remove droplets on the tube wall so that the magnetic beads are evenly dispersed in the solution. React at room temperature for 10 minutes.

[0114] Insert the EP tube into the magnetic rack, wait for the magnetic beads to adsorb to the tube wall, then suck off the solution, rinse the tube wall with 80% alcohol, and suck off the solution, taking care not to suck up the magnetic beads. Wait until the surface of the magnetic beads is dry and without cracks, add 32 μl of enzyme-free water, blow and mix the magnetic beads, and react at room temperature for 5 minutes.

[0115] Insert the EP tube into the magnetic rack and recover the solution after the magnetic beads are adsorbed to the tube wall.

[0116] S5, Oxford Nanopore Technologies (ONT) library construction The library was constructed using the SQK-LSK109 kit.

[0117] Example 2 Single-chain cyclization protocol S0. Design primers According to the ssDNA sequence to be synthesized, the required primers in this example were designed taking into account factors such as secondary structure, GC content between 40-60%, and moderate length.

[0118] First primer for PCR amplification of short ssDNA: 5'-TTTTTTTTTTT-CCGATCTCTGAGGATGCGCTGAACT-3' (SEQ ID NO. 5), wherein the "TTTTTTTTTTT" sequence is a thymine segment (i.e., a poly tail segment), and the "CCGATCTCTGAGGATGCGCTGAACT" sequence is a primer body segment.

[0119] Second primer for PCR enrichment and purification step of dsDNA: 5'-AAGGATTCATTCCCGGCTAGAGACTCCTACG-3' (SEQ ID NO. 6); 5'-TTTTTTTTTTTTTTTTTTTT-3' (SEQ ID NO. 7).

[0120] Those skilled in the art should understand that this step can be performed before the implementation of the technical solution or during the implementation, and has no substantial impact on the realization of the technical solution.

[0121] S1. Obtain sample chip Short-chain ssDNA sequences are synthesized according to demand, wherein the 5' end of the ssDNA sequence is connected to a fixed carrier and has a length of 20-100 nt.

[0122] S2, add polynucleotide A tail The sample short-chain ssDNA obtained in step S1 is used as a template, and a polynucleotide tail of a certain length is added to the 3' end of the short-chain ssDNA using TdT enzyme. The TdT enzyme can be selected from muTdT enzyme from mouse, the tailing speed is controlled at 30-40nt / min, and the tailing length is 8-20nt.

[0123] The specific process steps of this step are as follows: cut the sample chip to be built into a 4×4 mm square and place it at the bottom of a 1.5 mL centrifuge tube. Add the reaction solution prepared with the components shown in Table 11 to ensure that the reaction solution evenly covers the chip without bubbles.

[0124] Table 11

[0125] The reaction temperature of the muTdT enzyme was 30°C, the reaction time was 8-10 min, and finally the enzyme was inactivated at 98°C and centrifuged at 12000 rpm for 2 min to obtain the supernatant.

[0126] S3. Obtaining circularized single-stranded DNA S301, 5' end phosphorylation step The product obtained in step S2 was used as a template and phosphorylated using T4 polynucleotide kinase (T4 PNK).

[0127] The specific process steps of this step are: measure the concentration and calculate the input amount of 50ng, and prepare the system shown in Table 12 below.

[0128] Table 12

[0129] Place in PCR instrument. The optimal reaction temperature for this step is 37°C for 30 min and inactivation at 75°C for 10 min.

[0130] S302, ssDNA cyclization step The 5' end and 3' end of the purified product obtained in step S301 are connected to circularize the single-stranded DNA.

[0131] In the specific process steps, the reaction system shown in Table 13 below was prepared on ice: Table 13

[0132] Place in a PCR instrument for single-chain cyclization reaction. The optimal temperature for single-chain cyclization is 60°C, and the reaction takes 1 hour. For inactivation, use 80°C for 10 minutes.

[0133] After the ssDNA is circularized, the uncircularized ssDNA is digested with a nuclease exonuclease. The specific process steps are as follows: Place on ice to prepare the reaction system shown in Table 14 below: Table 14

[0134] Place it on a PCR instrument and perform the following reaction. The optimal temperature for the enzyme reaction is 37°C, the reaction time is 30 minutes, and the inactivation temperature is 80°C for 20 minutes. After purifying the circular DNA, a pure sample is obtained. Purification is performed as follows: Recover 21ul of sample, add 33.6ul of Novozyme magnetic beads (1.6×), mix well by pipetting, and centrifuge at low speed to remove droplets on the tube wall so that the magnetic beads are evenly dispersed in the solution. React at room temperature for 10min.

