Application of PLOD2 as a biomarker in the preparation of products for detecting sarcomatoid renal cell carcinoma

Abstract

This invention discloses the application of PLOD2 as a biomarker in the preparation of products for detecting sarcomatoid renal cell carcinoma, belonging to the biomedical field. This invention discovers that PLOD2 is a molecular marker for sarcomatoid renal cell carcinoma, with significantly higher expression in sarcomatoid renal cell carcinoma compared to non-sarcomatoid renal cell carcinoma and normal kidney tissue. Furthermore, within the same sarcomatoid renal cell carcinoma tissue, PLOD2 expression in the sarcomatoid component is significantly higher than in adjacent epithelioid renal cell carcinoma components and adjacent normal kidney tissue. Therefore, PLOD2 can serve as an auxiliary diagnostic molecular marker for sarcomatoid renal cell carcinoma, possessing significant clinical application value for improving the clinical diagnostic level of this disease.

Description

Technical Field

[0001] This invention belongs to the field of biomedicine, specifically relating to the application of PLOD2 as a biomarker in the preparation of products for detecting sarcomatoid renal cell carcinoma. Background Technology

[0002] Sarcomatoid renal cell carcinoma (sRCC) is a rare, poorly differentiated, highly malignant, and extremely difficult-to-treat type of renal cell carcinoma. Its incidence accounts for only about 4-5% of all renal cell carcinomas. Due to its low incidence and limited research, there are currently no specific molecular markers, and its pathogenesis is poorly understood. Because of the lack of effective imaging diagnostic tools, clinical diagnosis currently relies almost entirely on postoperative histopathological examination of tissue morphology, while the effectiveness of preoperative biopsy is only about 7.5%.

[0003] sRCC tissue is typically composed of two malignant cell components: sarcomatoid and non-sarcomatoid (epithelialoid). According to the 2016 WHO guidelines, renal cell carcinoma containing any number of sarcomatoid features can be diagnosed as sRCC. The prevailing "common progenitor cell theory" posits that sarcomatoid tumor cells within sRCC originate from pre-existing well-differentiated epithelioid cells, gradually transforming into sRCC cells through sarcomatoid dedifferentiation. Sarcomatoid dedifferentiation can occur in most renal cell carcinoma subtypes, but because clear cell renal cell carcinoma (ccRCC) accounts for as much as 75% of RCC, the sarcomatoid clear cell renal cell carcinoma (sccRCC) subtype is the most common.

[0004] Sarcomatoid dedifferentiation is the direct cause of sRCC and the fundamental reason why the prognosis of sRCC patients is significantly lower than that of non-sarcomatoid RCC. Moreover, the higher the content of sarcomatoid components, the greater the risk of patient death. According to statistics, for every 10% increase in sarcomatoid components, the risk of patient death increases by about 6%. Therefore, the search for specific molecular markers of sarcomatoid dedifferentiation can not only help improve the efficiency of sRCC pathological diagnosis and develop targeted imaging tools, but also assess the risk of patient death by analyzing the content of sarcomatoid components in sRCC tissue. This has important clinical application value for the diagnosis and risk assessment of sRCC. Summary of the Invention

[0005] The technical problem to be solved by this invention is how to diagnose sarcomatoid renal cell carcinoma.

[0006] To solve the above-mentioned technical problems, the present invention first provides any of the following applications:

[0007] 1. The application of substances that detect PLOD2 gene expression levels or PLOD2 protein content in the preparation of products for screening or assisting in the screening of patients with sarcomatoid renal cell carcinoma, or in the screening or assisting in the screening of patients with sarcomatoid renal cell carcinoma;

[0008] 2. The application of substances that detect PLOD2 gene expression levels or PLOD2 protein content in the preparation of products for the diagnosis or auxiliary diagnosis of sarcomatoid renal cell carcinoma, or in the diagnosis or auxiliary diagnosis of sarcomatoid renal cell carcinoma;

[0009] 3. The application of substances that detect PLOD2 gene expression levels or PLOD2 protein content in the preparation of prognostic or adjuvant prognostic products for renal cell carcinoma, or their application in the prognostic or adjuvant prognosis of renal cell carcinoma;

[0010] 4. The application of substances for detecting PLOD2 gene expression levels or PLOD2 protein content in the preparation of products for identifying or assisting in the identification of sarcomatoid components in sarcomatoid renal cell carcinoma tissues, or in the identification or assisting in the identification of sarcomatoid components in sarcomatoid renal cell carcinoma tissues.

[0011] 5. The application of substances for detecting PLOD2 gene expression levels or PLOD2 protein content in the preparation of products for detecting or assisting in the detection of sarcomatoid component content in sarcomatoid renal cell carcinoma tissues, or in the detection or assisting in the detection of sarcomatoid component content in sarcomatoid renal cell carcinoma tissues.

[0012] In the above applications, the substance used to detect the expression level of the PLOD2 gene or the content of the PLOD2 protein can be a substance that specifically recognizes PLOD2 mRNA (such as primers), or a substance that specifically recognizes PLOD2 protein (such as PLOD2 antibody).

[0013] The present invention also provides a product containing the substance for detecting PLOD2 gene expression level or PLOD2 protein content.

[0014] The product can be used to screen patients with sarcomatoid renal cell carcinoma, diagnose sarcomatoid renal cell carcinoma, assess the prognosis of renal cell carcinoma, or identify or detect sarcomatoid components in sarcomatoid renal cell carcinoma tissue.

[0015] This invention also provides any of the following applications of PLOD2 protein or substances that increase the content or activity of PLOD2 protein:

[0016] M1) to prepare sarcoma-like renal cell carcinoma or tissue models;

[0017] M2) induces epithelioid renal cell carcinoma cells or tissues to transform into sarcomatoid renal cell carcinoma cells or tissues;

[0018] M3 induces epithelial-mesenchymal transition in renal cell carcinoma cells;

[0019] M4) enhances the stemness of renal cell carcinoma cancer cells;

[0020] M5 promotes sarcomatoid dedifferentiation of renal cell carcinoma.

[0021] The PLOD2 protein may be as follows: A1), A2), or A3):

[0022] A1) The amino acid sequence of this protein is SEQ ID No. 2;

[0023] A2) A protein that has the same function as the amino acid sequence shown in SEQ ID No. 2 in the sequence listing, but with one or more amino acid residues substituted and / or deleted and / or added;

[0024] A3) is a fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of A1) or A2).

[0025] The PLOD2 protein in A2) above is a protein that shares 75% or more of the amino acid sequence identity with the protein shown in SEQ ID No. 2 and has the same function. The 75% or more of identity means 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity.

[0026] The tag described in A3) can be a polypeptide or protein fused with the target protein using in vitro DNA recombination technology, to facilitate the expression, detection, tracing, and / or purification of the target protein. The tag can be Poly-Arg, Poly-His, FLAG, Strep-tag II, c-myc, MBP tag, HA tag, GST tag, and / or SUMO tag, etc.

