Congenital adrenal hyperplasia detection system and method

Abstract

The invention relates to the technical field of gene detection, in particular to a system and a method for detecting congenital adrenal hyperplasia. The system comprises a sample processing module used for extraction, interruption and fragment screening of high molecular weight gDNA; the Y-shaped pre-library preparation module is used for terminal repair and 3 'A-tailing reaction, and carrying out Y-shaped linker connection, fragment screening and long fragment PCR amplification to obtain a Y-shaped pre-library, the targeted enrichment module is used for library hybridization, targeted enrichment and long fragment PCR amplification to obtain a capture library, and the PacBio three-generation library construction module is used for DNA damage repair, terminal repair, purification, sequencing linker connection and digestion. A PacBio three-generation library is obtained, and a sequencing analysis module is used for analyzing and obtaining the variation type of CYP21A2; according to the present invention, the detection result is accurate, and the mutation of the CYP21A2 and the pseudogene CY21A1P thereof can be distinguished.

Description

Technical Field

[0001] The present invention relates to the technical field of gene detection, and in particular to a detection system and method for congenital adrenal hyperplasia. Background Art

[0002] Congenital adrenal hyperplasia (CAH) is a group of autosomal recessive genetic diseases caused by enzyme defects in the synthesis of adrenal cortical hormones. According to the different types of enzyme deficiency, CAH can be divided into 21-hydroxylase deficiency (21-OHD), 11β-hydroxylase deficiency (11β-OHD), 17α-hydroxylase deficiency (17α-OHD), 3β-hydroxysteroid dehydrogenase type 2 deficiency (3β-HSD), congenital adrenal hyperplasia (Lipoid CAH), cytochrome P450 oxidoreductase deficiency (Cytochrome P450oxidoreductase deficiency, POR deficiency), cholesterol side-chain cleavage enzyme deficiency (Cholesterol Side-Chain Cleavage Enzyme deficiency, C ... Deficiency, SCCdeficiency), which are caused by mutations in seven genes: CYP21A2, CYP11B1, CYP17A1, HSD3B2, StAR, POR and CYP11A1.

[0003] 21-Hydroxylase-deficient CAH is an autosomal recessive disorder that presents with a range of clinical severity and includes three subtypes: (1) classic salt-wasting, (2) classic simple virilizing, and (3) a nonclassic form. The incidence of classic CAH ranges from 1 / 10,000 to 1 / 20,000 births worldwide.

[0004] The human CYP21A2 gene that causes 21-OHD is located in the HLA class III gene region at 6p21.3, is about 3.2 kb long, has 10 exons and 9 introns. The homology of the exons and introns of the CYP21A2 gene and the corresponding pseudogene CYP21A1P are 98% and 96%, respectively. Compared with CYP21A2, CYP21A1P has mutations at 10 positions that can lead to loss of gene function, including c.92C>T (p.P30L), c.293-13C / A>G (In2G), c.332_339del (p.G110Efs), c.518T>A (p.I172N), E6Cluster (c.710T>A (p.I236N), c.713T>A (p.V237E), c.719T>A (p.M239K)), c.845T>G (p.V281L), c.923dup (p.L307fs), c.955C>T (p.Q318X), c.1069C>T (p.R356W), and c.1360C>T (p.453S). In addition, the RCCX module (tandemly arranged genes RP, C4, CYP21, and TNX) in the 6p21.33 chromosome region shows high homology between functional genes (RP1, CYP21A2, and TNXB) and corresponding pseudogenes (RP2, CYP21A1P, and TNXA), which may cause unequal exchange or recombination during mitosis or meiosis. About 70% of CYP21A2 gene mutations are caused by gene conversion with the pseudogene CYP21A1P, resulting in pathogenic point mutations. 20-25% of CYP21A2 gene mutations are caused by unequal exchange, resulting in large fragment deletions of 30kb, including 9 CYP21A1P / CYP21A2 chimeras CH1-CH9 large fragment deletions caused by gene recombination between CYP21A1P and CYP21A2, and 3 TNXA / TNXB chimeras CH1-CH3 large fragment deletions caused by gene recombination between TNXA and TNXB.

[0005] At present, the most commonly used method for molecular detection of 21-OHD is to detect large fragment deletions or copy number increases through MLPA, combined with Sanger sequencing to specifically detect point mutations on the true gene CYP21A2 5. However, there is a complex recombination relationship between CYP21A2 and CYP21A1P, that is, the true gene CYP21A2 will have characteristic base sequences on the pseudogene CYP21A1P, and the pseudogene CYP21A1P will also have characteristic sequences on the true gene CYP21A2, which will interfere with the specificity of the MLPA probe, and will also interfere with the specificity of the PCR amplification primers and sequencing primers during Sanger sequencing, which will lead to missed diagnosis and misdiagnosis in actual detection. Summary of the invention

[0006] In view of the deficiencies of the above-mentioned prior art, the present invention aims to provide a detection system and method for congenital adrenal hyperplasia, which utilizes long-fragment targeted capture and long-fragment sequencing technology to detect CYP21A2 gene mutations, and can detect both known and unknown CYP21A2 gene mutations. At the same time, it can accurately distinguish mutations occurring in CYP21A2, and can detect complex structural variations such as large-fragment deletions and fusion genes, so as to achieve accurate and precise molecular diagnosis.