[0135] Insert the EP tube into the magnetic rack, wait for the magnetic beads to adsorb to the tube wall, then suck off the solution, rinse the tube wall with 80% alcohol, and suck off the solution, taking care not to suck up the magnetic beads. Wait until the surface of the magnetic beads is dry and without cracks, add 22ul of enzyme-free water, blow and mix the magnetic beads, and react at room temperature for 5 minutes.

[0136] Insert the EP tube into the magnetic rack and recover the solution after the magnetic beads are adsorbed to the tube wall.

[0137] S303, circularized DNA amplification In this step, phi29 DNA polymerase and random hexamer primers are used to perform rolling circle amplification to amplify the circular single-stranded DNA chain obtained in step S302.

[0138] The specific process steps are: transfer the sample from the previous step into a PCR tube as a replication template and prepare the system shown in Table 15 below.

[0139] Table 15

[0140] Mix well by pipetting, centrifuge to the bottom instantly, incubate at 30°C overnight, and add the reaction solution to 300 μl for later use.

[0141] The gel image of the verification band after using the splint DNA to form a circle is as follows Figure 2 As shown, Figure 2 The one on the middle left is the marker, and the other four are samples after ring formation.

[0142] S4, DNA chain fragmentation The product obtained in step S303 is cut into fragments using T7 endonuclease.

[0143] The specific process steps are: transfer the product obtained in step S303 to a PCR tube, prepare the system shown in Table 16 below, and place on ice for use: Table 16

[0144] Pipette 0.5× Novozyme magnetic beads into the product, discard the supernatant, add the prepared reaction solution to the magnetic beads, mix well by pipetting, incubate the magnetic beads in a 37°C metal bath for 2 hours, shake continuously, separate the magnetic beads on a magnetic stand, recover the supernatant, and add magnetic beads for purification. Purification is performed as follows: Recover 105μl of sample, add 52.5μl of Novozyme magnetic beads (0.5×), mix well by pipetting, and centrifuge at low speed to remove droplets on the tube wall so that the magnetic beads are evenly dispersed in the solution. React at room temperature for 10 minutes.

[0145] Insert the EP tube into the magnetic rack, wait for the magnetic beads to adsorb to the tube wall, then suck off the solution, rinse the tube wall with 80% alcohol, and suck off the solution, taking care not to suck up the magnetic beads. Wait until the surface of the magnetic beads is dry and without cracks, add 32 μl of enzyme-free water, blow and mix the magnetic beads, and react at room temperature for 5 minutes.

[0146] Insert the EP tube into the magnetic rack and recover the solution after the magnetic beads are adsorbed to the tube wall.

[0147] S5, Oxford Nanopore Technologies (ONT) library construction The library was constructed using the SQK-LSK109 kit.

[0148] Test Example 1 This test example investigated the sequencing accuracy of the short-chain ssDNA library constructed by the present invention for the third-generation sequencing ONT platform.

[0149] Take 2 different batches of sample chips, and construct short-chain ssDNA libraries for the three-generation sequencing ONT platform according to the method of Example 1 of the present invention, respectively, sample 1-1 and sample 1-2; take another 2 different batches of sample chips, and construct short-chain ssDNA libraries for the three-generation sequencing ONT platform according to the method of Example 2 of the present invention, respectively, sample 2-1 and sample 2-2. The obtained 4 kinds of samples were sequenced using the three-generation sequencing ONT platform, and the results are shown in Table 17: Table 17

[0150] Combination Figure 1-Figure 2 , Figure 1 The electrophoresis diagrams of sample 1-1 (RCA-1, RCA-2) and sample 1-2 (RCA-3, RCA-4) after DNA cyclization showed that the cyclized DNA sequences in each sample were all above 100 bp, meeting the experimental requirements; Figure 2 This is the electrophoresis diagram of the rolling circle amplification verification after single-stranded circularization of sample 2-1 and sample 2-2, showing that the sequence length in each sample after rolling circle amplification is greater than 1500bp, and the gel image is single and clean, meeting the requirements for library construction.

[0151] From the above results, it can be seen that the accuracy of sequencing using the ONT platform after the library is constructed using the method of the present invention has reached more than 96%, even higher than the 90% accuracy of the ONT chip R9.4 result. Therefore, it can be understood that the sequencing library of the short-chain ssDNA fixed by the carrier constructed by the method of the present invention can not only be applied to sequencing experiments such as the third-generation sequencing platform, but also the obtained detection results are even better than the accuracy of the existing third-generation sequencing technology for normal sequences.