[0027] In the above applications, the substance that increases the content or activity of PLOD2 protein can be any one of the following B1) to B3):

[0028] B1) Nucleic acid molecules encoding the PLOD2 protein;

[0029] B2) An expression cassette containing the nucleic acid molecule described in B1);

[0030] B3) A recombinant vector containing the nucleic acid molecule described in B1) or a recombinant vector containing the expression cassette described in B2).

[0031] The nucleic acid molecule can be DNA, such as cDNA, genomic DNA, or recombinant DNA; the nucleic acid molecule can also be RNA, such as mRNA or hnRNA.

[0032] Those skilled in the art can readily mutate the nucleotide sequence encoding the PLOD2 protein of this invention using known methods, such as directed evolution and point mutation. Artificially modified nucleotides that possess 75% or higher identity to the PLOD2 protein isolated according to this invention, provided they encode and function the PLOD2 protein, are derived from and equivalent to the nucleotide sequence of this invention.

[0033] In the above applications, the nucleic acid molecule described in B1) can be a cDNA molecule or a DNA molecule whose coding sequence is SEQ ID No. 1 in the sequence listing. Specifically, the nucleic acid molecule described in B1) can be the DNA molecule shown in SEQ ID No. 1.

[0034] Recombinant vectors containing the PLOD2 gene expression cassette can be constructed using existing expression vectors.

[0035] In the above applications, the vector can be a plasmid, granule, bacteriophage, or viral vector.

[0036] B3) The recombinant vector may specifically be pLV(Exp)-mCherry / Neo-EF1A>hPLOD2.

[0037] The present invention also provides a product containing (or having its active ingredient as) the PLOD2 protein or the substance that increases the content or activity of the PLOD2 protein.

[0038] In this invention, the renal cell carcinoma may be, but is not limited to, clear cell renal cell carcinoma, chromophobe renal cell carcinoma, or papillary renal cell carcinoma.

[0039] This invention, based on multi-omics screening technology combined with histopathological and molecular intervention verification, confirms that PLOD2 is a molecular marker for sarcomatoid renal cell carcinoma, with significantly higher expression in sarcomatoid renal cell carcinoma compared to non-sarcomatoid renal cell carcinoma and normal kidney tissue. Furthermore, within the same sarcomatoid renal cell carcinoma tissue, PLOD2 expression in the sarcomatoid component is significantly higher than in adjacent epithelioid renal cell carcinoma components and adjacent normal kidney tissue. Therefore, this molecular marker, as the first auxiliary diagnostic molecular marker for sarcomatoid renal cell carcinoma, has significant clinical application value for improving the clinical diagnostic level of this disease.

[0040] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way. Attached Figure Description

[0041] Figure 1 A schematic diagram of potential drivers of sarcomatoid dedifferentiation in ccRCC screened by multi-omics, based on the three main characteristics of sarcomatoid dedifferentiation ccRCC patients.

[0042] Figure 2 Compare the expression of PLOD family members in normal and tumor tissues and show their relationship with prognosis in the TCGA ccRCC cohort. OS: Overall survival.

[0043] Figure 3 Transcriptome sequencing of sarcomatoid renal cell carcinoma cells revealed the expression of six other candidate factors before and after PLOD2 knockout.

[0044] Figure 4 Western blot results of PLOD2 expression in various cell lines.

[0045] Figure 5 Expression of PLOD2 in clinical sample data from the .TCGA and CPTAC databases. PLOD2 protein indicates the PLOD2 protein content.

[0046] Figure 6 Immunohistochemical validation results of clinical samples. H-score of PLOD2 represents the PLOD2 content score.

[0047] Figure 7 Expression of PLOD2 in sarcomatoid and non-sarcomatoid components. H-score of PLOD2 represents the PLOD2 content score.

[0048] Figure 8 Expression of PLOD2 in sarcomatoid and non-sarcomatoid components in Patient 1. The top image shows the HE staining results, and the bottom image shows the PLOD2 expression detected by immunohistochemical staining.

[0049] Figure 9 Expression of PLOD2 in sarcomatoid and non-sarcomatoid components in Patient 2. The top image shows the HE staining results, with the leftmost bar at 1 mm; the bottom image shows the PLOD2 expression detected by immunohistochemical staining, with the leftmost bar at 1 mm.

[0050] Figure 10Expression of PLOD2 in sarcomatoid and non-sarcomatoid components in patient 3. The top image shows the HE staining results, and the bottom image shows the PLOD2 expression detected by immunohistochemical staining.

[0051] Figure 11 Expression of PLOD2 in the sarcomatoid, non-sarcomatoid, and transitional regions of three patients with sRCC. The H-score of PLOD2 represents the PLOD2 content score.

[0052] Figure 12 PLOD2 knockout leads to sRCC cells differentiating into epithelial-like cells.

[0053] Figure 13 TCGA analysis showed the expression of PLOD2 in sarcomatoid and non-sarcomatoid colorophobe renal cell carcinoma.

[0054] Figure 14PLOD2 promotes sarcomatoid dedifferentiation in ccRCC. (A) Western blot and RT-qPCR showed the effect of PLOD2 overexpression on the expression of stem cell markers (DCLK1, CD44, ALDH1A1, and β-catenin) and epithelial markers (CD10, CA9, and MUC1) in 769-PeccRCC cells. (B) Flow cytometry was used to assess the proportion of SP cells in control and PLOD2-overexpressing 769-PeccRCC cells, stained with Hoechst 33342, with and without verapamil treatment. Gated cells in the figure represent SP cells. (C) Flow cytometry was used to measure the ALDH1A1 staining intensity and the proportion of ALDH1A1+ cancer stem cells in control and PLOD2-overexpressing 769-PeccRCC cells. (D) Western blot and RT-qPCR showed the effect of PLOD2 overexpression on the expression of EMT markers in 769-PeccRCC cells. The control in AD was the epithelial-like ccRCC cell line 769-P. (E) Western blot and RT-qPCR analysis of the effects of PLOD2 knockout on stem cell and epithelial differentiation markers in 786-O sccRCC cells. (F) Flow cytometry assessment of the proportion of SP cells in the control and PLOD2-deficient 786-O sccRCC cells, using Hoechst 33342 staining, with or without verapamil treatment. (G) Flow cytometry measurement of ALDH1A1 staining intensity and the proportion of ALDH1A1+ cancer stem cells in the control and PLOD2-deficient 786-O sccRCC cells. (H) Immunofluorescence staining analysis of stem cell markers (DCLK1 and ALDH1A1) and epithelial differentiation markers (CA9 and AQP1) in the control and PLOD2-deficient 786-O sccRCC cells. (I) Western blot and RT-qPCR were used to assess the expression of EMT markers in 786-O sccRCC cells of the control and PLOD2-deficient groups. (J) Immunofluorescence staining was used to analyze EMT markers in 786-O sccRCC cells of the control and PLOD2-deficient groups. (K) A heatmap of RNA-seq data showed the effect of PLOD2 deficiency on cancer cell stemness, epithelial differentiation, and EMT markers in 786-O sccRCC cells. The control in EK was sarcomatoid renal cell carcinoma cell line 786-O. Data are presented as mean ± standard deviation. Statistical analysis was performed using unpaired two-sided Student's t-test [(A), (C), (D), (E), (G), and (I)].

