Primer pair, kit and method for rapid identification and quantitative detection of Lactobacillus acidophilus

Abstract

The invention belongs to the technical field of biology, and particularly discloses a primer pair, a kit and a method for rapidly identifying and quantitatively detecting lactobacillus acidophilus. A specific primer pair is designed aiming at lactobacillus acidophilus, the primer pair comprises a forward primer and a reverse primer, the nucleotide sequence of the forward primer is shown as any one of SEQ ID NO.1-5, and the nucleotide sequence of the reverse primer is shown as SEQ ID NO.6. The kit provided by the invention comprises the primer pair. The primer pair or the kit can be applied to detection of fermented food or lactobacillus acidophilus in the food fermentation process, and the method provided by the invention can realize rapid identification and quantitative detection of the lactobacillus acidophilus, and is high in detection accuracy, good in effectiveness and high in sensitivity.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and specifically discloses a primer pair, a kit and a method for rapid identification and quantitative detection of Jinshan Lactobacillus acetate. Background Art

[0002] Lactobacillus acetate Jinshan Acetilactobacillus jinshanensis ), first discovered in vinegar, and later found to play a dominant role in the late fermentation of liquor mash, playing a decisive role in the flavor of sauce-flavor liquor, and is a brewing functional microorganism. Therefore, the development of rapid monitoring technology for the dynamic succession of important functional strains of acetic acid and lactic acid bacteria in food fermentation is of great significance to clarifying the brewing mechanism behind food fermentation, and is helpful for monitoring and optimizing the brewing production process.

[0003] At present, the identification and quantification methods of Jinshan Lactobacillus acetate mainly use physiological and biochemical reactions, selective culture medium pure culture isolation and counting methods, but these methods are easily affected by factors such as culture conditions and strain characteristics, and there is a problem of poor linearity between plate culture counts and bacterial liquid concentrations. Real-time fluorescence quantitative PCR technology that does not rely on culture has also been used for rapid quantitative detection of Jinshan Lactobacillus acetate, such as using specific sequences in the α subunit of Jinshan Lactobacillus acetate phenylalanyl-tRNA synthetase as molecular markers, and using fluorescence quantitative PCR to accurately quantify them (ZL202110440735.6). Similarly, Kim E et al. developed the identification of Lactobacillus casei groups in probiotics using specific gene (glycoside hydrolase, hypothetical protein, transporter, etc.) sequences (Food Microbiology, 2020, 90: 103485). However, the screening of such specific gene sequences is based on high-quality genome sequencing, and there are a large number of unsequenced microorganisms in the production process of traditional fermented foods. Therefore, this strategy may lead to potential application risks of poor specificity of the developed detection method.

[0004] 16S rRNA is a subunit of ribosomal RNA and is present in the genome of all bacteria. 16S rDNA is the most useful and commonly used molecular clock in the systematic classification of bacteria. This sequence contains 10 conserved regions and 9 hypervariable regions. The conserved regions are common to all bacteria and are indistinguishable between bacteria, while the variable regions are genus or species specific and are indicators of bacterial phylogeny and classification. They are usually used to identify bacterial species at the genus level or to measure the total number of bacteria. At present, there is no report on the quantitative detection of Jinshan Lactobacillus acetate at the species level based on 16S rDNA sequences. Summary of the invention

[0005] In response to these defects, the present invention provides primer pairs, kits and methods for rapid identification and quantitative detection of Lactobacillus jinshanaceticus. Primer pairs that can specifically amplify Lactobacillus jinshanaceticus are designed based on specific conserved sequences in the 16S rDNA of Lactobacillus jinshanaceticus. Combined with PCR technology and CRISPR-Cas12a technology, rapid identification and accurate quantification of Lactobacillus jinshanaceticus in samples are achieved.

[0006] To achieve the above object, the present invention provides the following technical solutions: In a first aspect, the present invention provides a primer pair for identifying and quantitatively detecting Lactobacillus jinshanaceticus, the primer pair comprising a forward primer and a reverse primer, the nucleotide sequence of the forward primer being as shown in any one of SEQ ID NO.1-5, and the nucleotide sequence of the reverse primer being as shown in SEQ ID NO.6.