[0007] In order to solve the above problems, the present invention adopts the following technical solutions:

[0008] On the one hand, the present invention provides a detection system for congenital adrenal hyperplasia, comprising a sample processing module, a Y-shaped pre-library preparation module, a targeted enrichment module, a single-molecule real-time sequencing library construction module and a single-molecule real-time sequencing analysis module;

[0009] The sample processing module is used to collect peripheral blood of the subject to be tested and perform high molecular weight gDNA extraction, shearing and fragment screening;

[0010] The Y-shaped pre-library preparation module is used to perform end repair and 3'A-tailing reaction on the high molecular weight gDNA fragments after fragment screening, then perform Y-shaped adapter connection and fragment screening, and then use long-fragment amplification enzyme to perform long-fragment PCR amplification to obtain a Y-shaped pre-library;

[0011] The targeted enrichment module is used to use a biotin-labeled capture probe to hybridize with a Y-shaped pre-library, perform targeted enrichment and long-fragment PCR amplification to obtain a capture library; the target gene targeted capture region is CYP21A2 and CYP21A1P: GRCh38 / hg38, chr6: 32005689-32051548; the nucleotide sequence of the biotin-labeled capture probe is SEQ ID No: 1-SEQ ID No: 212;

[0012] The PacBio third-generation library construction module is used to perform DNA damage repair, end repair, purification, sequencing adapter ligation and digestion according to the captured library to obtain a PacBio third-generation library;

[0013] The sequencing analysis module is used to perform single-molecule real-time sequencing with a PacBio third-generation library to obtain sequencing data of the target region, decompose the sequencing data of the target region, and analyze the variation type of CYP21A2.

[0014] In another aspect, the present invention provides a method for non-disease diagnosis of congenital adrenal hyperplasia, characterized by comprising:

[0015] Collect peripheral blood from the subjects and perform high molecular weight gDNA extraction, shearing and fragment screening;

[0016] The high molecular weight gDNA fragments after fragment screening are subjected to end repair and 3'A-tailing reaction, and then Y-shaped adapter ligation and fragment screening are performed, and then long-fragment PCR amplification is performed using a long-fragment amplification enzyme to obtain a Y-shaped pre-library;

[0017] A capture probe labeled with biotin is used to hybridize with a Y-shaped pre-library, perform targeted enrichment and long-fragment PCR amplification to obtain a capture library; the target gene targeted capture region is CYP21A2 and CYP21A1P: GRCh38 / hg38, chr6: 32005689-32051548; the nucleotide sequence of the capture probe labeled with biotin is SEQ ID No: 1-SEQ ID No: 212;

[0018] Based on the captured library, DNA damage repair, end repair, purification, sequencing adapter ligation and digestion were performed to obtain the PacBio third-generation library;

[0019] Single-molecule real-time sequencing was performed using the PacBio third-generation library to obtain sequencing data for the target region. The sequencing data for the target region was decomposed and analyzed to determine the variation type of CYP21A2.

[0020] The beneficial effects of the present invention are as follows: the detection system and method of congenital adrenal hyperplasia of the present invention have accurate detection results. In addition to conventional detection, the mutations of CYP21A2 and CYP21A1P can be accurately distinguished, and complex structural variations such as large fragment deletions and true and false gene fusions can be accurately detected. It can detect whether the mutations are linked, and detect unknown mutations that have not been reported so far. The dumbbell-shaped library of PacBio can be interpreted for multiple rounds during sequencing. The base accuracy of the sequencing results after correction is greater than 99%, and the sequencing errors of PacBio are random. The base accuracy is greater than 99.9% after sequencing depth correction, and the gene mutations within the detection range of the primers can be accurately interpreted. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 This is a quality inspection diagram of the fragment length distribution of the captured library of the present invention; wherein, Migration time represents the migration time, LM20 represents a band with a size of 20 bp in the quality inspection marker, and LM1000 represents a band with a size of 1000 bp in the quality inspection marker.

[0022] Figure 2 This is a diagram of the PacBio sequencing results of the CYP21A2 large fragment deletion and point mutation samples of the present invention. DETAILED DESCRIPTION

[0023] The present invention is further described in detail below in conjunction with specific embodiments.

[0024] It should be noted that these embodiments are only used to illustrate the present invention rather than to limit the present invention. Simple improvements to the method based on the concept of the present invention all fall within the scope of protection claimed by the present invention.

[0025] Example 1 Construction of CYP21A2 mutation detection process

[0026] 1. Collect 10 mL of peripheral blood from the patient using an EDTA anticoagulant tube.

[0027] 2. Extraction of genomic DNA.