[0055] Figure 15 Gene ontology (GO) analysis of genes with PLOD2 deletion alterations revealed a significant enrichment of processes associated with sRCC biology.

[0056] Figure 16 Potential association between PLOD2 and sarcomatoid dedifferentiation in chromohobe RCCs. (A) TCGA analysis showing PLOD2 expression in sarcomatoid and non-sarcomatoid chromohobe RCCs. (B) Correlation between PLOD2 expression and mesenchymal characteristics (defined by mesenchymal markers Vimentin, Snai1, and ZEB1) in chromohobe RCC samples from TCGA. Data were analyzed using Pearson correlation tests.

[0057] Figure 17 PLOD2 deficiency induces differentiation in sccRCC and improves treatment response. (A) Representative images show the effects of PLOD2 deficiency on epithelial-like differentiation of 786-O-derived sccRCC xenografts in nude mice using IHC, HE, and Masson staining. (B) and (C) IHC staining analysis of epithelial differentiation, cancer cell stemness, and EMT marker expression in control and PLOD2-deficient sccRCC xenografts. (D) and (E) Correlation of PLOD2 expression with AQP1 and stemness markers in TCGA, CPTAC, and GSE73731 ccRCC patients. (F) TCGA analysis showing the relationship between cancer cell dedifferentiation and tumor stage and overall survival in ccRCC patients. (G) Tumor growth curves of sccRCC xenografts in the control and PLOD2-deficient groups. (H) IHC analysis showing Ki-67 expression in sccRCC xenografts in the control and PLOD2-deficient groups in nude mice. (I) Correlation between PLOD2 and Ki-67 in TCGA, CPTAC, and GSE73731 ccRCC patients. (J) CCK8 analysis of the effect of PLOD2 deficiency on the sensitivity of 786-O sccRCC cells to doxorubicin, gemcitabine, and IFN-α. (K) Assessment of the effect of PLOD2 deficiency on sccRCC growth and sensitivity to axitinib treatment, comparing tumor growth curves and weight (n=5). Data in the figures are expressed as mean ± standard deviation. Statistical analyses included Pearson correlation tests [(D), (E), and (I)], chi-square test (F, left), log-rank test (F, right), two-sided univariate ANOVA and Tukey test (K), or unpaired two-sided Student's t test [(G) and (H)].

[0058] Figure 18Minoxidil, a pharmacologically targeted inhibitor of PLOD2, can induce differentiation in sccRCCs and enhance their sensitivity to treatment. (AB) Western blot and RT-qPCR were used to analyze the effects of minoxidil treatment on stemness, epithelial differentiation, and EMT in 786-O sccRCC cells. (C) IHC was used to analyze the expression of epithelial differentiation markers CA9 and AQP1, stemness markers ALDH1A1 and DCLK1, and EMT markers in minoxidil-treated and control-treated 786-O-derived sccRCC xenografts. (D) HE and IHC were used to assess the effect of minoxidil on the tissue morphology of 786-O-derived sccRCC xenografts. In areas with more residual PLOD2, the tissue morphology was more sarcomatoid; while in areas with less residual PLOD2, the morphology was more epithelioid. (E) The CCK8 assay was used to evaluate the effect of minoxidil combination therapy on the sensitivity of sccRCCs to doxorubicin, gemcitabine, and IFN-α. The x-axis represents the concentrations of doxorubicin, gemcitabine, and IFN-α. (F) CompuSyn calculated the synergy index (CI), with a CI value <1 indicating synergistic effect and a CI value <0.1 indicating a very strong synergistic effect. (G) IHC analysis of the effect of minoxidil treatment on the Ki-67 index of sccRCC xenografts. (H) Tumor growth curves and tumor weight measurements assessed the effect of minoxidil (6 mg / kg) on ​​the growth of sccRCC xenografts and on the sensitivity to axitinib (5 mg / kg) treatment (n=4). Data in the figures are expressed as mean ± standard deviation. Statistical analyses included unpaired two-sided Student's t-test [(A), (B), and (G)], or two-sided one-way ANOVA and Tukey's test (H). Detailed Implementation

[0059] Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials, reagents, instruments, etc., used in the following embodiments are commercially available. All quantitative experiments in the following embodiments were performed in at least three replicates, and the results were averaged.

[0060] Statistical Analysis: Statistical analysis was performed using R (version 4.2.2) or GraphPad Prism (version 8.4.0) unless otherwise specified. Generally, comparisons between two groups were performed using a two-tailed Student's t-test or a Wilcoxon rank-sum test, and comparisons among multiple groups were performed using a one-way ANOVA with post-hoc Tukey test. Chi-square tests were used to compare categorical variables. Kaplan-Meier curves were plotted and differences were assessed using log-rank tests performed with the "survival" and "survminer" R packages. Correlation analysis was performed using Pearson correlation coefficients. Data are expressed as mean ± standard deviation (SD). A p-value less than 0.05 was considered statistically significant, with the following notations: *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001.

[0061] Immunohistochemistry (IHC) and multiplex fluorescent IHC:

[0062] Tumor tissue was fixed with 4% paraformaldehyde and then embedded in paraffin. Tissue sections were cut into 4 μm sections for IHC analysis. First, the sections were dewaxed in xylene for 30 minutes, followed by a gradient of alcohols for 5 minutes each. Antigen retrieval was performed by EDTA or citric acid treatment (ZSGB-BIO, China). The sections were then blocked with goat serum at room temperature for 30 minutes. The slides were then incubated overnight at 4°C with the following primary antibodies: anti-PLOD2 antibody (1:200, Proteintech), anti-CA9 antibody (1:100, Proteintech), anti-AQP1 antibody (1:3000, Proteintech), anti-ALDH1A1 antibody (1:100, Proteintech), anti-DCLK1 antibody (1:300, Cell Signaling Technology), anti-E-cadherin antibody (1:100, Cell Signaling Technology), anti-ZO-1 antibody (1:100, Proteintech), anti-Vimentin antibody (1:100, Cell Signaling Technology), anti-Snail antibody (1:100, Proteintech), or anti-Ki67 antibody (1:150, ZSGB-BIO). Signal enhancement was then achieved using enzyme-labeled goat anti-mouse or anti-rabbit IgG polymers (ZSGB-BIO, China). IHC staining was performed using DAB substrate (ZSGB-BIO, China) and observed under an optical microscope (Olympus Corporation, Tokyo, Japan). IHC staining scores were determined using SlideViewer 2.8 software (3DHISTECH, Hungary).

[0063] For multiplex fluorescent IHC, patient samples were processed using a 4-color manual IHC kit (Akoya, USA) according to the manufacturer's instructions. Primary antibodies used for primary staining were anti-human PLOD2 antibody (1:150, Proteintech) and anti-human DCLK1 antibody (1:100, Cell Signaling Technology). Cell nuclei were stained with DAPI (Solarbio, Beijing, China). Images were acquired using a PANNORAMIC Midi II digital slide scanner (3DHISTECH, Hungary) and exported using SlideViewer 2.8.