[0007] Nucleotide sequence SEQ ID NO.1: GCTAGAGAAGAACGTACCAAGT; Nucleotide sequence SEQ ID NO.2: GTTGCTAGAGAAGAACGTACCA; Nucleotide sequence SEQ ID NO.3: GTACCAAGTAGGAAATGGCTT; Nucleotide sequence SEQ ID NO.4:TGGTAGTGACGGTATCTGGTT; Nucleotide sequence SEQ ID NO.5: AAGTAGGAAATGGCTTGGTAGT; Nucleotide sequence SEQ ID NO.6: CCTCTTCTGTACTCAAGTCGCT.

[0008] The primer pair provided by the present invention is a specific primer designed for a specific conserved sequence gene in 16S rDNA of Lactobacillus jinshanensis. The specificity and accuracy of the provided primer pair are verified by PCR using a standard strain and a fermented grain sample, and it is found that the primer pair only specifically amplifies Lactobacillus jinshanensis, and is insensitive to other dominant lactic acid bacteria in the fermentation process.

[0009] Preferably, the nucleotide sequence of the forward primer is shown in SEQ ID NO.2, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO.6.

[0010] In a second aspect, the present invention also provides a kit for specific identification / quantitative detection of Lactobacillus jinshanaceticus, the kit comprising any one of the above primer pairs.

[0011] The nucleotide sequence of the target gene (Target DNA) targeted by the kit is shown in SEQ ID NO.8.

[0012] Preferably, the kit further comprises DNA polymerase and buffer.

[0013] Preferably, the kit is a Jinshan Lactobacillus acetate detection kit based on CRISPR-Cas12a, and the kit also includes crRNA, a fluorescent reporter probe and a Cas12a protein; the nucleic acid sequence of the crRNA is shown in SEQ ID NO.9; the fluorescent reporter probe is a double-labeled single-stranded DNA sequence, the 5' end is labeled with a fluorescent group, and the 3' end is labeled with a quenching group.

[0014] More preferably, the sequence of the fluorescent reporter probe is fluorescent reporter group-TTATT-fluorescence quencher group, the fluorescent group of the fluorescent reporter probe is one of FAM, HEX, TET, JOE and VIC, and the fluorescent quencher group is one of BHQ1, BHQ2 and BHQ.

[0015] In a third aspect, the present invention also provides the use of the above primer pair or the above kit in identifying and / or quantitatively detecting Lactobacillus jinshanaceticus.

[0016] Preferably, the application is the application of the primer pair or the kit to identify and / or quantitatively detect Lactobacillus jinshanaceticus in fermented food or food fermentation process.

[0017] The fermented food is a food produced by utilizing the action of microorganisms, including but not limited to liquor, soy sauce, vinegar, fermented black beans, rice wine, beer, wine, etc.

[0018] Preferably, the application is the above primer pair or the above kit in identifying and distinguishing Lactobacillus jinshanaceticus from Lactobacillus plantarum ( Lactiplantibacillus plantarum ), Weissella Weissella sp. , Pediococcus acidilactici ( Pediococcus acidilactici )、Lactobacillus acidophilus( Lactobacillus acidophilus ) in applications.

[0019] In a fourth aspect, the present invention also provides a method for specifically identifying Lactobacillus jinshanensis, using the above primer pair or the above kit to detect the nucleic acid in the sample to be tested, and identifying Lactobacillus jinshanensis in the sample to be tested by observing the product band position or sequencing results through gel electrophoresis.

[0020] The sample to be tested contains bacteria, genome or metagenome.

[0021] The sample to be tested may be a finished fermented food or a sample taken from a fermented food during its fermentation process. The fermented food includes, but is not limited to, liquor, vinegar, Daqu and fermented grains.

[0022] Preferably, colony PCR can be performed on the microorganisms in the test sample or PCR can be performed using the microorganism genome in the test sample as a template, and the PCR product can be subjected to gel electrophoresis. If the PCR product has a band between 100-250 bp on the electrophoresis map, it means that the test sample contains Lactobacillus jinshanensis; or the PCR product between 100-250 bp is sequenced, and the sequencing result is compared with the gene sequence of Lactobacillus jinshanensis to determine whether the test sample contains Lactobacillus jinshanensis.

[0023] The sample to be tested may also be a microbial cell. The microbial cell may be a single cell or a mixed cell, and the microorganisms include but are not limited to Lactobacillus plantarum, Weissella, Pediococcus acidilactici, Lactobacillus acidophilus and Lactobacillus jinshanaceticus.

