Inspection system for polycystic kidney disease and detection method for non-disease diagnosis purpose

Abstract

The invention relates to the technical field of gene detection, in particular to an inspection system for polycystic kidney diseases and an inspection method for non-disease diagnosis purposes. The system comprises a collection module used for collecting peripheral blood of a to-be-detected person and extracting and breaking high molecular weight DNA, a Y-shaped pre-library preparation module used for repairing sheet ends and connecting joints to construct a Y-shaped pre-library, and a targeted enrichment module used for carrying out hybridization and targeted enrichment on target genes by adopting a target area capture probe. The PacBio three-generation library construction module is used for carrying out three-generation sequencing joint connection to obtain a PacBio three-generation library, and the sequencing analysis module is used for carrying out single-molecule real-time sequencing to obtain sequencing data of a target region, and carrying out disassembly and analysis on the sequencing data of the target region to obtain variation types of PKD1 and PKD2; the detection result is accurate, and mutation of PKD1 and pseudogene thereof can be distinguished.

Description

Technical Field

[0001] The present invention relates to the technical field of gene detection, and in particular to a polycystic kidney disease detection system and a method for non-disease diagnosis purposes. Background Art

[0002] Polycystic kidney disease (PKD), also known as Perlmann syndrome, Potter (I) syndrome, cystic kidney, congenital renal cystic tumor disease, benign multilocular cystic tumor of the kidney, bilateral renal dysgenesis syndrome, is a genetic disease that seriously endangers health. After the disease occurs, multiple cysts appear on both sides of the kidney and will progressively increase. If no intervention is performed, the kidney function will be seriously damaged and eventually lead to the occurrence of uremia. There are two different inheritance modes of polycystic kidney disease, which are divided into autosomal dominant polycystic kidney disease (ADPKD) and autosomal recessive polycystic kidney disease (ARPKD). ADPKD is more common in clinical practice, usually in adults, with an incidence rate of 1 / 400 to 1 / 1000. After reaching the age of 60, about 50% of patients will develop into the uremia stage. The incidence of ARPKD is about 1 / 6000 to 1 / 40000, which is more common in children and infants, and most children die in their early years. Current research suggests that PKD is caused by gene mutations, which lead to abnormalities in the structure and function of polycystin, resulting in the formation and continuous growth of vesicles.

[0003] ADPKD is caused by single gene mutations, mainly caused by mutations in two genes: PKD1 (MIM 601313) and PKD2 (MIM 173910). PKD1 is located on chromosome 16 (16p13.3), and its mutations account for about 85% of cases of ADPKD caused by genetic causes; PKD2 is located on chromosome 4 (4q21-11), and its mutations account for the remaining 15%. PKD1 encodes polycystin-1, which is an integral membrane protein that forms a complex with polycystin-2, which is encoded by PKD2, and polycystin-2 is involved in the intracellular Ca 2+Homeostatic calcium-permeable cation channel. Polycystin forms a functional complex in the primary cilium of the renal tubule and is thought to be involved in the adhesion, proliferation and differentiation of renal tubular epithelial cells. The heterogeneity observed at the genetic and allele levels shows that ADPKD has a certain degree of complexity. At the genetic level, PKD1 mutations are associated with a more severe disease phenotype and an earlier age of onset of end-stage renal disease (ESRD) compared with PKD2 mutations (54.3 years for PKD1 and 74 years for PKD2). At the allele level, the average age of onset of ESRD in truncating mutations is earlier than that in non-truncating mutations (55.6 years and 67.9 years, respectively). Compared with other monogenic diseases, genetic analysis and mutation screening of ADPKD cases are technically more challenging. One reason is that both PKD1 and PKD2 are highly variable genes, and molecular analysis has shown that there are no clear hotspot mutations in the entire region of these two genes. Mutations are usually unique to a single family, and recurrent mutations account for only 30% of the total number of mutations detected. In the Autosomal Dominant Polycystic Kidney Disease Mutation Database (PKDB) established by the Mayo Clinic in the United States, 2055 PKD1 variants are listed, of which 1243 are clearly pathogenic variants, and 374 of the 463 PKD2 variants are clearly pathogenic variants (http: / / pkdb.mayo.edu). Another reason is that the existence of the PKD1 pseudogene increases the complexity of ADPKD gene detection. PKD1 is located in a segmental duplication region, and its first 32 exons are repeated 6 times in a region 13 to 16 Mb proximal to the original PKD1 gene (16p.13.1), with a sequence homology of 97.6 to 97.8% with the original PKD1 gene.

[0004] Due to the interference of PKD1 pseudogenes and the high GC characteristics of some regions, NGS sequencing has certain uncertainties in the identification of PKD1 variants. These uncertainties are reflected in the fact that the true positive variants in the PKD1 repeat region only account for 28%-50%, and most of the false positive sites are caused by mismatches, low-quality alignments, and pseudogenes to bring "contaminated fragments". Therefore, short-read sequencing based on NGS cannot meet the diagnosis of ADPKD.