[0064] HE staining and Masson's trichrome staining:

[0065] In the HE staining procedure, the sections were incubated in hematoxylin for 2 minutes, followed by counterstaining with eosin for 3 minutes. Masson trichrome staining (Solarbio, Beijing, China) was performed according to the manufacturer's instructions. Images were acquired using a biological microscope (Leica, Germany) and a PANNORAMIC Midi II digital slide scanner (3DHISTECH, Hungary).

[0066] Flow cytometry:

[0067] Cells were resuspended in cold PBS containing 2% FBS at a density of 1 × 10^6 cells / mL. To measure ALDH1A1 expression, cells were fixed with 4% paraformaldehyde (Solarbio, Beijing, China) at room temperature for 15 minutes. After fixation, cells were centrifuged at 3000 rpm for 5 minutes, and the supernatant was discarded. Cells were infiltrated with 0.1% Triton X-100 (Beyotime Biotechnology, China) at room temperature for 10 minutes, followed by incubation with ALDH1A1 primary antibody (1:100, Proteintech, China) at room temperature for 30 minutes, and then incubated with fluorescently labeled secondary antibody (1:100 dilution) in the dark for 30 minutes. To detect side population (SP) cells, cells were divided into two groups. One group was stained with Hoechst 33342 dye (KeyGEN BioTECH, China) at a concentration of 5 μg / mL and gently stirred at 37°C for 90 minutes. Another group of cells was pretreated with 50 μM Verapamil (Glpbio, USA) for 20 min, followed by staining with Hoechst dye at 37°C for 90 min. After washing twice with PBS containing 2% FBS, the cells were stained with 7-aminoactinomycin D (7-AAD, BD Biosciences, USA) at a concentration of 2 μg / ml. Fluorescence at 450 and 670 nm was measured by flow cytometry (BD LSR Fortessa, USA) to distinguish between SP and non-sidegroup (NSP) cells. Data were analyzed using FlowJo software version 10.8.1 (BD Biosciences, USA).

[0068] Immunofluorescence Assay:

[0069] Immunofluorescence analysis was performed using antibodies against DCLK1 (1:100, Cell Signaling Technology), ALDH1A1 (1:100, Proteintech), CA9 (1:100, Proteintech), AQP1 (1:100, Proteintech), ZO-1 (1:1000, Proteintech), Snail (1:250, Proteintech), and N-cadherin (1:500, Cell Signaling Technology). The experimental procedure was as follows: Cells were seeded at a density of 2 × 10^4 cells per well in 24-well plates. After 24 hours of adhesion, the cells were fixed in 4% paraformaldehyde solution (Solarbio, Beijing, China) for 10 minutes. After fixation, the cells were infiltrated with 0.2% Triton X-100 at room temperature for 10 minutes. After blocking with goat serum for 30 minutes, the cells were incubated overnight at 4°C with primary antibody. Subsequently, the samples were incubated in a dark room for 1 hour with fluorescently labeled secondary antibody (1:200 dilution) and stained with DAPI (Solarbio, Beijing, China) for 5 minutes. Final images were captured using a fluorescence microscope (Olympus, Japan).

[0070] Human clear cell renal cell carcinoma lines 786-O, 769-P, OS-RC-2, and Caki-1, as well as the human embryonic kidney cell line HEK293T, were obtained from a nationally certified cell bank (Beijing, China). The 786-O cell line is currently the only ccRCC cell line capable of forming sarcoma-like ccRCC xenografts. 786-O, 769-P, and OS-RC-2 cells were cultured in RPMI-1640 medium (SIGMA, Vienna, Austria). Caki-1 cells were cultured in McCoy's 5A medium (KeyGEN BioTECH, Jiangsu, China), and HEK293T cells were cultured in DMEM medium (Gibco, California, USA). Normal human renal epithelial cells HK-2 were maintained in DMEM / F-12 medium (Gibco, California, USA). All media were supplemented with 10% fetal bovine serum (FBS, Ausbian, Australia) and a 1% penicillin-streptomycin mixture (Solarbio, Beijing, China). All cell lines were cultured in a humid environment at 37°C and 5% CO2.

[0071] Clinical tissue samples from patients with or without sarcomatoid features of ccRCC used in the following examples were obtained from Beijing Chaoyang Hospital, Capital Medical University. All samples were reviewed by a specialized urogenital pathologist to confirm the presence of sarcomatoid / epithelialoid components. This study was ethically approved by the Ethics Committee of Beijing Chaoyang Hospital, and all participants signed informed consent forms in accordance with the Declaration of Helsinki.

[0072] All animal experiments were approved by the Laboratory Animal Management and Use Committee of Capital Medical University. Mice used in the experiments were purchased from Beijing Vital River Laboratory Animal Co., Ltd., and were housed under specific pathogen isolation conditions.

[0073] The antibodies used in the following examples and the names of the companies that sell them are as follows:

[0074] PLOD2 antibody: Proteintech (21214-1-AP);

[0075] DCLK1 antibody: Cell Signaling Technology (D2U3L);

[0076] CD44 antibody: Cell Signaling Technology (156-3C11);

[0077] β-catenin antibody: Cell Signaling Technology (D10A8);

[0078] ALDH1A1 antibody: Proteintech (15910-1-AP);

[0079] CD10 antibody: Proteintech (18008-1-AP);

[0080] CA9 antibody: Proteintech (66243-1-AP);

[0081] AQP1 antibody: Proteintech (20333-1-AP);

[0082] MUC1 antibody: Proteintech (23614-1-AP);

[0083] ZO1 antibody: Cell Signaling Technology (D7D12);

[0084] E-Cadherin antibody: Cell Signaling Technology (4A2);

[0085] N-Cadherin antibody: Cell Signaling Technology (D4R1H);

[0086] Vimentin antibody: Cell Signaling Technology (D21H3);

[0087] Snail antibody: Cell Signaling Technology (C15D3);

[0088] GAPDH antibody: Cell Signaling Technology (14C10);

[0089] β-actin antibody: Proteintech (81115-1-RR);

[0090] HRP-labeled Goat Anti-Rabbit IgG (H+L): Beyotime (A0208); HRP-labeled Goat Anti-Mouse IgG (H+L): Beyotime (A0216). The primers used in the following examples are shown in Table 1 below.

[0091] Table 1. Primer Information

[0092]

[0093] Among them, E-Cadherin can be abbreviated as E-Cad, Vimentin can be abbreviated as Vim, and N-Cadherin (N-cadherin) can be abbreviated as N-Cad.

[0094] Example 1: Screening for potential molecular markers of sarcomatoid renal cell carcinoma using multi-omics data

[0095] This embodiment utilizes ccRCC transcriptomic and proteomic data from the TCGA and CPTAC databases to screen for potential regulatory factors promoting ccRCC sarcoma-like dedifferentiation based on three key characteristics of sarcoma-like dedifferentiation (poor differentiation, high EMT, and poor prognosis). Figure 1 ).