[0028] The peripheral blood of the subjects to be tested was extracted using a special high molecular weight DNA extraction kit to obtain high molecular weight gDNA, and the concentration was measured and the integrity of the genomic DNA was detected by agarose gel electrophoresis.

[0029] The specific method is as follows:

[0030] (1) Take 1 ml of blood sample, add 100 μL of Proteinase K solution and 2 ml of Lysis Buffer GHD, and mix by inversion.

[0031] (2) The samples were lysed at 56°C and 1500 rpm in a constant temperature oscillating metal bath for 20 min and then placed at room temperature for 5 min.

[0032] (3) Add 2 μl RNase A (100 mg / ml), invert to mix, and let stand at room temperature for 5 min.

[0033] (4) Add 2 ml of binding enhancer BP2 and 50 μl of magnetic bead suspension BE (100 mg / ml) and shake to mix for 10 min.

[0034] (5) Place the centrifuge tube on a magnetic rack and allow it to adsorb for 5 minutes. After the magnetic beads are completely adsorbed, discard the supernatant.

[0035] (6) Place the centrifuge tube on a magnetic rack, add 2.5 ml of buffer GDWP and 500 μL of binding enhancer BP2, cover the centrifuge tube, invert and mix for 2 min, place on a magnetic rack, and carefully discard the supernatant.

[0036] (7) Place the centrifuge tube on a magnetic rack, add 2.5 ml of buffer GAZP and 500 μL of binding enhancer BP2, cover the centrifuge tube, invert and mix for 2 min, place on a magnetic rack, and carefully discard the supernatant.

[0037] (8) Place the centrifuge tube on the magnetic rack, add 3 ml of PWVP, cover the tube, invert and mix for 2 min, leave on the magnetic rack, and carefully discard the supernatant.

[0038] (9) Place the centrifuge tube on the magnetic rack, add 3 ml of rinse solution PWD, cover the centrifuge tube, invert and mix for 2 min, let it stand on the magnetic rack, and carefully discard the supernatant.

[0039] (10) Use a pipette to remove as much liquid as possible and leave to dry at room temperature with the lid open for 5 to 10 minutes.

[0040] (11) Remove the centrifuge tube from the magnetic stand, add 100 μL-300 μL of elution buffer TB preheated at 65°C, pipette up and down 3 to 5 times to fully resuspend the magnetic beads, and incubate at 65°C for 3 to 5 min.

[0041] (12) Place the centrifuge tube on a magnetic rack and let it stand for 2 to 5 min. After the magnetic beads are completely adsorbed, transfer the supernatant to a new centrifuge tube and store it at -20°C.

[0042] (13) Determine the concentration and detect the integrity of genomic DNA by agarose gel electrophoresis.

[0043] 3. Shearing of high molecular weight gDNA

[0044] (1) Take 1 μg, 2 μg, 3 μg, 4 μg, or 5 μg of the high molecular weight gDNA of the subject to be tested and dilute it to 150 μL with ddH2O.

[0045] (2) Place the diluted sample into the top of the g-TUBE (Covaris, 520079) device and close the lid tightly.

[0046] (3) Place the g-TUBE containing the sample into a centrifuge and set the fragmentation conditions according to the required fragment length. For example, if you want to fragment the fragments to about 10 kbp, you can set the fragmentation conditions to 6000 rpm, 2 min; if you want to fragment the fragments to about 6 kbp, you can set the fragmentation conditions to 8000 rpm, 2 min. The fragmentation conditions mentioned here are based on the use of an Eppendorf 5424 centrifuge.

[0047] (4) Flip the g-TUBE device over and centrifuge under the same conditions. If there is still residual sample at the top, centrifuge the sample at a higher speed for 5 seconds. Repeat the high-speed centrifugation until all the sample is in the bottom chamber of the g-TUBE.

[0048] (5) Transfer the sample to a new 1.5 mL low-absorption centrifuge tube for later use.

[0049] 4. Screening of fragmented DNA

[0050] (1) AmpureXP beads (Beckman, A63881) were diluted with 1 mM Tris-HCl pH 8 at 1×, 2×, 3× or 4× ratios.

[0051] (2) Mix the fragmented DNA to be screened with the diluted fragment screening magnetic beads in a ratio of 1:1, 1:2, 1:3 or 1:4.

[0052] (3) Briefly centrifuge the tube to concentrate the magnetic bead / DNA mixture at the bottom of the tube. Place the tube on a magnetic rack for 5-10 minutes or until the magnetic beads gather on the side of the tube and the supernatant becomes clear. Slowly remove the clear supernatant to avoid disturbing the magnetic beads.

[0053] (4) Wash the magnetic beads twice with fresh 80% ethanol. After 30 seconds, remove the 80% ethanol with a pipette.

[0054] (5) Eluting the cleaned magnetic beads to obtain fragmented DNA after fragment screening.

[0055] 5. Use the S3 cartridge for large fragment detection (Bioptic, c105106) to perform Qsep100 quality inspection on the fragmented DNA after fragment screening. The proportion of fragments below 3 kbp should be less than 10%, otherwise it will be regarded as unqualified fragmented DNA.