[0024] When distinguishing Lactobacillus jinshanensis from Lactobacillus plantarum, Weissella, Pediococcus acidilactici, and Lactobacillus acidophilus, colony PCR is performed or PCR is performed using the genomes of the above lactic acid bacteria as templates, and the PCR products are observed by gel electrophoresis. If the PCR product has a band between 100-250 bp on the electrophoresis map, it means that the corresponding strain is Lactobacillus jinshanensis; or the PCR product between 100-250 bp is sequenced, and the sequencing result is compared with the gene sequence of Lactobacillus jinshanensis to determine whether the corresponding strain is Lactobacillus jinshanensis.

[0025] Specifically, the present invention also provides a method for specifically identifying Lactobacillus aceticus Jinshan, comprising the following steps: S1: Extract the genome of the microorganisms in the sample to be tested; S2: After diluting the genome obtained in S1, PCR is performed using the above primer pair or the above kit, and the position of the product band is observed by gel electrophoresis to identify the Lactobacillus jinshanensis in the sample to be tested.

[0026] In some embodiments, the method for specifically identifying Lactobacillus jinshanensis also includes pre-treating the sample to be tested before S1, including the following steps: collecting microorganisms in the sample to be tested; and crushing, centrifuging, and extracting the microbial cells.

[0027] Specifically, the present invention also provides another method for specifically identifying Lactobacillus jinshanensis, comprising the following steps: S1: Prepare the sample to be tested into a bacterial suspension, dilute and spread the bacterial suspension to obtain a single colony; S2: performing colony PCR on the single colony obtained in S1 using the above primer pair or the above kit, and identifying Lactobacillus jinshanensis in the sample to be tested by observing the position of the product bands through gel electrophoresis.

[0028] In a fifth aspect, the present invention also provides a method for specific quantitative detection of Lactobacillus aceticus, comprising the following steps: S1: Extract the genome of the microorganisms in the sample to be tested; S2: using the above primer pair or the above kit, and taking the genomic DNA extracted from S1 as a template, a fluorescent quantitative PCR amplification reaction is performed, and the Lactobacillus jinshanensis in the sample to be tested is quantified based on the Ct value obtained by amplification.

[0029] In the method using fluorescent quantitative PCR (qPCR) amplification reaction, the minimum detection limit of Lactobacillus aceticus in Jinshan was 10 3 copies / μL.

[0030] Preferably, the annealing temperature during the fluorescence quantitative PCR amplification reaction is 60°C; In some embodiments, the method for specific quantitative detection of Lactobacillus jinshanensis further comprises the following operations: Obtaining a single-copy cloning plasmid containing the target fragment: using the genome of Lactobacillus jinshanensis as a template, using specific primers to perform PCR on SEQ ID NO.2 and SEQ ID NO.6 to obtain a specific target fragment, the nucleotide sequence of which is shown in SEQ ID NO.8; connecting the target fragment with a T vector to obtain a recombinant plasmid, that is, obtaining a single-copy cloning plasmid containing the target fragment; Drawing a standard curve: using a single-copy clone plasmid containing the target fragment as a standard, and using different concentrations of the standard as a template, using the primer pairs shown in SEQ ID NO.2 and SEQ ID NO.6 to perform qPCR amplification reactions on the different concentrations of the standard, respectively, using the Lg value of the copy number as the horizontal axis and the Ct value as the vertical axis, and establishing a standard curve; Quantitative calculation: Substitute the Ct value of the sample to be tested into the standard curve to calculate the copy number, and convert it to obtain the corresponding content of Lactobacillus aceticus in the sample to be tested.

[0031] In a sixth aspect, the present invention also provides a method for specific quantitative detection of Lactobacillus aceticus based on CRISPR-Cas12a, comprising the following steps: S1: Extract genomic DNA from the sample to be tested; S2: The genomic DNA described in S1 or the genomic DNA described in S1 is used as a template, and the amplified product obtained by PCR amplification using the above primer pair or the above kit is added to the CRISPR-Cas12a reaction system containing crRNA, fluorescent reporter probe, buffer and Cas12a protein; the nucleic acid sequence of the crRNA is shown in SEQ ID NO.9; the fluorescent reporter probe is a double-labeled single-stranded DNA sequence, the 5' end of which is labeled with a fluorescent group and the 3' end is labeled with a quenching group.

[0032] S3: After the reaction is completed, the fluorescence intensity of the reaction system is detected to obtain a fluorescence signal; and the Lactobacillus jinshanensis in the sample to be tested is quantified based on the obtained fluorescence signal.