[0096] Clinical information and high-throughput RNA sequencing data of ccRCC patients were obtained from UCSC Xena (https: / / xenabrowser.net / datapages / ). Expression values ​​were expressed as FPKM (fragments per kilobase) and logarithmically transformed using log2(FPKM+1) for statistical analysis. Clinical information and proteomics expression data of ccRCC patients were obtained from the ClinicalProteomic Tumor Analysis Consortium (CPTAC) through Proteomic Data Commons (PDCStudyID: PDC000411), at https: / / proteomic.datacommons.cancer.gov / . Information on TCGA and CPTAC ccRCC patients with sarcomatoid annotations was referenced from previous studies (Zuo Y, Fu S, Zhao Z, et al. Sarcomatoid-associated gene risk index for clear cell renal cellcarcinoma. Front Genet. 2022. 13: 985641.; Li Y, Lih TM, Dhanasekaran SM, et al. Histopathologic and proteogenomic heterogeneity reveals features of clear cell renal cell carcinoma aggressiveness. Cancer Cell. 2023. 41(1): 139-163. e17.). Gene expression profiles of other ccRCC samples and xenograft samples from renal cancer patients were downloaded from GeneExpression Omnibus (GEO, access numbers GSE73731 and GSE78806) at https: / / www.ncbi.nlm.nih.gov / geo / .

[0097] The heatmaps in this study were generated using the "ComplexHeatmap" R package. Survival analysis was performed using the "survminer" R package. EMT scores were based on gene definitions from previous studies (Mak MP, Tong P, Diao L, et al. APatient-Derived, Pan-Cancer EMT Signature Identifies Global Molecular Alterations and Immune Target Enrichment Following Epithelial-to-Mesenchymal Transition. Clin Cancer Res. 2016. 22(3): 609-20.), and stemness scores were calculated using previously identified ccRCC-specific stemness markers CD44, CXCR4, and MET (Fendler A, Bauer D, Busch J, et al. Inhibiting WNT and NOTCH in renal cancer stem cells and the implications for human patients. Nat Commun. 2020. 11(1): 929.). The formulas for calculating EMT and stemness scores are as follows:

[0098]

[0099] To screen for candidate drivers of sarcomatoid dedifferentiation in recurrent sarcoma (RCC), the inventors analyzed transcriptomic data from ccRCC patients at the TCGA and proteomic data from ccRCC patients at the CPCAC, based on three key characteristics of sarcomatoid dedifferentiation in ccRCC: poor differentiation, high EMT, and poor prognosis. All analyses were performed using R software (version 4.2.2). The Wilcoxon rank-sum test was used to identify differentially expressed genes that were progressively upregulated during ccRCC dedifferentiation (p < 0.05, FDR < 0.05). In the ccRCC patient sample, Pearson correlation analysis was used to identify genes significantly positively correlated with EMT scores (r > 0.35, adjusted p < 0.0001). The "survminer" R package was used to screen for genes associated with poor overall survival in ccRCC patients (p < 0.05). Ultimately, genes that overlapped with the "poor differentiation," "high EMT," and "poor prognosis" analyses at the mRNA and protein levels in the TCGA and CPTAC data were considered candidate drivers of RCC sarcoma-like dedifferentiation.

[0100] Screening revealed that all three genes of the lysine hydroxylase (PLOD) family (PLOD1, PLOD2, PLOD3) appeared in the final list of 13 candidate genes, suggesting a closer relationship between this gene family and sarcomatoid dedifferentiation in ccRCC. Given that among the three genes, PLOD2 had the highest expression level, the largest upregulation, and the highest relative risk (HR) of death in ccRCC (HR up to 2.51), further investigation was conducted. Figure 2 The inventors prioritized PLOD2 as the primary target for validation. The reliability of this choice was, in turn, supported by subsequent RNA-seq analysis in sccRCC cells, which showed that the loss of PLOD2 simultaneously led to a significant decrease in the expression of the other six candidate driver factors. Figure 3 ).

[0101] Example 2: PLOD2 is significantly overexpressed in sarcomatoid renal cell carcinoma cell lines and patient tissues.

[0102] Cell lines to be tested: normal renal proximal tubule cell line HK-2, epithelioid renal clear cell carcinoma cell lines OS-RC-2, 769-P, Caki-1, and sarcomatoid renal clear cell carcinoma cell line 786-O.

[0103] Western blot was used to detect PLOD2 expression in various cells. The antibodies used were PLOD2 antibody (Proteintech, 21214-1-AP) and β-actin antibody (Proteintech, 81115-1-RR). The secondary antibody was horseradish peroxidase-labeled secondary antibody (1:8000, ZSGB-BIO, China). Cell line validation revealed that PLOD2 expression in sarcomatoid clear cell renal carcinoma cells was significantly higher than that in epithelial-like clear cell renal carcinoma cells and normal renal cell lines. Figure 4 ).

[0104] Validation using clinical sample data from the TCGA and CPTAC databases also showed that PLOD2 expression in sarcomatoid renal cell carcinoma tissues was significantly higher than in adjacent normal tissues. Figure 5 ).

[0105] Immunohistochemical verification and PLOD2 content scoring of clinical samples collected by the inventors also revealed that PLOD2 expression in sarcomatoid clear cell renal carcinoma tissue was significantly higher than that in epithelioid clear cell renal carcinoma tissue. Figure 6 ).

[0106] Example 3: PLOD2 expression increases with the progression of renal cell carcinoma sarcomatoid dedifferentiation.

[0107] Sarcomatoid renal cell carcinoma tissue generally contains two tumor cell components: epithelioid and sarcomatoid. In order to further show the expression of PLOD2 in the sarcomatoid and epithelioid components in the same sRCC tissue, the inventors performed HE staining, immunohistochemical staining, and scoring statistics on tissues from 6 patients containing obvious epithelioid and sarcomatoid components.

[0108] The results showed that PLOD2 expression in the sarcomatoid component was significantly higher than that in the adjacent epithelioid component and the normal renal tissue adjacent to the cancer. Figure 7 The inventor provided specific examples from three typical cases: Patient 1 ( Figure 8 Patient 2 Figure 9 Patient 3 Figure 10 Immunohistochemical staining showed that PLOD2 can specifically recognize sarcomatoid components in sarcomatoid renal cell carcinoma tissue, and the inventors found that PLOD2 expression in the epithelioid-sarcomatoid transition zone is intermediate between that of the epithelioid and sarcomatoid regions. Figure 8-11 The results indicate that PLOD2 expression gradually increases as RCC sarcomatoid dedifferentiation progresses, further illustrating the specificity of PLOD2 in recognizing sarcomatoid components.

[0109] Example 4: PLOD2 knockout can lead to sarcomatoid morphology differentiation of renal cell carcinoma into epithelioid morphology.