[0005] At present, some detection methods have been derived based on the third-generation sequencing, such as using different primers to perform Long-PCR on the target fragments to detect the target mutations, but these methods have the limitation that they can only detect known mutations. At the same time, due to the excessive length of the PKD1 gene, multiple pairs of primers are required for nested PCR amplification, which not only consumes a lot of manpower, is costly, and inefficient. At the same time, there are 6 highly homologous pseudogenes in the PKD1 gene, with a sequence homology of up to 97.7% with the 1-33 exons of the PKD1 gene. Ordinary PCR is difficult to avoid the interference of pseudogenes. In addition, the PKD1 gene has a complex structure, and the GC content of some regions exceeds 70%, which increases the difficulty of PCR. At the same time, PCR has a preference, resulting in different amplification efficiencies of alleles of different lengths. Summary of the invention

[0006] In view of the above-mentioned deficiencies in the prior art, the present invention aims to provide a polycystic kidney disease inspection system and a detection method for non-disease diagnosis purposes, so as to detect complex variant types of the PKD1 gene.

[0007] In order to solve the above problems, the present invention adopts the following technical solutions:

[0008] In one aspect, the present invention provides a polycystic kidney disease examination system, comprising an acquisition module, a Y-shaped pre-library preparation module, a targeted enrichment module, a PacBio third-generation library construction module, and a sequencing analysis module;

[0009] The collection module is used to collect peripheral blood of the subject to be tested and to extract, shear and screen high molecular weight DNA;

[0010] The Y-shaped pre-library preparation module is used to perform end repair and 3'A-tailing reaction on the extracted and sheared high molecular weight DNA, perform Y-shaped adapter connection and fragment screening, and then use a long-fragment amplification enzyme to perform long-fragment PCR amplification to obtain a Y-shaped pre-library;

[0011] The targeted enrichment module is used to hybridize, target enrich and long-fragment PCR amplify the Y-shaped pre-library with a biotin-labeled capture probe to obtain a capture library; the target gene capture region is: PKD1: GRCh37 / hg19, chr16: 2085692-2134898; PKD2: GRCh37 / hg19, chr4: 88006483-88076777; the nucleotide sequence of the biotin-labeled capture probe is SEQ ID No: 1-SEQ ID No: 326;

[0012] The PacBio third-generation library construction module is used to perform DNA damage repair, end repair, purification, sequencing adapter ligation and digestion according to the captured library to obtain a PacBio third-generation library;

[0013] The sequencing analysis module is used to perform single-molecule real-time sequencing with a PacBio third-generation library to obtain sequencing data of the target region, decompose the sequencing data of the target region, and analyze the variation types of PKD1 and PKD2.

[0014] In another aspect, the present invention provides a method for detecting PKD1 and PKD2 mutations for non-disease diagnosis purposes, comprising:

[0015] Collect peripheral blood from the subjects and perform high molecular weight DNA extraction, shearing and fragment screening;

[0016] The extracted and sheared high molecular weight DNA is subjected to end repair and 3'A-tailing reaction, and Y-shaped adapter ligation and fragment screening are performed, and then long-fragment PCR amplification is performed using a long-fragment amplification enzyme to obtain a Y-shaped pre-library;

[0017] According to the Y-shaped pre-library, a capture probe labeled with biotin is used to hybridize with the Y-shaped pre-library, targeted enrichment and long-fragment PCR amplification to obtain a capture library; the target gene capture region is: PKD1: GRCh37 / hg19, chr16: 2085692-2134898; PKD2: GRCh37 / hg19, chr4: 88006483-88076777; the nucleotide sequence of the biotin-labeled capture probe is SEQ ID No: 1-SEQ ID No: 326;

[0018] Based on the captured library, DNA damage repair, end repair, purification, sequencing adapter ligation and digestion were performed to obtain the PacBio third-generation library;

[0019] Single-molecule real-time sequencing was performed using the PacBio third-generation library to obtain sequencing data for the target region, which was then decomposed to analyze the mutation types of PKD1 and PKD2.

[0020] The beneficial effects of the present invention are: the detection results are accurate. In addition to conventional detection, it can accurately distinguish mutations occurring on PKD1 and its pseudogenes, and can accurately detect complex structural variations such as large fragment deletions and fusions, and can also detect unknown mutations that have not been reported so far. The accuracy is high. PacBio's dumbbell-shaped library can be interpreted multiple times during sequencing. The base accuracy of the sequencing results after correction is greater than 99%. Moreover, PacBio sequencing errors are random, and the base accuracy is greater than 99.9% through sequencing depth correction, which can accurately interpret gene mutations within the primer detection range. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 This is a quality inspection diagram of the fragment length distribution of the captured library of the present invention; wherein, Migration time represents the migration time, LM20 represents a band with a size of 20 bp in the quality inspection marker, and LM1000 represents a band with a size of 1000 bp in the quality inspection marker.

[0022] Figure 2 This is a representative PacBio sequencing result diagram of the PKD1 gene mutation sample of the present invention; the red frame portion indicates gene duplication mutation. DETAILED DESCRIPTION

[0023] The present invention is further described in detail below in conjunction with specific embodiments.