[0033] In the method for specific quantitative detection of Lactobacillus jinshanensis based on CRISPR-Cas12a provided by the present invention, the target gene (Target DNA) is the specific conserved sequence gene of Lactobacillus jinshanensis. When Cas12a detects the corresponding TargetDNA, the crRNA-activated Cas12a protein non-specifically cuts any single-stranded DNA, separates the fluorescent group from the quenching group, and the fluorescent group emits fluorescence, and the concentration of Lactobacillus jinshanensis can be identified by detecting the fluorescence intensity. This method achieves a minimum detection limit of 10 for the concentration of Lactobacillus jinshanensis in the sample. 0 At the same time, the CRISPR-Cas12a fluorescence system can be used to detect Jinshan Lactobacillus acetate, which can be amplified isothermally and quickly and accurately amplify and detect the specific genes of Jinshan Lactobacillus acetate, without the need for a temperature-variable instrument like PCR to achieve amplification and detection.

[0034] In some embodiments, the method for specific quantitative detection of Lactobacillus jinshanensis further comprises the following operations: Construction of standard Target DNA: PCR amplification was performed using the sequences shown in SEQ ID NO.2 and SEQ ID NO.6 as primers. The amplified product was used to construct a plasmid containing a specific fragment of Lactobacillus jinshanensis. The plasmid was the standard Target DNA; Drawing a standard curve: preparing standard Target DNA of different concentrations; adding the standard Target DNA of different concentrations to the above reaction system respectively, and performing CRISPR-Cas12a reaction; drawing a standard curve with the standard Target DNA concentration as the horizontal axis and the fluorescence signal as the vertical axis; Quantitative calculation: Substitute the fluorescence intensity value into the standard curve to calculate the copy number, and convert it to obtain the corresponding content of Lactobacillus jinshanensis in the sample to be tested.

[0035] Preferably, each 100 μL of the CRISPR-Cas12a reaction system includes: 10 μL of 10×NEB Bufferr2.1; 100 nM of Cas12a protein; 200 nM of DNA reporter molecule; 300 nM of crRNA; and 5 μL of genomic DNA / amplification product.

[0036] More preferably, the concentration of the genomic DNA is 50 ng / μL or the concentration of the amplification product is 50 ng / μL.

[0037] Preferably, the CRISPR-Cas12a reaction conditions are: 37° C. for 30-60 min.

[0038] Preferably, the excitation wavelength used for the fluorescence intensity detection is 484 nm, and the emission wavelength is 529 nm. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0040] Figure 1 The gel electrophoresis diagram of the amplification of lactic acid bacteria by the five primer pairs in Example 1; Figure 2 is the qPCR melting curve of the 2-F / 2-R primer pair in Example 1; Figure 3 The results of validating the 2-F / 2-R primer pair in Example 1; (lanes 1-5 are fermented grains metagenome templates) Figure 4 is the qPCR standard curve in Example 3; Figure 5 This is a feasibility experimental analysis of detecting Lactobacillus aceticus in Jinshan based on the CRISPR-Cas12a fluorescent reporter system in Example 4; Figure 6 The results of different concentrations of Lactobacillus jinshanensis detection based on the CRISPR-Cas12a fluorescent reporter system in Example 5; Figure 7 It is the standard curve based on the CRISPR-Cas12a fluorescent reporter system in Example 5; Figure 8 The fluorescence intensity of Lactobacillus jinshanaceticus in the real fermented grains sample was detected based on the CRISPR-Cas12a fluorescence reporter system in Example 5. DETAILED DESCRIPTION

[0041] The following will be combined with the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0042] Description of the source of biological materials: Lactobacillus acetate Jinshan Acetilactobacillus jinshanensis )HSLZ-75 T , provided by the Modern Brewing Technology Research Group of Tianjin University of Science and Technology, the strain has been published in “Comparative Genome Analysis and Vinegar Brewing Function Evaluation of Jinshan Lactobacillus Acetate” (Sun Jia); Weissella Weissella sp. )CICC 24442 and Pediococcus acidilactici ( Pediococcus acidilactici )CICC 24367 was provided by China Industrial Microbiology Culture Collection Center (CICC); Lactobacillus acidophilus ( Lactobacillus acidophilus )ATCC 4356 and Lactobacillus plantarum ( Lactobacillus plantarum )ATCC14917 was commercially available.

[0043] Unless otherwise specified, the technical means used in the examples are conventional means known to those skilled in the art. The test methods in the following examples are conventional methods unless otherwise specified. Unless otherwise specified, the reagents and materials used can be obtained through commercial channels.