[0110] To further verify the reliability of PLOD2 as a molecular marker for sarcomatoid renal cell carcinoma, the inventors knocked out PLOD2 in sarcomatoid renal cell carcinoma cells 786-O. Through HE staining and Masson's staining, they found that the xenografts in nude mice changed from a typical sarcomatoid morphology to a clear cell-like epithelial morphology, and exhibited epithelial morphology resembling that of normal proximal renal tubules. Figure 12 This further confirms the key role of PLOD2 in the sarcomatoid transformation of RCC, which in turn supports the reliability of PLOD2 as a molecular marker of sRCC.

[0111] CRISPR / Cas9-mediated PLOD2 gene knockout:

[0112] PLOD2 gene expression was precisely knocked out using CRISPR / Cas9 technology. A single guide RNA (sgRNA) sequence targeting PLOD2 was synthesized, annealed, and inserted upstream of the sgRNA backbone in the lentiCRISPRv2 vector, yielding three recombinant vectors. All three recombinant vectors could transcribe the PLOD2-targeting sgRNA. HEK293T cells were co-transfected with the three recombinant vectors, psPAX2 and pMD2.G, using Lipofectamine 3000 (Invitrogen, Carlsbad, California, USA), to produce lentiviral particles. 48-72 hours after transfection, the three recombinant lentiviruses were collected and purified through a 0.45 μm filter. Subsequently, the three recombinant lentiviruses were mixed and used to infect ccRCC 786-O cells. Three days post-infection, cell lines with stable PLOD2 gene knockout were selected using 2 μg / ml puromycin (Gibco, USA). Western blot analysis of the resulting cell lines showed a significant decrease in PLOD2 protein content compared to 786-O cells. The three PLOD2-specific sgRNA target sequences are as follows: PLOD2-sgRNA-1: 5'-ATATTTCAATTATACTGTGA-3' (SEQ ID No. 3); PLOD2-sgRNA-2: 5'-GTAGCAACAAAAGAAAGTGA-3' (SEQ ID No. 4); PLOD2-sgRNA-3: 5'-GTTGTGGCTGAGAAGATGAG-3' (SEQ ID No. 5).

[0113] Example 5: PLOD2 is also a molecular marker for sarcomatoid dedifferentiation in other subtypes of renal cell carcinoma.

[0114] Renal cell carcinoma includes common subtypes such as clear cell renal cell carcinoma, chromophobe renal cell carcinoma, and papillary renal cell carcinoma. The above studies primarily focused on the clear cell renal cell carcinoma subtype. Furthermore, analysis of PLOD2 expression in TCGA chromophobe renal cell carcinoma patient samples showed that two of the three patients explicitly labeled as sarcomatoid dedifferentiation had significantly higher PLOD2 expression than all patients labeled as non-sarcomatoid. Figure 13 This suggests that PLOD2 is likely a universal molecular marker for the sarcomatoid dedifferentiation phenotype of various subtypes of renal cell carcinoma.

[0115] Example 6: PLOD2-driven sarcomatoid dedifferentiation of ccRCC

[0116] Epithelial-like RCC cells acquire a sarcoma-like phenotype through stepwise dedifferentiation and EMT activation. To investigate the role of PLOD2 in sarcoma-like dedifferentiation, the inventors overexpressed PLOD2 in the epithelial-like ccRCC cell line 769-P, which had low PLOD2 expression.

[0117] Overexpression of human PLOD2:

[0118] PLOD2 overexpression was achieved using the pLV(Exp)-mCherry / Neo-EF1A>hPLOD2 lentiviral vector (catalog number: VB900122-1045uaw) from Yunzhou Biotechnology (Guangzhou) Co., Ltd. (Guangzhou, China). pLV(Exp)-mCherry / Neo-EF1A>hPLOD2 contains the PLOD2 gene coding sequence shown in SEQ ID No. 1 and expresses the PLOD2 protein shown in SEQ ID No. 2.

[0119] PLOD2 gene coding sequence (SEQ ID No. 1):

[0120] ATGGGGGGATGCACGGTGAAGCCTCAGCTGCTGCTCCTGGCGCTCGTCCTCCACCCCTGGAATCCCTGTCTGGGTGCGGACTCGGAGAAGCCCTCGAGCATCCCCACAGATAAATTATTAGTCATAACT GTAGCAACAAAAGAA AGTGA TGGATTCCATCGATTTATGCAGTCAGCCAA ATATTTCAATTATACTGTGA

[0121] PLOD2 protein (SEQ ID No. 2):

[0122] .

[0123] The recombinant vector pLV(Exp)-mCherry / Neo-EF1A>hPLOD2 was co-transfected with packaging plasmids pMD2G and psPAX2 into HEK293T cells to produce lentiviral particles. The resulting lentivirus was transfected into ccRCC 769-P cells. Three days after transfection, stable cell lines overexpressing PLOD2 were selected using 400 μg / mL G418.

[0124] The expression of PLOD2, stem cell markers, and epithelial markers in the obtained cell lines was detected by Western blotting and qPCR. The results showed that stem cell markers such as DCLK1, CD44, ALDH1A1, and β-catenin were significantly upregulated, while ccRCC-related epithelial markers CD10, CA9, and MUC1 were significantly downregulated. Figure 14 The presence of cells in region A indicates that the cells underwent dedifferentiation. Flow cytometry analysis showed an increased proportion of side population (SP) cells. Figure 14 In the middle B group, the ALDH1A1 staining intensity increased, and the proportion of ALDH1A1+ cancer stem cells increased. Figure 14 The study further verified that PLOD2 overexpression enhances the cancer stemness of epithelial-like ccRCC cells.

[0125] In addition to promoting cell dedifferentiation, PLOD2 overexpression also activated the EMT program in epithelial-like ccRCC cells. This was reflected in the decreased expression of epithelial markers E-cadherin and ZO-1, and the increased expression of mesenchymal markers vimentin, Snail, and N-cadherin, all of which were verified at the mRNA and protein levels. Figure 14 These results indicate that PLOD2 promotes both dedifferentiation and activates EMT in epithelial-like ccRCC cells, highlighting its role in sarcomatoid dedifferentiation.

[0126] To further verify the functional necessity of PLOD2 in ccRCC sarcoma-like dedifferentiation, the inventors knocked out PLOD2 in sccRCC cells (786-O) (the cells tested were the PLOD2 gene stably knocked out cell line obtained in Example 4). The results showed that the stemness of the cancer cells was significantly reduced, while epithelial differentiation was increased, which could be clearly seen from the changes in the expression of molecular markers. Figure 14 (E). In addition to epithelial markers related to ccRCC, the inventors also observed a significant increase in AQP1, a molecular marker specific to normal proximal tubular epithelial cells of the kidney, from which ccRCC originates ( Figure 14 (E).

[0127] Flow cytometry results showed a significant decrease in the proportion of SP cells. Figure 14 In the middle F), the ALDH1A1 staining intensity decreased, and the proportion of ALDH1A1+ cancer stem cells decreased. Figure 14 (G). Immunofluorescence staining further supported these findings, showing a significant decrease in the dryness markers DCLK1 and ALDH1A1, while a significant increase in the epithelial differentiation markers CA9 and AQP1. Figure 14 (H).