[0152] In summary, the sequencing library construction method, sequencing method and application of short-chain ssDNA provided in the embodiments of the present invention, by extending the short-chain ssDNA and making it into a ring, solves the technical problems in the prior art that direct library construction and sequencing of short ssDNA does not meet the third-generation sequencing conditions and the third-generation sequencing accuracy is low, and realizes the construction of a special ssDNA library, which has a good commercial prospect.

[0153] It should be pointed out that for ordinary technicians in this field, the technical features in the above embodiments can be freely combined, and the formed technical solutions also belong to the embodiments disclosed in this application.

[0154] Furthermore, without departing from the principles of the present application, several improvements and modifications may be made to the present application, and these improvements and modifications also fall within the protection scope of the claims of the present application.

Claims

1. A method for constructing a sequencing library of short-chain ssDNA, characterized in that: The 5' end of the short-chain ssDNA is connected to a fixed carrier, and the 3' end is an exposed end. The sequencing library construction method comprises the steps of: The step of adding a polynucleotide tail, using the short-chain ssDNA as a template, using terminal deoxynucleotidyl transferase to perform an enzyme reaction, adding a polynucleotide tail to the 3' end of the short-chain ssDNA, and obtaining a tailed short-chain ssDNA; wherein the length of the tailed short-chain ssDNA is not less than 100 nt; Steps for obtaining circularized single-stranded DNA: treating the tailed short-stranded ssDNA and connecting it into a circle, then purifying the circular DNA product, and using the purified product as a template for amplification; DNA chain fragmentation step: The product obtained from the step of obtaining circularized single-stranded DNA is fragmented using nuclease, and a sequencing library is established.

2. The method for constructing a sequencing library according to claim 1, characterized in that: The step of treating the tailed short-chain ssDNA and connecting it into a ring comprises: PCR amplification steps of short-chain ssDNA: using the tailed short-chain ssDNA as a template, designing the first primer for PCR amplification reaction, and purifying the amplified product; End repair step: Using the purified amplified product as a template, perform 5' end repair and 3' end tailing reactions; Connector ligation step: using the product obtained in the end repair step as a template, using a ligase to react, obtaining a template with a connector, and purifying it; dsDNA PCR enrichment and purification step: using the purified product obtained in the adapter ligation step as a template, design a second primer for PCR enrichment and purification; DNA chain circularization step: dsDNA is denatured into single strands, and ssDNA is connected into a circle through clamp DNA.

3. The method for constructing a sequencing library according to claim 1, wherein: The step of treating the tailed short-chain ssDNA and connecting it into a ring comprises: 5' end phosphorylation step: phosphorylating the 5' end of the tailed short-chain ssDNA; ssDNA cyclization step: cyclize the phosphorylated ssDNA to connect its 5' end with its 3' end.

4. The method for constructing a sequencing library according to claim 1, wherein: In the step of adding polynucleotide tails, the tailing reaction rate is controlled at 30-40 nt / min.

5. The method for constructing a sequencing library according to claim 2, wherein: The method of denaturing dsDNA into a single strand comprises the steps of: The dsDNA samples were placed at 90-100°C for 2-5 min, then placed on ice for 1-5 min and centrifuged.

6. The method for constructing a sequencing library according to claim 2, characterized in that: In the step of connecting the ssDNA into a ring through the clamp DNA, the reaction solution comprises, by volume: 30-50 copies of denatured single-stranded DNA, 10-20 copies of ligation buffer, Ligase 3-10 copies, Incubate at 36-38°C for 10-30 minutes.

7. The method for constructing a sequencing library according to claim 3, wherein: In the 5' end phosphorylation step, the reaction solution comprises, by volume: Containing 0.04-0.06 parts by weight of tailed short-chain ssDNA x parts, 10× polynucleotide kinase buffer 1-3 copies, 0.1mM ATP 0.5-2 copies, Polynucleotide kinase 0.5-2 parts, Ultrapure water is added to 10-30 parts. The reaction temperature is 36-38°C for 20-40 minutes, followed by inactivation at 70-80°C for 5-20 minutes.

8. The method for constructing a sequencing library according to claim 3, wherein: In the step of cyclizing the phosphorylated ssDNA, the reaction solution comprises, by volume: Phosphorylated ssDNA 15-20 copies, 10× cyclase buffer 1-3 parts, 50mM MnCl2 0.5-2 parts, 0.5-2 copies of single-stranded DNA cyclase, The reaction temperature is 55-65°C for 30-90 min, followed by inactivation at 75-85°C for 5-20 min.

9. A third-generation sequencing method, comprising the method for constructing a short-chain ssDNA sequencing library as described in any one of claims 1 to 8.

10. Use of the method for constructing a short-chain ssDNA sequencing library according to any one of claims 1 to 8 in the synthesis of short-chain ssDNA.

Images