[0024] It should be noted that these embodiments are only used to illustrate the present invention rather than to limit the present invention. Simple improvements to the method based on the concept of the present invention are within the scope of protection claimed by the present invention.

[0025] Example 1 Construction of PKD1 / PKD2 mutation detection process

[0026] 1. Collect 10 mL of peripheral blood from the patient using an EDTA anticoagulant tube.

[0027] 2. Extraction of genomic DNA.

[0028] The peripheral blood of the subjects to be tested was extracted using a special high molecular weight DNA extraction kit to obtain high molecular weight gDNA, and the concentration was measured and the integrity of the genomic DNA was detected by agarose gel electrophoresis.

[0029] 3. Shearing of high molecular weight gDNA

[0030] (1) Take 2 μg of high molecular weight gDNA from the subject and dilute it to 150 μL with ddH2O.

[0031] (2) Place the diluted sample into the top of the g-TUBE (Covaris, 520079) device and close the lid tightly.

[0032] (3) Place the g-TUBE containing the sample into a centrifuge and set the fragmentation conditions according to the required fragment length. For example, if you want to fragment the fragments to about 10 kbp, you can set the fragmentation conditions to 6000 rpm, 2 min; if you want to fragment the fragments to about 6 kbp, you can set the fragmentation conditions to 8000 rpm, 2 min. The fragmentation conditions mentioned here are based on the use of an Eppendorf 5424 centrifuge.

[0033] (4) Flip the g-TUBE device over and centrifuge under the same conditions. If there is still residual sample at the top, centrifuge the sample at a higher speed for 5 seconds. Repeat the high-speed centrifugation until all the sample is in the bottom chamber of the g-TUBE.

[0034] (5) Transfer the sample to a new 1.5 mL low-absorbency centrifuge tube for later use.

[0035] 4. Screening of fragmented DNA

[0036] (1) AmpureXP beads (Beckman, A63881) were diluted 2× using 1 mM Tris-HCl pH 8.

[0037] (2) Mix the fragmented DNA to be screened and the diluted fragment screening magnetic beads in a ratio of 1:4.

[0038] (3) Briefly centrifuge the tube to concentrate the magnetic bead / DNA mixture at the bottom of the tube. Place the tube on a magnetic rack for 5-10 minutes or until the magnetic beads gather on the side of the tube and the supernatant becomes clear. Slowly remove the clear supernatant to avoid disturbing the magnetic beads.

[0039] (4) Wash the magnetic beads twice with fresh 80% ethanol. After 30 seconds, remove the 80% ethanol with a pipette.

[0040] (5) Eluting the cleaned magnetic beads to obtain fragmented DNA after fragment screening.

[0041] 5. Use the S3 cartridge for large fragment detection (Bioptic, c105106) to perform Qsep100 quality inspection on the fragmented DNA after fragment screening. The proportion of fragments below 3 kbp should be less than 10%, otherwise it will be regarded as unqualified fragmented DNA.

[0042] 6. Preparation of pre-library

[0043] (1) Use a long fragment library construction kit to construct a long fragment Y-shaped pre-library. Dilute the purified fragmented DNA that has passed the quality inspection to 50 μL, and prepare the end repair and 3'A-tailing reactions according to Table 1.

[0044] Table 1 Preparation of end repair and 3'A-tailing reaction reagents

[0045]

[0046] Set up the PCR program according to Table 2 to perform end repair and 3'A-tailing reactions.

[0047] Table 2 End repair and 3'A-tailing reaction PCR program

[0048]

[0049] (2) Adapter ligation: Add the following components in order according to Table 3 to the end repair and 3'A-tailing reaction products.

[0050] Table 3 Connector connection reagents

[0051]

[0052] Adapter sequence

[0053] A.ACACTCTTTCCCTACACGACGCTCTTCCGATC*T

[0054] BP-GATCGGAAGAGCACACGTCT

[0055] P: Phosphorylation*Phosphorylation

[0056] Vortex to mix, centrifuge briefly to ensure that all the solution is at the bottom of the tube, and immediately incubate at 20°C for 1 h in a PCR instrument with the heated lid set to 85°C.

[0057] (3) Fragment screening of adapter ligation products

[0058] ① Dilute AmpureXP beads (Beckman, A63881) in 1 mM Tris-HCI pH 8 at a 2× dilution ratio;

[0059] ② Mix the adapter ligation product to be screened with the diluted fragment screening magnetic beads in a ratio of 1:4.

[0060] ③ Centrifuge the centrifuge tube momentarily to concentrate the magnetic beads / DNA mixture at the bottom of the tube. Place the centrifuge tube on a magnetic rack for 5-10 minutes or until the magnetic beads gather on the side of the centrifuge tube and the supernatant becomes clear. Slowly remove the clear supernatant to avoid disturbing the magnetic beads.

[0061] ④ Wash the magnetic beads twice with fresh 80% ethanol. After 30 seconds, aspirate the 80% ethanol with a pipette.