[0056] 6. Preparation of pre-library

[0057] (1) Use a long fragment dedicated library construction kit to construct a long fragment Y-shaped pre-library, dilute the DNA after quality inspection qualified fragment screening to 50 μL, and prepare the end repair and 3'A-tailing reaction according to Table 1.

[0058] Table 1 Preparation of end repair and 3'A-tailing reaction reagents

[0059]

[0060] Set up the PCR program according to Table 2 to perform end repair and 3'A-tailing reactions.

[0061] Table 2 End repair and 3'A-tailing reaction PCR program

[0062]

[0063] (2) Adapter ligation: Add the following components in order according to Table 3 to the end repair and 3'A-tailing reaction products.

[0064] Table 3 Connector connection reagents

[0065]

[0066]

[0067] Vortex to mix, centrifuge briefly to ensure that all the solution is at the bottom of the tube, and immediately incubate in a PCR instrument at 20°C for 10 min, 20 min, 30 min, or 1 h with the heated lid set to 85°C.

[0068] Adapter sequence

[0069] A.ACACTCTTTCCCTACACGACGCTCTTCCGATC*T

[0070] BP-GATCGGAAGAGCACACGTCT

[0071] P: Phosphorylation*Phosphorylation

[0072] (3) Fragment screening of adapter ligation products

[0073] ① Dilute AmpureXP beads (Beckman, A63881) in 1 mM Tris-HCl pH 8 at 1×, 2×, 3× or 4× ratios.

[0074] ② Mix the adapter-ligated product to be screened with the diluted fragment screening magnetic beads in a ratio of 1:1, 1:2, 1:3 or 1:4.

[0075] ③ Centrifuge the centrifuge tube momentarily to concentrate the magnetic beads / DNA mixture at the bottom of the tube. Place the centrifuge tube on a magnetic rack for 5-10 minutes or until the magnetic beads gather on the side of the centrifuge tube and the supernatant becomes clear. Slowly remove the clear supernatant to avoid disturbing the magnetic beads.

[0076] ④ Wash the magnetic beads twice with fresh 80% ethanol. After 30 seconds, aspirate the 80% ethanol with a pipette.

[0077] ⑤ Elute the cleaned magnetic beads to obtain the adapter connection product after fragment screening.

[0078] (4) The ligation product was subjected to long-fragment PCR amplification using a dedicated enzyme for long-fragment amplification, and the reaction system was configured according to Table 4; the dedicated enzyme for long-fragment amplification was Takara LA Taq DNA Polymerase Hot-Start Version (Takara, RR042A).

[0079] Table 4 Long fragment PCR amplification reagents

[0080]

[0081] Different tags can be single nucleotide sequences of lengths such as 8nt, 10nt, or 12nt.

[0082] Index primer sequence:

[0083] Sequence 1:

[0084] CAAGCAGAAGACGGCATACGAGATNNNNNNNNNGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC

[0085] Sequence 2:

[0086] AATGATACGGCGACCACCGAGATCTACACNNNNNNNNNAACACTCTTTCCCTACACGAGCTCTTCCGATCT.

[0087] N is any base of A, T, C or G.

[0088] Carry out PCR reaction according to Table 5.

[0089] Table 5 Long fragment PCR amplification program

[0090]

[0091]

[0092] (5) The Y-shaped pre-library PCR products were screened for fragments, aiming to control short fragments below 3 kb to less than 10%.

[0093] ① Dilute AmpureXP beads (Beckman, A63881) in 1 mM Tris-HCl pH 8 at 1×, 2×, 3× or 4× ratios.

[0094] ② Mix the Y-shaped pre-library PCR product to be screened with the diluted fragment screening magnetic beads in a ratio of 1:1, 1:2, 1:3 or 1:4.

[0095] ③ Centrifuge momentarily to concentrate the magnetic beads / DNA mixture at the bottom of the tube. Place the centrifuge tube on the magnetic rack for 5-10 minutes or until the magnetic beads gather on the side of the centrifuge tube and the supernatant becomes clear. Slowly remove the clear supernatant to avoid disturbing the magnetic beads.

[0096] ④ Wash the magnetic beads twice with fresh 80% ethanol. After 30 seconds, aspirate the 80% ethanol with a pipette.

[0097] ⑤ Elute the cleaned magnetic beads to obtain the Y-shaped pre-library PCR product after fragment screening.

[0098] ⑥ Use the S3 card holder for large fragment detection (Bioptic, c105106) to perform Qsep100 quality inspection on the Y-shaped pre-library PCR product after fragment screening. The proportion of fragments below 3kbp should be less than 10%, otherwise it will be regarded as an unqualified Y-shaped pre-library PCR product.