[0128] These results indicate that PLOD2 knockout can reduce the stemness of sccRCC cells and promote their differentiation into an epithelial phenotype, highlighting the value of PLOD2 as a potential therapeutic target for reversing sarcomatoid dedifferentiation in ccRCC cells.

[0129] It should be noted that no specific biomarker for sccRCC has been identified to date. However, based on existing literature, the inventors found that high expression of CA9 (an epithelial biomarker associated with ccRCC) and AQP1 (a specific biomarker for the proximal tubules of the kidney) may characterize the differentiation status of sccRCC at the molecular level: (1) Although CA9 is significantly upregulated during ccRCC tumorigenesis, its expression gradually decreases during ccRCC dedifferentiation. More importantly, recent studies have shown that in the same sccRCC tissue, CA9 expression is higher in the epithelioid component than in the sarcomatoid component. (2) ccRCC originates from the proximal tubules of normal kidneys, and AQP1 is a specific biomarker for the proximal tubules. This suggests that AQP1 expression can help assess the degree of differentiation of ccRCC. In fact, high AQP1 expression is significantly associated with the high level of differentiation of ccRCC, a finding that has been validated by TCGA and CPTAC data.

[0130] EMT plays a crucial role in maintaining the sarcomatoid morphology of sccRCC. This was demonstrated by Western blot and RT-qPCR. Figure 14 (I) and immunofluorescence staining ( Figure 14 In J), the inventors observed that EMT was significantly reversed after PLOD2 knockout in sccRCC cells, with increased expression of epithelial markers (E-cadherin and ZO-1) and decreased expression of mesenchymal markers (vimentin, Snail and N-cadherin).

[0131] Furthermore, in PLOD2-deficient sccRCC cells, the inventors' RNA sequencing data also showed significant alterations in the expression of molecular markers associated with cancer cell stemness, epithelial differentiation, and EMT. Figure 14 (Middle K). Gene ontology (GO) analysis showed that PLOD2 loss-induced gene alterations were significantly enriched in processes related to sRCC biology, including the establishment of cell polarity, stem cell differentiation, renal tubular development, and the G2 / M transition of the mitotic cell cycle (M). Figure 15 These results further confirm the key role of PLOD2 in driving molecular events that drive sarcoma-like dedifferentiation in ccRCC.

[0132] Furthermore, TCGA analysis of colorophobic renal cell carcinoma subtypes showed that PLOD2 expression was significantly higher in the three patients annotated as sarcomatoid dedifferentiation than in all 22 patients annotated as non-sarcomatoid. Figure 16 (A). PLOD2 was also significantly associated with the stromal characteristics of the chromophobe renal cell carcinoma subtype. Figure 16 (B) This suggests that PLOD2 may also play a role in regulating sarcomatoid dedifferentiation in other RCC subtypes. These results indicate that PLOD2 is a key regulator of sarcomatoid dedifferentiation in various RCC types.

[0133] Example 7: PLOD2 knockout induces sccRCC differentiation and improves treatment response

[0134] Pathological morphological examination is the gold standard for diagnosing sCC. To further investigate the effect of PLOD2 knockout on sccRCC differentiation, the inventors performed histopathological analysis on sarcomatoid masses derived from 786-O cells in mice.

[0135] A total of 5 × 10^6 control cells (sarcomatoid renal cell carcinoma cells 786-O) or PLOD2 knockout sccRCC cells (the PLOD2 gene stably knocked-out cell line obtained in Example 4) were injected into the dorsal region of 4-week-old male NOD / Scid nude mice to establish sccRCC xenograft tumor models with or without PLOD2. Mice were sacrificed 40 days after transplantation, and tumors were excised for examination.

[0136] HE staining showed that the spindle-shaped sarcoma-like appearance of sccRCC was significantly reversed to a clear cell epithelial-like morphology after PLOD2 knockout. Figure 17 (A). Furthermore, Masson staining revealed cytoplasmic proximal tubular-like structures in PLOD2-deficient sccRCC xenografts, resembling normal kidney tissue. Figure 17 (A)

[0137] These morphological changes were accompanied by a significant increase in differentiation markers CA9 and AQP1, and a significant decrease in stemness markers ALDH1A1 and DCLK1, which was confirmed by IHC analysis in PLOD2-deficient sccRCC xenograft tumors. Figure 17 (B). Further IHC analysis also showed a significant decrease in EMT markers, indicating the induction of mesenchymal-epithelial transition (MET). Figure 17 (C). These in vivo experimental results further confirm the role of PLOD2 knockout in driving the differentiation of sccRCCs into epithelioid morphology (eccRCCs), which is achieved by reducing cancer cell stemness, enhancing epithelial differentiation, and inducing MET.

[0138] Analysis of patient sample data from TCGA, CPTAC, and GSE73731 showed a significant negative correlation between PLOD2 and the epithelial differentiation marker AQP1. Figure 17 (D), and showed a significant positive correlation with the specific ccRCC dry marker (CXCR4+MET+CD44+). Figure 17 (E), supporting the dedifferentiation effect of PLOD2 in ccRCC.

[0139] In ccRCC, poor differentiation is directly associated with rapid tumor progression and poor survival. Figure 17 In this embodiment, PLOD2 knockout-induced sccRCC differentiation significantly inhibited tumor growth (F). Figure 17 (G), accompanied by a significant decrease in the Ki-67 proliferation index (G). Figure 17 These results were confirmed in a nude mouse subcutaneous xenograft tumor model. Furthermore, in the TCGA, CPTAC, and GSE73731 datasets, PLOD2 expression was significantly correlated with Ki-67 levels. Figure 17 Middle I).

[0140] Sarcoma-like dedifferentiation is associated with resistance to cytotoxic chemotherapy and anti-angiogenic therapy. Treatment of sarcoma-like renal cell carcinoma 786-O cells or PLOD2 knockout sccRCC cells (the PLOD2 gene stably knocked-out cell line obtained in Example 4) with doxorubicin, gemcitabine, and IFN-α (α-interferon) showed that PLOD2 knockout-induced differentiation significantly enhanced the sensitivity of sccRCC cells to doxorubicin, gemcitabine, and IFN-α, as evidenced by a significant decrease in IC50 values. Figure 17 (J). In xenograft mouse model experiments, intervention with PLOD2 alone showed a stronger antitumor effect than the anti-angiogenic drug axitinib. Figure 17 (K). Furthermore, combining PLOD2 intervention with axitinib significantly enhanced the sensitivity of sccRCC xenograft tumors to axitinib ( Figure 17 (Middle K). The experimental steps for the xenograft mouse model are as follows: A total of 5 × 10^6 control cells (sarcoma-like renal cell carcinoma cells 786-O) or PLOD2 knockout sccRCC cells (the PLOD2 gene stably knocked-out cell line obtained in Example 4) were injected into the dorsal region of 4-week-old male NOD / Scid nude mice to establish sccRCC xenograft models with or without PLOD2. Mice were sacrificed 40 days after transplantation, and the xenograft tumor was excised and cut into pieces approximately 4 mm in size. 3Small xenografts were transplanted into the right abdomen of 4-week-old male BALB / C nude mice. When the sccRCC xenografts reached the specified size, mice with each tumor were randomly divided into two groups (n=5 per group), receiving either DMSO or axitinib at 5 mg / kg / day. Mice were sacrificed 40 days after tumor transplantation, and tumors were excised for size and weight testing. Tumor volume was monitored before sacrifice. DMSO was administered intraperitoneally, while axitinib was administered by gavage.