[0062] ⑤ Elute the cleaned magnetic beads to obtain the adapter connection product after fragment screening.

[0063] (3) The ligation product was subjected to long-fragment PCR amplification using a dedicated enzyme for long-fragment amplification, and the reaction system was configured according to Table 4; the dedicated enzyme for long-fragment amplification was Takara LA Taq DNA Polymerase Hot-Start Version (Takara, RR042A).

[0064] Table 4 Long fragment PCR amplification reagents

[0065]

[0066] Index primer sequence

[0067] Sequence 1:

[0068] CAAGCAGAAGACGGCATACGAGATNNNNNNNNNGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC

[0069] Sequence 2:

[0070] AATGATACGGCGACCACCGAGATCTACACNNNNNNNNNAACACTCTTTCCCTACACGAGCTCTTCCGATCT.

[0071] N is any base of A, T, C or G.

[0072] Different tags can be single nucleotide sequences of lengths such as 8nt, 10nt, or 12nt.

[0073] Carry out PCR reaction according to Table 5.

[0074] Table 5 Long fragment PCR amplification program

[0075]

[0076] (4) The Y-shaped pre-library PCR products were screened for fragments, aiming to control short fragments below 3 kb to less than 10%.

[0077] ① Dilute AmpureXP beads (Beckman, A63881) in 1 mM Tris-HCl pH 8 at a 2× dilution ratio.

[0078] ② Mix the Y-shaped pre-library PCR product to be screened with the diluted fragment screening magnetic beads in a ratio of 1:4.

[0079] ③ Centrifuge momentarily to concentrate the magnetic beads / DNA mixture at the bottom of the tube. Place the centrifuge tube on the magnetic rack for 5-10 minutes or until the magnetic beads gather on the side of the centrifuge tube and the supernatant becomes clear. Slowly remove the clear supernatant to avoid disturbing the magnetic beads.

[0080] ④ Wash the magnetic beads twice with fresh 80% ethanol. After 30 seconds, aspirate the 80% ethanol with a pipette.

[0081] ⑤ Elute the cleaned magnetic beads to obtain the Y-shaped pre-library PCR product after fragment screening.

[0082] ⑥ Use the S3 card holder for large fragment detection (Bioptic, c105106) to perform Qsep100 quality inspection on the Y-shaped pre-library PCR product after fragment screening. The proportion of fragments below 3kbp should be less than 10%, otherwise it will be regarded as an unqualified Y-shaped pre-library PCR product.

[0083] 7. Hybridization of the Y-shaped pre-library with the biotin-labeled double-stranded DNA probe

[0084] The components of the capture kit used in this example refer to patent ZL202011284834.1

[0085] (1) In this embodiment, the GRCh37 / hg19 gene sequence is used as the reference genome sequence, the target capture region is selected as the target gene and its upstream and downstream regions, and continuous probe design is performed in this region. The target gene coding region and non-coding region are required to be fully covered, wherein the PKD1 targeted capture region is GRCh37 / hg19, chr16:2085692-2134898; the PKD2 targeted capture region is GRCh37 / hg19, chr4:88006483-88076777. The capture probe used to enrich the target gene and flanking region is a biotin-labeled double-stranded DNA probe, and the probe sequence is shown in Table 6.

[0086] Table 6 Probe sequence list

[0087]

[0088]

[0089]

[0090]

[0091]

[0092]

[0093]

[0094]

[0095]

[0096]

[0097]

[0098]

[0099]

[0100]

[0101]

[0102]

[0103] (2) The hybridization reaction can be performed as a single hybrid or a multi-hybrid. For a multi-hybrid, multiple Y-shaped pre-libraries need to be mixed at equal molecular weights according to the following formula: fmol = (concentration * 10 6 ) / [650*length(bp)].

[0104] (3) Vacuum concentrate a single library or a mixed library of equal molecular weight to a dry powder state, and resuspend the library according to the components in Table 7.

[0105] Table 7 Library resuspension reagents

[0106]

[0107] (4) Denature the resuspended library and probe according to the PCR program in Table 8.

[0108] Table 8 Denaturation PCR program table

[0109]

[0110]

[0111] (5) Add 20 μl of hybridization buffer preheated at 65°C for at least 5 min to the denatured pre-library and probe mixture, incubate at 68°C, with the heated lid at 85°C, and perform the hybridization reaction for 16-18 hours.

[0112] 8. Targeted Enrichment

[0113] (1) Preheat the streptavidin magnetic beads at 65°C for at least 10 min, then transfer the hybridization products directly from the 65°C condition to the 65°C streptavidin magnetic beads. Be sure not to cool the hybridization product temperature to room temperature, otherwise it will cause serious off-target effects.

[0114] (2) After the hybridization product is bound to the streptavidin magnetic beads, the hybridization product and the streptavidin magnetic beads are rinsed and eluted.

[0115] (3) The eluted product was captured and then PCR was performed using a long fragment specific amplification enzyme. The amplification system is shown in Table 9.