[0099] 7. Hybridization of the Y-shaped pre-library with the biotin-labeled double-stranded DNA probe

[0100] The components of the capture kit used in this example refer to patent ZL202011284834.1

[0101] (1) In this embodiment, the GRCh38 / hg38 gene sequence is used as the reference genome sequence, and the gene sequence of the RCC region (including the CYP21A1 / CYP21A1P gene region) is extracted from databases such as UCSC or NCBI, and extended 1-2Kb upstream and downstream. After extracting the sequence, the repeated sequence is removed, and the probe is designed starting from 120bp from a base. The number of probe coverage is adjusted according to the GC content. The probe covers the region of GRCh38 / hg38, chr6: 32005689-32051548. The capture probe used to enrich the target gene and the flanking region is a biotin-labeled double-stranded DNA probe, and the probe sequence is shown in Table 6.

[0102] Table 6 Probe sequence list

[0103]

[0104]

[0105]

[0106]

[0107]

[0108]

[0109]

[0110]

[0111]

[0112]

[0113]

[0114] (2) The hybridization reaction can be performed as a single hybrid or a multi-hybrid. For a multi-hybrid, multiple Y-shaped pre-libraries need to be mixed at equal molecular weights according to the following formula: fmol = (concentration * 10 6 ) / [650*length(bp)].

[0115] (3) Vacuum concentrate a single library or a mixed library of equal molecular weight to a dry powder state, and resuspend the library according to the components in Table 7.

[0116] Table 7 Library resuspension reagents

[0117]

[0118] (4) Denature the resuspended library and probe according to the PCR program in Table 8.

[0119] Table 8 Denaturation PCR program table

[0120]

[0121] (5) Add 20 μL of hybridization buffer preheated at 65°C for at least 5 min to the denatured pre-library and probe mixture, incubate at 65°C with a heated lid at 85°C, and perform the hybridization reaction for 16-18 hours.

[0122] 8. Targeted Enrichment

[0123] (1) Preheat the streptavidin magnetic beads at 65°C for at least 10 min, then transfer the hybridization products directly from the 65°C condition to the 65°C streptavidin magnetic beads. Be sure not to cool the hybridization product temperature to room temperature, otherwise it will cause serious off-target effects.

[0124] (2) After the hybridization product is bound to the streptavidin magnetic beads, the hybridization product and the streptavidin magnetic beads are rinsed and eluted.

[0125] (3) The eluted product was captured and then PCR was performed using a long fragment specific amplification enzyme. The amplification system is shown in Table 9.

[0126] Table 9 Capture library amplification system

[0127]

[0128]

[0129] Universal primer sequences:

[0130] AATGATACGGCGACCACCGAG

[0131] CAAGCAGAAGACGGCATACGA.

[0132] Amplify according to the amplification program in Table 10.

[0133] Table 10 Capture library amplification program

[0134]

[0135] (4) Purify the PCR product using 0.8* purification magnetic beads to obtain a capture library.

[0136] (5) The captured library is tested for concentration and fragment length distribution by Qubit and Qsep100. The length of the captured library should be 3k-10k. Figure 1 .

[0137] 9. PacBio third-generation library construction (kit from PacBio, PN: 103-381-200)

[0138] (1) DNA damage repair

[0139] Configure the DNA damage repair system according to Table 11.

[0140] Table 11 Damage repair system

[0141]

[0142] The prepared reaction solution was shaken and mixed. The reaction conditions were: 37°C, 20 min; maintained at 4°C.

[0143] (2) End repair and purification

[0144] Configure the end repair and purification reaction system according to Table 12.

[0145] Table 12 End repair and purification reaction system

[0146]

[0147] The prepared reaction solution was shaken and mixed. The reaction conditions were: 25°C, 5 min; maintained at 4°C.

[0148] (3) Connector connection

[0149] Configure the adapter ligation reaction system according to Table 13.

[0150] Table 13 Linker connection reaction system

[0151]

[0152] The prepared reaction solution was shaken and mixed. The reaction conditions were: 25°C, 24h; 65°C, 10min; maintained at 4°C.

[0153] (4) Digestion of failed DNA and adapter sequences

[0154] The reaction system was configured according to Table 14.

[0155] Table 14 Digestion reaction system

[0156]

[0157] The prepared reaction solution was shaken and mixed. The reaction conditions were: 37°C, 1h; maintained at 4°C.

[0158] 10. Sequencing and result analysis

[0159] The prepared library was sequenced using a third-generation single-molecule sequencer (PacBio Revio), so that the average sequencing depth of the target region reached more than 50×.

[0160] The obtained data is split and analyzed. The specific analysis method is as follows:

[0161] 1) Sample data preparation and splitting:

[0162] Lima software was used to split the PacBio data by different indexes, and the index sequences were removed to obtain the cleaned sample data. This step ensured the accuracy and high quality of the data and removed possible library construction errors.

[0163] 2) Alignment to the reference genome:

[0164] Use Minimap2 to align the processed clean data to the reference genome (hg38). During the alignment process, use the **-MD parameter** to generate MD tags to facilitate downstream variant detection analysis. This step can efficiently align the sample data with the reference genome, providing accurate control data for subsequent variant analysis.