[0044] Unless otherwise defined, all professional and scientific terms used herein have the same meanings as those familiar to those skilled in the art. In addition, any methods and materials similar or equivalent to those described herein may be applied to the present invention. The preferred implementation methods and materials described herein are for demonstration purposes only.

[0045] Unless otherwise specified, the implementation of the present invention will use conventional botanical techniques, microorganisms, tissue culture, molecular biology, chemistry, biochemistry, DNA recombination and bioinformatics techniques that are obvious to those skilled in the art. These techniques are fully explained in the published literature. In addition, the methods of DNA extraction, construction of phylogenetic trees, gene editing methods, construction of gene editing vectors, and obtaining gene-edited plants used in the present invention can be achieved by using methods already disclosed in existing literature, except for the methods used in the following examples.

[0046] Example 1 Primer design and specificity verification 1. Sequence analysis and primer design Using the gene fragment of the Jinshan Lactobacillus acetate nucleotide sequence as shown in SEQ ID NO.7 as the template sequence, multiple pairs of primers were designed, the length of the primers was between 21-22 bp, and the sequences of each primer pair are shown in Table 1 below. The designed primer sequences were verified for specificity by NCBI Blast, and the alignment results showed that they only had 100% similarity with Jinshan Lactobacillus acetate. The above primer sequences were synthesized and purified by a primer synthesis company.

[0047] Table 1 Primer sequences

[0048] 2-F / 2-R was used as a primer pair and the genome of Lactobacillus jinshanensis was used as a template for PCR amplification. The nucleotide sequence of the amplified fragment was shown in SEQ ID NO.8, with a length of 230 bp, a GC content of 51%, and a Tm value of 55°C.

[0049] 2. Primer specificity verification Five core lactobacilli, Lactobacillus aceticus, Lactobacillus plantarum, Weissella, Pediococcus acidilactici and Lactobacillus acidophilus, were activated and cultured. The genomes of the five lactobacilli were extracted using a bacterial genomic DNA extraction kit (Cat. No. DP302). The DNA concentration was measured by Nano Drop 2000 and then diluted to 50 ng / μL. The five primer pairs in Table 1 were used to perform PCR amplification with the extracted lactobacilli genome as templates, and the PCR products were subjected to gel electrophoresis. Double distilled water (ddH 2 O) as blank control, electrophoresis results as Figure 1 shown.

[0050] PCR reaction system: 1 μL of upstream and downstream primers, 10 μL of 2× Rapid Taq Master Mix, 1 μL of genomic template, ddH 2 O 8 μL.

[0051] PCR reaction conditions: 95°C for 3 min; 95°C for 15 s, 55°C for 15 s, 72°C for 10 s, 30 cycles; 72°C for 5 min.

[0052] Figure 1The gel electrophoresis diagram of 5 sets of primer pairs amplifying lactic acid bacteria, wherein lanes 1-5 are the results of primer pair 1-F / 1-R amplifying Lactobacillus jinshanensis, Lactobacillus plantarum, Weissella, Pediococcus acidilactici and Lactobacillus acidophilus respectively; lanes 7-11 are the results of primer pair 2-F / 2-R amplifying Lactobacillus jinshanensis, Lactobacillus plantarum, Weissella, Pediococcus acidilactici and Lactobacillus acidophilus respectively; lanes 12-16 are the results of primer pair 3-F / 3-R amplifying Lanes 17-21 are the results of primer pair 4-F / 4-R amplifying Lactobacillus aceticus, Lactobacillus plantarum, Weissella, Pediococcus acidilactici and Lactobacillus acidophilus; Lanes 23-27 are the results of primer pair 5-F / 5-R amplifying Lactobacillus aceticus, Lactobacillus plantarum, Weissella, Pediococcus acidilactici and Lactobacillus acidophilus. Lanes 6 and 12 are Mark.

[0053] The electrophoresis results showed that lanes 1, 7, 12, 17, and 23 (representing the electrophoresis results of amplifying Jinshan Lactobacillus acetate using primer pairs 1-F / 1-R, 2-F / 2-R, 3-F / 3-R, 4-F / 4-R, and 5-F / 5-R, respectively) contained single bands. The positions of the bands varied slightly with the primer pairs, but the lengths were all around 200 bp. No strains other than Jinshan Lactobacillus acetate had the target bands, indicating that the above primer pairs had good specificity.