[0116] Table 9 Capture library amplification system

[0117]

[0118] Universal primer sequences:

[0119] F:AATGATACGGCGACCACCGAGATCTACAC;

[0120] R:ATCTCGTATGCCGTCTTCTGCTTG.

[0121] Amplify according to the amplification program in Table 10.

[0122] Table 10 Capture library amplification program

[0123]

[0124]

[0125] (4) Purify the PCR product using 0.8* purification magnetic beads to obtain a capture library.

[0126] (5) The captured library is tested for concentration and fragment length distribution by Qubit and Qsep100. The length of the captured library should be 3k-10k. Figure 1 .

[0127] 9. PacBio third-generation library construction (kit from PacBio, PN: 103-381-20)

[0128] (1) DNA damage repair

[0129] Configure the DNA damage repair system according to Table 11.

[0130] Table 11 Damage repair system

[0131]

[0132] The prepared reaction solution was shaken and mixed. The reaction conditions were: 37°C, 20 min; maintained at 4°C.

[0133] (2) End repair and purification

[0134] Configure the end repair and purification reaction system according to Table 12.

[0135] Table 12 End repair and purification reaction system

[0136]

[0137] The prepared reaction solution was shaken and mixed. The reaction conditions were: 25°C, 5 min; maintained at 4°C.

[0138] (3) Connector connection

[0139] Configure the adapter ligation reaction system according to Table 13.

[0140] Table 13 Linker connection reaction system

[0141]

[0142] The prepared reaction solution was shaken and mixed. The reaction conditions were: 25°C, 24h; 65°C, 10min; maintained at 4°C.

[0143] (4) Digestion of failed ligation DNA and adapter sequences.

[0144] The reaction system was configured according to Table 14.

[0145] Table 14 Digestion reaction system

[0146]

[0147] The prepared reaction solution was shaken and mixed. The reaction conditions were: 37°C, 1h; maintained at 4°C.

[0148] 10. Sequencing and result analysis

[0149] The prepared library was sequenced using a third-generation single-molecule sequencer (PacBio Revio), so that the average sequencing depth of the target region reached more than 50×.

[0150] The obtained data is split and analyzed. The specific analysis method is as follows:

[0151] 1) Data splitting and cleaning

[0152] Lima software is used to split PacBio sequencing data and divide the raw sequencing data into different samples according to different index sequences. Lima software can accurately identify and remove index sequences in samples to obtain clean sequencing data. This step can effectively reduce errors in sequencing data and optimize subsequent variant detection analysis.

[0153] 2) Data comparison

[0154] Minimap2 is used to align the cleaned sample data (cleandata) with the reference genome (e.g. hg19). During the alignment process, the -MD parameter is used to output the matching MD tags, which is helpful for subsequent downstream variant detection analysis. Through efficient alignment steps, the consistency of the data with the reference genome can be ensured, providing high-quality basic data for variant detection.

[0155] 3) Basic quality control analysis

[0156] A series of basic quality control statistical analyses are performed on the sequencing data of the target region to ensure the reliability of the data quality. The main analysis contents include:

[0157] Data volume: The total amount of sequencing data, including sequencing depth and coverage.

[0158] Alignment rate: The ratio of sample data aligned to the reference genome, reflecting the alignment quality.

[0159] Fragment length: The length distribution of sequencing fragments affects the accuracy of subsequent analysis.

[0160] Capture efficiency: The capture efficiency of the target area determines the coverage of variant detection.

[0161] These quality control indicators can provide data quality assurance for subsequent variation analysis.

[0162] 4) SNV variation detection

[0163] Use DeepVariant to perform SNV (single nucleotide variation) analysis on the specified target region (BED file). The DeepVariant tool is optimized for PacBio data. Use the --model_type=PACBIO parameter to select a variant detection model suitable for PacBio sequencing data to ensure high accuracy of variant detection. The tool uses a deep learning algorithm to accurately identify SNVs in samples, especially in long read regions in PacBio data.

[0164] 5) SV mutation detection

[0165] Use cuteSV tool for structural variation (SV) analysis. To ensure the accuracy and efficiency of structural variation detection, cuteSV tool configures several key parameters:

[0166] --max_cluster_bias_INS1000: Sets the maximum insertion variation clustering bias, which is used to control the clustering effect of insertion variation.

[0167] --diff_ratio_merging_INS 0.9: Set the merging difference ratio when inserting variants.

[0168] --max_cluster_bias_DEL 1000: Set the maximum missing variant clustering bias to control the clustering effect of missing variants.

[0169] --diff_ratio_merging_DEL 0.5: Set the merging difference ratio when merging missing variants.

[0170] -md 500: Set the maximum cluster distance to control the cluster assignment of structural variations.

[0171] -mi 500: Set the maximum clustering distance for inserting variants.

[0172] -q 20: Sets the minimum quality score to ensure the quality of variant detection.

[0173] -l 10: Set the minimum mutation length to remove short mutations.

[0174] -L 5000000: Sets the maximum region range for variation analysis.

[0175] -s 10: Set the minimum supported cut length.