[0165] 3) CYP21A2 / 1P haplotype analysis:

[0166] The Paraphase tool was used to perform haplotype analysis on the CYP21A2 / 1P gene region of the sample. By distinguishing different haplotypes, we can better understand the inheritance patterns of different genotypes, thereby providing a basis for subsequent recombination and variation analysis.

[0167] 4) Distinguishing true and false genes and judging recombination:

[0168] Haplotype information is used to distinguish true and false genes at known CYP21A2 / 1P gene difference sites. By checking the consistency of haplotype and pseudogene region, it is determined whether there is a pseudogene. If more than three consecutive sites are consistent with the pseudogene, it is determined to be a recombination. This step can efficiently identify gene recombination, distinguish true and false genes, and ensure the accuracy of variation analysis.

[0169] 5) SNV and SV analysis:

[0170] DeepVariant was used to detect SNVs (single nucleotide variants) in the CYP21A2 gene region. CuteSV was used to analyze structural variants (SVs) and identify structural variants such as insertions and deletions in the CYP21A2 gene. By combining the two variant detection tools, all types of variants in the CYP21A2 gene can be comprehensively and efficiently identified.

[0171] 6) Variant annotation and disease association analysis:

[0172] Annovar and vep were used to annotate SNVs. The annotation information included variant information, such as nucleotide changes, amino acid changes, hgvs, genotype, etc.; population frequency, such as 1000g, gnomAD; disease and phenotype information, such as ACMG pathogenicity judgment, inheritance mode, disease phenotype characteristics, etc.; prediction tools and scores, such as spliceAI, SIFT, PolyPhen-2, REVEL_score, GERP++, etc. At the same time, combined with the recombination and structural variation (SV) analysis results of the CYP21A2 gene, it provides strong support for clinical genetic diagnosis.

[0173] According to the above construction process, a detection system for congenital adrenal hyperplasia is constructed, including a sample processing module, a Y-shaped pre-library preparation module, a targeted enrichment module, a single-molecule real-time sequencing library construction module and a single-molecule real-time sequencing analysis module;

[0174] The sample processing module is used to collect peripheral blood from the subject and perform high molecular weight gDNA extraction, shearing and fragment screening;

[0175] The Y-shaped pre-library preparation module is used to perform end repair and 3'A-tailing reaction on the high molecular weight gDNA fragments after fragment screening, and then perform Y-shaped adapter ligation and fragment screening, and then use long-fragment amplification enzyme to perform long-fragment PCR amplification to obtain a Y-shaped pre-library;

[0176] The targeted enrichment module is used to use a biotin-labeled capture probe to hybridize with a Y-shaped pre-library, perform targeted enrichment and long-fragment PCR amplification to obtain a capture library; the target gene targeted capture region is CYP21A2 and CYP21A1P: GRCh38 / hg38, chr6: 32005689-32051548; the nucleotide sequence of the biotin-labeled capture probe is SEQ ID No: 1-SEQ ID No: 212;

[0177] The PacBio third-generation library construction module is used to perform DNA damage repair, end repair, purification, sequencing adapter ligation and digestion based on the captured library to obtain the PacBio third-generation library;

[0178] The sequencing analysis module is used to perform single-molecule real-time sequencing with the PacBio third-generation library to obtain sequencing data of the target region, decompose the sequencing data of the target region, and analyze the variation type of CYP21A2.

[0179] Example 2

[0180] 8 positive test samples were tested according to the detection system of congenital adrenal hyperplasia in Example 1. The results showed that the present invention can intuitively and correctly detect the mutation type of positive samples (Table 15), and for samples that are vaguely judged by traditional methods (samples 3, 5, 8, and 9), the mutation type can also be clearly determined, and the breakpoint position can be accurately seen. At the same time, PCR or PCR-Sanger sequencing verification was performed on samples with inconsistent results, and the results were consistent with the method of the present invention.

[0181] Table 15 Test sample test results

[0182]

[0183]

[0184]

[0185] illustrate:

[0186] Sample 1: See Figure 2 The detection results of the two methods are consistent, and the present invention can clearly see the breakpoint position.

[0187] Sample 2: The test results of the two methods are consistent.

[0188] Sample 3: The detection results of the two methods are consistent, and the present invention can clearly see the breakpoint position.

[0189] Sample 4: The test results of the two methods are consistent.

[0190] Sample 5: The detection results of the two methods are consistent, and the present invention can clearly see the breakpoint position.

[0191] Sample 6: The test results of the two methods are consistent.

[0192] Sample 7: The detection results of the two methods are inconsistent. The present invention can clearly identify the different haplotypes of CYP21A2 and CYP21A1P, and additionally determine that a point mutation in CYP21A2 comes from a minor conversion of CYP21A1P.

[0193] Sample 8: The detection results of the two methods were inconsistent. The present invention additionally found that CYP21A1P and CYP21A2 fused in TNX, and CYP21A2 changed from 2 copies to 3 copies.

[0194] In summary, the present invention can detect CYP21A2 point mutations, large fragment deletions, multi-copy mutations and CYP21A2 and CYP21A1P fusion mutations, and can accurately identify cis-trans mutations without the need for family verification and negative sample controls.