[0054] Comparing the electrophoresis results of lanes 1, 7, 12, 17, and 23 separately, compared with other primer pairs, the PCR product of the 2-F / 2-R primer pair had the highest electrophoresis brightness and a length of about 230 bp. The homology with the Jinshan Lactobacillus acetate accession sequence in Genebank was 100%, so the 2-F / 2-R primer pair was selected for subsequent experiments.

[0055] Feasibility verification of quantitative detection (1) Preparation of a single-copy clone plasmid containing the target fragment: Using the genome of Lactobacillus jinshanensis as a template, PCR was performed using a 2-F / 2-R specific primer pair to obtain a specific target fragment, whose nucleotide sequence is shown in SEQ ID NO.8. The target fragment was connected to 5×pClone007 Versatile Simple Vector Mix by T vector to obtain a recombinant plasmid, i.e., a single-copy clone plasmid containing the target fragment.

[0056] PCR reaction system: 1 μL of upstream and downstream primers, 10 μL of 2× Rapid Taq Master Mix, 1 μL of genomic template, ddH 2 O 8 μL.

[0057] PCR reaction conditions: 95°C for 3 min; 95°C for 15 s, 55°C for 15 s, 72°C for 10 s, 30 cycles; 72°C for 5 min.

[0058] (2) Use a single-copy clone plasmid containing the target fragment as a standard, determine the concentration of the standard, and perform gradient dilution with distilled water to obtain 10 0 -10 10 qPCR was performed using 2-F / 2-R specific primer pairs and different concentrations of standard samples as templates.

[0059] qPCR reaction system: 0.8 μL each of primers 2-F / 2-R, 10 μL of TB Green Premix Ex Taq II, 2 μL of template DNA, ddH 2 O 6.4 μL.

[0060] qPCR reaction conditions: 95°C for 30 s; 95°C for 5 s, 60°C for 30 s, and 95°C for 5 s, for 40 cycles.

[0061] Draw a melting curve for the standard qPCR amplification results (such as Figure 2 ). It can be seen that the number of copies of the standard is 10 0 -10 10 When the amplification curve of Jinshan Lactobacillus acetate qPCR was within the range of 100 copies / μL, it was a typical inverted S curve. The baseline of the amplification curve was flat, the exponential phase was obvious and steep, the platform phase could converge, the linear range was wide, and the higher the concentration of the plasmid standard, the lower the cycle threshold Ct value. In addition, the qPCR melting curve of Jinshan Lactobacillus acetate showed a single melting peak at around 85°C, without primer dimers and non-specific products, and the curve was stable with a sharp and narrow peak, indicating that the melting temperature of plasmids of different concentrations was uniform and the amplification product had good specificity. It was feasible to perform quantification based on this.

[0062] 4. Validity Verification 5 mash samples: The samples were taken from the mash samples before entering the cellar of a liquor production enterprise in Guizhou, liquor product number: BJD4300.

[0063] Weigh 7 g of fermented grains into a 50 mL centrifuge tube, add 15 mL of sterile PBS buffer and 3 g of sterilized glass beads, use a vortex shaker to fully oscillate for 10 min, centrifuge at 300×g for 5 min, collect the supernatant, repeat the above operation three times, combine the supernatants, centrifuge at 12000×g for 10 min, and use the soil genomic DNA extraction kit (Cat. No.: DP336) to extract the fermented grains metagenome. Using the obtained fermented grains metagenome as a template, PCR amplification was performed using the 2-F / 2-R primer pair. The results of agarose gel electrophoresis of the PCR product are shown in Figure 3 The electrophoresis results showed that there were bands in lanes 1-5 with a length of about 230 bp, indicating that this primer pair can be used to detect Lactobacillus aceticus in the fermented mash during liquor fermentation.

[0064] Example 2 This embodiment provides a method for identifying Lactobacillus jinshanaceticus in a fermented grain sample during the fermentation process of Maotai-flavor liquor.

[0065] Weigh 7 g of fermented grains in a 50 mL centrifuge tube, add 15 mL of sterile PBS buffer, 3 g of sterilized glass beads, use a vortex shaker to fully oscillate for 10 min, centrifuge at 300×g for 5 min, collect the supernatant, repeat the above operation three times, combine the supernatants, centrifuge at 12000×g for 10 min, and use the soil genomic DNA extraction kit (Cat. No.: DP336) to extract the genome from the obtained precipitate. Using the obtained genome as a template, PCR amplification was performed using any set of primers in Table 1. The PCR reaction system and reaction conditions were referred to Example 1, and the PCR product was subjected to agarose gel electrophoresis. The electrophoresis result showed that the band appeared at about 200 bp, indicating that the fermented grains tested contained Lactobacillus aceticus from Jinshan.