[0176] The settings of these configuration parameters ensure the accurate identification and efficient detection of insertion (INS) and deletion (DEL) variants, especially when processing long read length data (such as PacBio data), which can greatly improve the reliability and accuracy of structural variation analysis.

[0177] 6) SNV variant annotation

[0178] ANNOVAR and VEP tools were used to annotate SNV variants. The annotation information includes:

[0179] Variation information: such as nucleotide changes, amino acid changes, HGVS (Human Genome Variation Society) nomenclature, genotype, etc.

[0180] Population frequency: Variant frequencies in public databases such as 1000g and gnomAD help assess the commonness and rarity of variants.

[0181] Disease and phenotype information: including ACMG pathogenicity judgment, inheritance pattern, disease phenotypic characteristics, etc. This information helps to evaluate the potential relationship between variants and diseases.

[0182] Prediction tools and scoring: Use multiple bioinformatics tools (such as spliceAI, SIFT, PolyPhen-2, REVEL score, GERP++, etc.) to predict and score variant functions and help determine the potential impact of variants.

[0183] These annotation information provides strong data support for subsequent variant function assessment and clinical decision-making.

[0184] According to the above construction process, a polycystic kidney disease inspection system was constructed, including an acquisition module, a Y-shaped pre-library preparation module, a targeted enrichment module, a PacBio third-generation library construction module, and a sequencing analysis module;

[0185] The collection module is used to collect peripheral blood from the subject and perform high molecular weight DNA extraction, shearing and fragment screening;

[0186] The Y-shaped pre-library preparation module is used to perform end repair and 3'A-tailing reaction on the extracted and sheared high molecular weight DNA, and perform Y-shaped adapter ligation and fragment screening, and then use long-fragment amplification enzyme to perform long-fragment PCR amplification to obtain a Y-shaped pre-library;

[0187] The targeted enrichment module is used to hybridize, target enrich and long-fragment PCR amplify the Y-shaped pre-library with a biotin-labeled capture probe to obtain a capture library; the target gene targeted capture region is PKD1: GRCh37 / hg19, chr16: 2085692-2134898; PKD2: GRCh37 / hg19, chr4: 88006483-88076777;

[0188] The PacBio third-generation library construction module is used to perform DNA damage repair, end repair, purification, sequencing adapter ligation and digestion based on the captured library to obtain the PacBio third-generation library;

[0189] The sequencing analysis module is used to perform single-molecule real-time sequencing with the PacBio third-generation library to obtain sequencing data of the target region, decompose the sequencing data of the target region, and analyze the variation types of PKD1 and PKD2.

[0190] Example 2

[0191] 12 MLPA positive test samples were tested according to the PKD1 and PKD2 mutation detection system in Example 1. The results showed that the present invention can intuitively and correctly detect the mutation types of positive samples (Table 15). It can not only detect mutations that have not been detected before (samples 6 and 8), but also clearly determine the mutation types for those that are vaguely judged by traditional methods (samples 4 and 12), and can accurately see the breakpoint positions. The false positive samples tested before were corrected, and the samples with inconsistent results were verified by PCR or PCR-Sanger sequencing, and the results were consistent with the method of the present invention.

[0192] Table 15 Test sample test results

[0193]

[0194]

[0195] illustrate:

[0196] Sample 1: The results of the two methods were inconsistent, and the present invention can clearly identify it as a negative sample. After repeated verification by PCR-Sanger, the results were consistent with those of the present invention.

[0197] Sample 2: The results of the two methods were inconsistent, and the present invention can clearly identify it as a negative sample. It was then verified by PCR-Sanger and the results were consistent with those of the present invention.

[0198] Sample 3: The detection results of the two methods are consistent, and the present invention can clearly see the breakpoint position.

[0199] Sample 4: The detection results of the two methods are consistent. The present invention can clearly identify the type of mutation and the breakpoint position.

[0200] Sample 5: The results of the two methods were inconsistent, and the present invention can clearly identify it as a negative sample. It was then verified by PCR-Sanger and the results were consistent with those of the present invention.

[0201] Sample 6: The results of the two methods were inconsistent. The present invention detected a wider range of deletions and the breakpoints were clearly visible. The PCR-Sanger test was repeated and the results were consistent with those of the present invention.

[0202] Sample 7: Figure 2 The detection results of the two methods are consistent, and the present invention can clearly see the breakpoint position.

[0203] Sample 8: The detection results of the two methods were inconsistent. The present invention has a wider detection range and detected the ABCG2 EXON12-17 heterozygous deletion which is not in the target gene. It can be seen that the present invention can detect unknown mutations. The PCR-Sanger repeated verification was consistent with the results of the present invention.

[0204] Sample 9: The results of the two methods were inconsistent, and the present invention can clearly identify it as a negative sample. It was then verified by PCR-Sanger and the results were consistent with those of the present invention.

[0205] Sample 10: The results of the two methods were inconsistent, and the present invention can clearly identify it as a negative sample. It was then verified by PCR-Sanger and the results were consistent with those of the present invention.