[0195] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention rather than to limit it. Although the present invention has been described with reference to the preferred embodiments of the present invention, it should be understood by those skilled in the art that various changes may be made in form and details without departing from the spirit and scope of the present invention as defined in the appended claims.

Claims

1. A detection system for congenital adrenal hyperplasia, characterized in that: It includes sample processing module, Y-shaped pre-library preparation module, targeted enrichment module, single-molecule real-time sequencing library construction module and single-molecule real-time sequencing analysis module; The sample processing module is used to collect peripheral blood of the subject to be tested and perform high molecular weight gDNA extraction, shearing and fragment screening; The Y-shaped pre-library preparation module is used to perform end repair and 3'A-tailing reaction on the high molecular weight gDNA fragments after fragment screening, then perform Y-shaped adapter connection and fragment screening, and then use long-fragment amplification enzyme to perform long-fragment PCR amplification to obtain a Y-shaped pre-library; The targeted enrichment module is used to use a biotin-labeled capture probe to hybridize with a Y-shaped pre-library, perform targeted enrichment and long-fragment PCR amplification to obtain a capture library; the target gene targeted capture region is CYP21A2 and CYP21A1P: GRCh38 / hg38, chr6: 32005689-32051548; the nucleotide sequence of the biotin-labeled capture probe is SEQ ID No: 1-SEQ ID No: 212; The PacBio third-generation library construction module is used to perform DNA damage repair, end repair, purification, sequencing adapter ligation and digestion according to the captured library to obtain a PacBio third-generation library; The sequencing analysis module is used to perform single-molecule real-time sequencing with a PacBio third-generation library to obtain sequencing data of the target region, decompose the sequencing data of the target region, and analyze the variation type of CYP21A2.

2. The detection system for congenital adrenal hyperplasia according to claim 1, characterized in that: The method of collecting peripheral blood of the subject to be tested and extracting high molecular weight gDNA comprises: (1) Take 1 ml of blood sample, add 100 μL of Proteinase K solution and 2 ml of lysis buffer GHD, and mix by inversion; (2) Place in a constant temperature oscillating metal bath at 56°C and 1500 rpm for 20 min, and place at room temperature for 5 min; (3) Add 2 μl of 100 mg / ml RNase A, mix by inversion, and let stand at room temperature for 5 min; (4) Add 2 ml of binding enhancer BP2 and 50 μl of 100 mg / ml BE magnetic bead suspension and shake to mix for 10 min; (5) Place on a magnetic stand and adsorb for 5 min. After the magnetic beads are completely adsorbed, discard the supernatant. (6) Place on a magnetic rack, add 2.5 ml of buffer GDWP and 500 μL of binding enhancer BP2, cover the centrifuge tube, invert and mix for 2 min, let stand on the magnetic rack, and discard the supernatant; (7) Place on a magnetic rack, add 2.5 ml of buffer GAZP and 500 μL of binding enhancer BP2, cover the centrifuge tube, invert and mix for 2 min, let stand on the magnetic rack, and discard the supernatant; (8) Place on a magnetic rack, add 3 ml of PWVP rinse buffer, cover the centrifuge tube, invert and mix for 2 min, let stand on the magnetic rack, and discard the supernatant; (9) Place on a magnetic rack, add 3 ml of PWD, cover the centrifuge tube, invert and mix for 2 min, let stand on the magnetic rack, and discard the supernatant; (10) Remove the liquid with a pipette and leave to dry at room temperature with the lid open for 5–10 min. (11) Remove from the magnetic stand, add 100 μL-300 μL of elution buffer TB preheated at 65°C, pipette 3-5 times to resuspend the beads, and incubate at 65°C for 3-5 min; (12) Place the tube on a magnetic rack and let it stand for 2 to 5 minutes. After the magnetic beads are completely adsorbed, transfer the supernatant to a new centrifuge tube and store it at -20°C. (13) Determine the concentration and detect the integrity of genomic DNA by agarose gel electrophoresis.

3. The detection system for congenital adrenal hyperplasia according to claim 1, characterized in that: In the process of collecting peripheral blood from the subject and extracting, shearing and screening high molecular weight gDNA, the fragment screening uses the S3 card clamp for large fragment detection to perform Qsep100 quality inspection on the fragmented DNA after fragment screening. Fragments below 3kbp accounting for less than 10% are qualified high molecular weight gDNA fragments.

4. The detection system for congenital adrenal hyperplasia according to claim 1, characterized in that: The reaction reagents for the end repair and 3'A-tailing reaction include 7 μL Rapid Max End Prep Buffer, 3 μL End Prep Enzymes and 50 μL high molecular weight gDNA fragments; the PCR program for the end repair and 3'A-tailing reaction is: 20°C, 30min, 65°C, 30min, and 4°C.