[0066] Example 3 This embodiment provides a method for quantitatively detecting Lactobacillus jinshanaceticus in a fermented grain sample.

[0067] (1) Preparation of a single-copy cloning plasmid containing the target fragment: Using the genome of Lactobacillus jinshanensis as a template, PCR was performed using a 2-F / 2-R specific primer pair to obtain a specific target fragment, the nucleotide sequence of which is shown in SEQ ID NO.8. The target fragment was ligated to a 5×pClone007 Versatile Simple Vector Mix by T vector to obtain a recombinant plasmid, i.e., a single-copy cloning plasmid containing the target fragment.

[0068] PCR reaction system: 1 μL of upstream and downstream primers, 10 μL of 2× Rapid Taq Master Mix, 1 μL of genomic template, ddH 2 O 8 μL.

[0069] PCR reaction conditions: 95°C for 3 min; 95°C for 15 s, 55°C for 15 s, 72°C for 10 s, 30 cycles; 72°C for 5 min.

[0070] (2) Draw a standard curve: Use a single-copy clone plasmid containing the target fragment as the standard, determine the concentration of the standard, and perform gradient dilution with distilled water to obtain 10 0 -10 10 copies / μL of different concentrations of standard products. qPCR was performed using 2-F / 2-R specific primer pairs with different concentrations of standard products as templates. The standard curve was drawn with the Lg value of the standard gene copy number as the horizontal axis and the Ct value as the vertical axis.

[0071] qPCR reaction system: 0.8 μL each of primers 2-F / 2-R, 10 μL of TB Green Premix Ex Taq II, 2 μL of template DNA, ddH 2 O 6.4 μL.

[0072] qPCR reaction conditions: 95°C for 30 s; 95°C for 5 s, 60°C for 30 s, and 95°C for 5 s, for 40 cycles.

[0073] (3) Extraction of genome from mash samples: Weigh 7 g mash into a 50 mL centrifuge tube, add 15 mL sterile PBS buffer and 3 g sterilized glass beads, vortex thoroughly for 10 min, centrifuge at 300 × g for 5 min, collect the supernatant, repeat the above operation three times, combine the supernatants, centrifuge at 12,000 × g for 10 min, and use the soil genomic DNA extraction kit (Cat. No.: DP336) to extract the genome from the precipitate.

[0074] (4) Using the obtained genome as a template, qPCR was performed using a 2-F / 2-R specific primer pair. The qPCR reaction conditions were the same as those in step (2). The obtained Ct value was substituted into the standard curve obtained in step (2) to convert the content of Lactobacillus aceticus in the fermented grains sample.

[0075] The standard curve of the standard prepared according to step (2) is Y=-2.4898X+33.322, R 2 =0.93( Figure 4 ). It can be seen that in 10 3 -10 10 In the range of copies / μL, the fluorescence intensity showed a good linear relationship with the Target DNA concentration.

[0076] Example 4 Construction of CRISPR-Cas12a detection system Design and synthesis of crRNA: According to the gene sequence specific to Lactobacillus aceticus Jinshan (nucleotide sequence as SEQ ID NO.8), the crRNA required for the CRISPR-Cas12a reaction process was designed, and its nucleic acid sequence is shown in SEQ ID NO.9. The crRNA sequence itself does not form a stable secondary structure with the Target DNA and primers.

[0077] reporter DNA: FAM-TTATT-BHQ1.

[0078] Each 100 μL CRISPR-Cas12a reaction system includes: 10×NEB Bufferr2.1 10 μL; Cas12a protein 100 nM; DNA reporter molecule 200 nM; crRNA 300 nM; genomic DNA / amplification product 5 μL.

[0079] The CRISPR-Cas12a reaction conditions were 37°C, 60 min; the fluorescence signal detection conditions were excitation and emission wavelengths of 484 and 529 nm, respectively.

[0080] In order to verify whether the system is successfully constructed, feasibility experiments were carried out, such as Figure 5 As shown, when Cas12a protein, crRNA and Target DNA are present in the detection system at the same time, the system will have a higher fluorescence value, which proves the feasibility of the system, that is, the system is successfully constructed.