[0206] Sample 11: The detection results of the two methods are consistent, and the present invention can clearly see the breakpoint position.

[0207] Sample 12: The detection results of the two methods are consistent. The present invention can clearly identify the type of mutation and the breakpoint position.

[0208] In summary, the present invention can detect complex mutation types such as PKD1 and PKD2 point mutations, large fragment deletions, and multi-copy mutations, and can accurately identify cis- and trans-mutations without the need for family verification and negative sample controls.

[0209] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention rather than to limit it. Although the present invention has been described with reference to the preferred embodiments of the present invention, it should be understood by those skilled in the art that various changes may be made in form and details without departing from the spirit and scope of the present invention as defined in the appended claims.

Claims

1. A polycystic kidney disease detection system, characterized in that: It includes acquisition module, Y-shaped pre-library preparation module, targeted enrichment module, PacBio third-generation library construction module and sequencing analysis module; The collection module is used to collect peripheral blood of the subject to be tested and to extract, shear and screen high molecular weight DNA; The Y-shaped pre-library preparation module is used to perform end repair and 3'A-tailing reaction on the extracted and sheared high molecular weight DNA, perform Y-shaped adapter connection and fragment screening, and then use a long-fragment amplification enzyme to perform long-fragment PCR amplification to obtain a Y-shaped pre-library; The targeted enrichment module is used to hybridize, target enrich and long-fragment PCR amplify the Y-shaped pre-library with a biotin-labeled capture probe to obtain a capture library; the targeted capture region of the target gene is PKD1: GRCh37 / hg19, chr16: 2085692-2134898; PKD2: GRCh37 / hg19, chr4: 88006483-88076777; the nucleotide sequence of the biotin-labeled capture probe is SEQ ID No: 1-SEQ ID No: 326; The PacBio third-generation library construction module is used to perform DNA damage repair, end repair, purification, sequencing adapter ligation and digestion according to the captured library to obtain a PacBio third-generation library; The sequencing analysis module is used to perform single-molecule real-time sequencing with a PacBio third-generation library to obtain sequencing data of the target region, decompose the sequencing data of the target region, and analyze the variation types of PKD1 and PKD2.

2. The polycystic kidney disease inspection system according to claim 1, characterized in that: The method of collecting peripheral blood of the subject to be tested and extracting high molecular weight gDNA comprises: (1) Take 1 ml of blood sample, add 100 μl of Proteinase K solution and 2 ml of lysis buffer GHD, and mix by inversion; (2) Place in a constant temperature oscillating metal bath at 56°C and 1500 rpm for 20 min, and place at room temperature for 5 min; (3) Add 2 μl of 100 mg / ml RNase A, mix by inversion, and let stand at room temperature for 5 min; (4) Add 2 ml of binding enhancer BP2 and 50 μl of 100 mg / ml BE magnetic bead suspension and shake to mix for 10 min; (5) Place on a magnetic stand and adsorb for 5 min. After the magnetic beads are completely adsorbed, discard the supernatant. (6) Place on a magnetic rack, add 2.5 ml of buffer GDWP and 500 μl of binding enhancer BP2, cover the centrifuge tube cap, invert and mix for 2 min, let stand on the magnetic rack, and discard the supernatant; (7) Place on a magnetic rack, add 2.5 ml of buffer GAZP and 500 μl of binding enhancer BP2, cover the centrifuge tube, invert and mix for 2 min, let stand on the magnetic rack, and discard the supernatant; (8) Place on a magnetic rack, add 3 ml of PWVP rinse buffer, cover the centrifuge tube, invert and mix for 2 min, let stand on the magnetic rack, and discard the supernatant; (9) Place on a magnetic rack, add 3 ml of PWD, cover the centrifuge tube, invert and mix for 2 min, let stand on the magnetic rack, and discard the supernatant; (10) Remove the liquid with a pipette and leave to dry at room temperature with the lid open for 5–10 min. (11) Remove from the magnetic stand, add 100 μl–300 μl of elution buffer TB preheated at 65°C, pipette up and down 3–5 times to resuspend the beads, and incubate at 65°C for 3–5 min. (12) Place the tube on a magnetic rack and let it stand for 2 to 5 minutes. After the magnetic beads are completely adsorbed, transfer the supernatant to a new centrifuge tube and store it at -20°C. (13) Determine the concentration and detect the integrity of genomic DNA by agarose gel electrophoresis.

3. The polycystic kidney disease inspection system according to claim 1, characterized in that: In the process of collecting peripheral blood from the subject and extracting, shearing and screening high molecular weight gDNA, the fragment screening uses the S3 card clamp for large fragment detection to perform Qsep100 quality inspection on the fragmented DNA after fragment screening. Fragments below 3kbp accounting for less than 10% are qualified high molecular weight gDNA fragments.

4. The polycystic kidney disease inspection system according to claim 1, characterized in that: The reaction reagents for the end repair and 3'A-tailing reaction include 7μl Rapid Max End Prep Buffer, 3μl End Prep Enzymes and 50μl high molecular weight gDNA fragment; the PCR program for the end repair and 3'A-tailing reaction is: 20°C, 30min, 65°C, 30min, and 4°C.