5. The detection system for congenital adrenal hyperplasia according to claim 4, characterized in that: The reagents for Y-joint ligation include 60 μL of end repair and 3'A-tailing reaction products, 30 μL of ligase buffer, 10 μL of ligase, 5 μL of water and 5 μL of joints; the reagents for long-fragment PCR amplification include 46 μL of Y-joint ligation and fragment screening products, 100 μL of 10X LAPCR Buffer II (MgSO4, 25 mM) and 10 μL of 25 mM ... 2+ Plus), 40 μL dNTP Mixture, 10 μL universal primers with different labels and 4 μL TaKaRa LA Taq HS; the PCR program for the long-fragment PCR amplification is 94°C, 2 min; 98°C, 10 s, 58.8°C, 30 s, 68°C, 15 min, repeated 6 times; 68°C, 10 min; keep at 4°C.

6. The detection system for congenital adrenal hyperplasia according to claim 5, characterized in that: Biotin-labeled capture probes were used to perform hybridization, targeted enrichment, and long-fragment PCR amplification with the Y-shaped pre-library. The capture library includes: The biotin-labeled capture probe and Y-shaped pre-library were vacuum concentrated to a dry powder state and resuspended; The resuspended product is subjected to denaturation of the Y-shaped pre-library and probe; Add 20 μL of hybridization buffer preheated at 65°C for at least 5 min to the denatured prelibrary and probe mixture, and perform hybridization reaction at 65°C and 85°C hot cover for 16-18 hours; The hybridization product was eluted using streptavidin magnetic beads; The eluted product was amplified by long-fragment PCR using a long-fragment specific amplification enzyme; the reagents for long-fragment PCR amplification included 48 μL of eluted product, 100 μL, 25 mM 10X LAPCR Buffer II (Mg 2+ Plus), 40 μL dNTP Mixture, 6 μL adapter universal primer, 4 μL TaKaRa LATaq HS and 2 μL water; the PCR program for the long-fragment PCR amplification is 94°C, 2 min; 98°C, 10 s, 58.8°C, 30 s, 68°C, 15 min, repeated 12 times; 68°C, 10 min; 4°C hold; The product after long-fragment PCR amplification is purified using magnetic beads to obtain a capture library.

7. The detection system for congenital adrenal hyperplasia according to claim 6, characterized in that: The capture library is 3k-10k in length.

8. The detection system for congenital adrenal hyperplasia according to claim 7, characterized in that: The DNA damage repair reagent includes 5 μL 10× DNA damage repair buffer, 0.5 μL 10× NAD + , 5 μL 10 mM ATP, 2 μL DNA damage repair enzyme mixture, 1 μg captured product DNA, and make up to 50 μL with water; The reagents for sequencing adapter ligation include 30 μL of captured product DNA after end repair purification, 1 μL of PacBio platform sequencing adapter, 4 μL of 10× ligation buffer, 2 μL of 1 mM ATP and 1 μL of DNA ligase, and are filled to 40 μL with water.

9. The detection system for congenital adrenal hyperplasia according to claim 8, characterized in that: The sequencing analysis module is used for: Use Lima software to split the PacBio offline data by different indexes and remove the index sequence to obtain the cleaned sample data; The cleaned data were aligned to the reference genome hg38 using Minimap2; The Paraphase tool was used to perform haplotype analysis on the CYP21A2 / 1P gene region of the samples; Haplotype information was used to distinguish true and false genes and to judge recombination at known CYP21A2 / 1P gene difference sites. The consistency between haplotype and pseudogene region was checked to determine whether there was a pseudogene. If more than three consecutive sites were consistent with the pseudogene, it was determined to be a recombination. DeepVariant was used to detect SNVs in the CYP21A2 gene region, and cuteSV was used for structural variation analysis to identify insertion and deletion structural variations of the CYP21A2 gene; Annovar and vep were used to annotate SNVs, and the annotation information included variant information, population frequency, disease and phenotype information, and prediction tools and scores.

10. A method for non-disease diagnosis of congenital adrenal hyperplasia, characterized in that: include: Collect peripheral blood from the subjects and perform high molecular weight gDNA extraction, shearing and fragment screening; The high molecular weight gDNA fragments after fragment screening are subjected to end repair and 3'A-tailing reaction, and then Y-shaped adapter ligation and fragment screening are performed, and then long-fragment PCR amplification is performed using a long-fragment amplification enzyme to obtain a Y-shaped pre-library; A capture probe labeled with biotin is used to hybridize with a Y-shaped pre-library, perform targeted enrichment and long-fragment PCR amplification to obtain a capture library; the target gene targeted capture region is CYP21A2 and CYP21A1P: GRCh38 / hg38, chr6: 32005689-32051548; the nucleotide sequence of the capture probe labeled with biotin is SEQ ID No: 1-SEQ ID No: 212; Based on the captured library, DNA damage repair, end repair, purification, sequencing adapter ligation and digestion were performed to obtain the PacBio third-generation library; Single-molecule real-time sequencing was performed using the PacBio third-generation library to obtain sequencing data for the target region. The sequencing data for the target region was decomposed and analyzed to determine the variation type of CYP21A2.

Images