[0141] These findings suggest that PLOD2 plays a key role in sarcomatoid dedifferentiation and treatment resistance in sccRCC, and that targeting PLOD2 may be a new strategy to improve the efficacy of existing treatments.

[0142] Example 8: Minoxidil, a pharmacologically targeted inhibitor of PLOD2, drives sccRCC differentiation and enhances its sensitivity to treatment.

[0143] Minoxidil, an FDA-approved drug for the treatment of androgenetic alopecia, was recently discovered to be an inhibitor of PLOD2. To explore whether pharmacological targeting of PLOD2 could provide therapeutic benefit to patients with sccRCC, the inventors treated sccRCC cells with minoxidil.

[0144] 1. Drug sensitivity test

[0145] Sarcoma-like renal cell carcinoma cells 786-O were seeded in 96-well plates (2000 cells per well) and cultured in a humidified incubator with 5% CO2. They were then treated with different concentrations of doxorubicin (MedChemExpress, China), gemcitabine (MedChemExpress, China), or everolimus (MedChemExpress, China) for 48 hours, or with IFN-α (Genscript, USA) for 72 hours before CCK8 analysis. For combination therapy experiments, pre-cultured 786-OsccRCC cells (2000 cells per well) were treated with different concentrations of the therapeutic agent in combination with low doses of minoxidil (MedChemExpress, China) (0.25 mM and 0.5 mM) for 48 hours. Subsequently, the cells were mixed with 90 μL of RPMI-1640 medium using CCK8 reagent (Lablead, China) and incubated at 37°C for 1 hour, with absorbance measured at 450 nm. Cell viability was expressed as a percentage (%) and calculated using the formula: [(OD value of experimental group - OD value of blank group) / (OD value of control group - OD value of blank group)] × 100%. Data analysis was performed using GraphPad 8.0 software (GraphPad, San Diego, California). The co-existence index (CI) was calculated using CompuSyn software version 1.0, with CI < 1 indicating synergistic effects and CI < 0.1 indicating extremely strong synergistic effects.

[0146] The results showed that minoxidil treatment (0.5 mM) significantly increased the expression of ccRCC epithelial differentiation markers, while significantly decreasing the expression of cancer stem cell and EMT markers. This phenomenon was confirmed by in vitro Western blot and RT-qPCR analysis. Figure 18 (A and B), and further confirmed by IHC staining of tumor tissue in an in vivo xenograft experiment ( Figure 18 These molecular changes are accompanied by significant epithelial-like differentiation in approximately 60% of sccRCC xenograft tumors (C). Figure 18 (D). In areas with higher PLOD2 residues, the tissue morphology tends towards sarcoma-like, while in areas with lower PLOD2 residues, the morphology is more epithelial-like. Figure 18 (D). The in vivo xenograft experiment proceeded as follows: 5 × 10^6 786-O cells were injected into the dorsal region of 4-week-old male NOD / Scid nude mice to establish an sccRCC xenograft tumor model. Mice were sacrificed 40 days post-transplantation, and the xenograft tumor was harvested and cut into approximately 4 mm sections. 3 Small xenografts were transplanted into the right abdomen of 4-week-old male BALB / C nude mice. When the sccRCC xenografts reached the specified size, the tumor-bearing mice were randomly divided into two groups (n=5 per group), and were administered DMSO or minoxidil at 6 mg / kg / day by gavage, respectively. The mice were sacrificed 40 days after tumor transplantation, and the tumors were excised for analysis.

[0147] To evaluate whether minoxidil, when combined with conventional drugs, could enhance therapeutic sensitivity, the inventors treated sccRCC cells with two relatively mild minoxidil doses: 0.25 mM and 0.5 mM. Single-dose treatment did not induce significant cell death. Subsequently, minoxidil was combined with doxorubicin, gemcitabine, and IFN-α. Results showed that minoxidil at both doses significantly enhanced the tumor-killing effects of all three drugs, exhibiting a synergistic effect. CompuSyn's combination index (CI) calculations showed that all CI values ​​were <1. Figure 18 (E and F in the middle).

[0148] 2. In vivo xenotransplantation experiment

[0149] To investigate the effects of PLOD2 knockout on the biology of sccRCC, a total of 5 × 10^6 control cells (sarcomatoid renal cell carcinoma 786-O) or PLOD2-knockout sccRCC cells (the PLOD2 gene stably knocked-out cell line obtained in Example 4) were injected into the dorsal region of 4-week-old male NOD / Scid nude mice to establish sccRCC xenograft tumor models with or without PLOD2. Mice were sacrificed 40 days after transplantation, and the tumor xenograft was harvested and cut into pieces approximately 4 mm in size. 3Small xenografts were transplanted into the right abdomen of 4-week-old male BALB / C nude mice. When the sccRCC xenografts reached the specified size, the tumor-bearing mice were randomly divided into two groups (n=5 per group), and were administered DMSO or axitinib (5 mg / kg / day) by gavage, respectively. Tumor size was monitored and recorded every two days, and tumor volume was calculated using the following formula: Tumor volume = (tumor length × tumor width²) / ².

[0150] For in vivo combination therapy experiments, BALB / C nude mice with 786-O-derived sccRCC xenografts of comparable size were randomly divided into four groups (n=4 per group): one group received DMSO (control group), one group received minoxidil at 6 mg / kg / day, one group received axitinib at 5 mg / kg / day, and the other group received a combination of minoxidil at 6 mg / kg / day and axitinib at 5 mg / kg / day. DMSO and minoxidil were administered intraperitoneally, while axitinib was administered by gavage.

[0151] In the sccRCC xenograft mouse model, minoxidil alone (6 mg / kg) significantly reduced the Ki-67 index ( Figure 18 (G) and tumor growth rate ( Figure 18 In addition to the H), the combination of minoxidil and other treatments significantly improved the sensitivity of sccRCC xenografts to axitinib (a treatment targeting angiogenesis). Figure 18 These findings suggest that PLOD2 is a promising pharmacological target for the future treatment of sRCC, and that minoxidil combined with conventional therapy may be a more effective strategy for managing sccRCC.

[0152] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.

Claims

1. The application of substances that increase the content or activity of PLOD2 protein in the preparation of sarcoma-like clear cell renal cancer cells or tissue models, characterized in that: The model was obtained by inducing epithelioid clear cell renal cancer cells or tissues to transform into sarcomatoid clear cell renal cancer cells or tissues. The substance that increases the content or activity of PLOD2 protein is a recombinant vector containing a nucleic acid molecule encoding PLOD2 protein, wherein the recombinant vector is pLV(Exp)-mCherry / Neo-EF1A>hPLOD2.

Images