5. The polycystic kidney disease inspection system according to claim 4, characterized in that: The reagents for Y-shaped adapter ligation include 60 μl of end repair and 3'A-tailing reaction products, 30 μl of ligase buffer, 10 μl of ligase, 5 μl of water and 5 μl of adapter; the reagents for long-fragment PCR amplification include 46 μl of Y-shaped adapter ligation and fragment screening products, 100 μl, 25 mM 10X LAPCR Buffer II (Mg 2+ Plus), 40 μL dNTP Mixture, 10 μL universal primers with different labels and 4 μL TaKaRa LATaq HS; the PCR program for the long-fragment PCR amplification is 94° C., 2 min; 98° C., 10 s, 58.8° C., 30 s, 68° C., 15 min, repeated 6 times; 68° C., 10 min; 4° C. hold.

6. The polycystic kidney disease inspection system according to claim 5, characterized in that: Biotin-labeled capture probes were used for hybridization, targeted enrichment, and long-fragment PCR amplification with the Y-shaped pre-library, and the capture library included: The biotin-labeled capture probe and Y-shaped pre-library were vacuum concentrated to a dry powder state and resuspended; The resuspended product is subjected to denaturation of the Y-shaped pre-library and probe; Add 20 μl of hybridization buffer preheated at 65°C for at least 5 min to the denatured prelibrary and probe mixture, and perform hybridization reaction at 68°C and 85°C on the heated lid for 16-18 hours; The hybridization product was eluted using streptavidin magnetic beads; The eluted product was amplified by long-fragment PCR using a long-fragment specific amplification enzyme; the reagents for long-fragment PCR amplification included 48 μL of eluted product, 100 μL, 25 mM 10X LAPCR Buffer II (Mg 2+ Plus), 40 μL dNTP Mixture, 6 μL adapter universal primer, 4 μL TaKaRa LA Taq HS and 2 μL water; the PCR program for the long-fragment PCR amplification is 94°C, 2 min; 98°C, 10 s, 58.8°C, 30 s, 68°C, 15 min, repeated 12 times; 68°C, 10 min; 4°C hold; The product after long-fragment PCR amplification is purified using magnetic beads to obtain a capture library.

7. The polycystic kidney disease inspection system according to claim 6, characterized in that: The length of the high molecular weight DNA fragments is 6-20 kbp.

8. The polycystic kidney disease inspection system according to claim 7, characterized in that: The DNA damage repair reagent includes 5 μl 10× DNA damage repair buffer, 0.5 μl 10× NAD + , 5 μl 10 mM ATP, 2 μl DNA damage repair enzyme mixture, 1 μg capture product DNA, and make up to 50 μl with water; The reagents for sequencing adapter ligation include 30 μl of captured product DNA after end repair purification, 1 μl of PacBio platform sequencing adapter, 4 μl of 10× ligation buffer, 2 μl of 1 mM ATP and 1 μl of DNA ligase, and the mixture is filled to 40 μl with water.

9. The polycystic kidney disease inspection system according to claim 1, characterized in that: The sequencing analysis module is used for: The PacBio sequencing data were split using Lima software to obtain sequencing data; Minimap2 was used to align the sequencing data with the reference genome; Perform quality control statistical analysis on the sequencing data of the target region, including data volume, alignment rate, fragment length, and capture efficiency; DeepVariant was used to perform SNV analysis of PKD1 and PKD2 in the target regions, and cuteSV tool was used to perform structural variation analysis of PKD1 and PKD2; ANNOVAR and VEP tools were used to annotate SNV variants, including variant information, population frequency, disease and phenotype information, and prediction tools and scores.

10. A method for detecting PKD1 and PKD2 mutations for non-disease diagnosis purposes, characterized in that: include: Collect peripheral blood from the subjects and perform high molecular weight DNA extraction, shearing and fragment screening; The extracted and sheared high molecular weight DNA is subjected to end repair and 3'A-tailing reaction, and Y-shaped adapter ligation and fragment screening are performed, and then long-fragment PCR amplification is performed using a long-fragment amplification enzyme to obtain a Y-shaped pre-library; According to the Y-shaped pre-library, a capture probe labeled with biotin is used to hybridize with the Y-shaped pre-library, targeted enrichment and long-fragment PCR amplification to obtain a capture library; the target gene capture region is: PKD1: GRCh37 / hg19, chr16: 2085692-2134898; PKD2: GRCh37 / hg19, chr4: 88006483-88076777; the nucleotide sequence of the biotin-labeled capture probe is SEQ ID No: 1-SEQ ID No: 326; Based on the captured library, DNA damage repair, end repair, purification, sequencing adapter ligation and digestion were performed to obtain the PacBio third-generation library; Single-molecule real-time sequencing was performed using the PacBio third-generation library to obtain sequencing data for the target region, which was then decomposed to analyze the mutation types of PKD1 and PKD2.

Images