[0081] Example 5 This embodiment provides a method for specific quantitative detection of Lactobacillus jinshanaceticus in fermented grains samples based on CRISPR-Cas12a.

[0082] (1) Preparation of a single-copy cloning plasmid containing the target fragment: The preparation method is the same as that in Example 3, and a single-copy cloning plasmid containing the target fragment is used as the Target DNA.

[0083] (2) Draw the standard curve: Configuration 10 0 -10 10 The target DNA with different concentration gradients of copies / μL was used as the standard. The standard was used as the detection template to perform CRISPR-Cas12a fluorescence detection. The reaction system and reaction conditions were the same as those in Example 4. The results are shown in Figure 6 The standard curve was drawn with the Lg value of the standard gene copy number as the horizontal axis and the fluorescence intensity as the vertical axis.

[0084] (3) Extraction of genome from mash samples: Weigh 7 g mash into a 50 mL centrifuge tube, add 15 mL sterile PBS buffer and 3 g sterilized glass beads, vortex thoroughly for 10 min, centrifuge at 300 × g for 5 min, collect the supernatant, repeat the above operation three times, combine the supernatants, centrifuge at 12,000 × g for 10 min, and use the soil genomic DNA extraction kit (Cat. No.: DP336) to extract the genome from the precipitate.

[0085] (4) Using the obtained genome as a template, CRISPR-Cas12a fluorescence detection is performed, and the obtained fluorescence value is substituted into the standard curve of step (2), and finally the content of Lactobacillus aceticus in the fermented grains sample is obtained.

[0086] Depend on Figure 6 It can be seen that as the concentration of Target DNA (plasmid containing the specific fragment of Lactobacillus jinshanensis) increases, the fluorescence intensity increases accordingly, showing a positive correlation. The fluorescence intensity value of the standard sample at a reaction time of 60 min was used to make a standard curve, Y=179X+755.64, R 2 =0.996 ( Figure 7 ), in 10 0 -0 10 In the range of copies / μL, the fluorescence intensity showed a good linear relationship with the Target DNA concentration.

[0087] Eleven samples of fermented grains from two different pits were taken, their genomes were extracted, and their fluorescence intensity was determined according to the CRISPR-Cas12a detection system in Example 4. The reaction conditions were 37°C for 60 min. The fluorescence signal intensity was detected by Tecan Infinite®200Pro plate reader. The fluorescence signal detection conditions were excitation wavelength and emission wavelength of 484 and 529 nm, respectively. The fluorescence intensity was measured every 30 s. The experiment was repeated three times. The results are as follows: Figure 8 As shown, substituting into the standard curve Y=179X+755.64, after conversion, it can be known that the Jinshan Lactobacillus acetate concentration of the above-mentioned mash sample is shown in Table 2.

[0088] Table 2 Content of Lactobacillus aceticus in different fermented grains

[0089] In summary, the specific primer pair provided by the present invention and the kit comprising the primer pair can realize the rapid identification and accurate determination of Jinshan Lactobacillus acetate, are easy to operate, have high detection sensitivity, are suitable for actual production and research scenarios, and can be widely used in the detection and quantitative analysis of Jinshan Lactobacillus acetate in fermented foods or food fermentation processes, providing strong support for quality control and process optimization in the field of fermented foods.

[0090] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the protection scope of the present invention.

Claims

1. A primer pair for rapid identification and quantitative detection of Lactobacillus jinshanaceticus, the primer pair comprising a forward primer and a reverse primer, characterized in that: The nucleotide sequence of the forward primer is shown in any one of SEQ ID NO.1-5, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO.

6.

2. The primer pair according to claim 1, characterized in that The nucleotide sequence of the forward primer is shown in SEQ ID NO.2, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO.

6.

3. A kit for specific identification / quantitative detection of Lactobacillus aceticus Jinshan, characterized in that: The kit comprises any one of the primer pairs described in claims 1-2.

4. The kit according to claim 3, characterized in that The kit is a quantitative detection kit for Lactobacillus aceticus Jinshan based on CRISPR-Cas12a, and the kit also includes crRNA, a fluorescent reporter probe and a Cas12a protein; the nucleic acid sequence of the crRNA is shown in SEQ ID NO.9; the fluorescent reporter probe is a double-labeled single-stranded DNA sequence, the 5' end is labeled with a fluorescent group, and the 3' end is labeled with a quenching group.

5. Use of the primer pair described in any one of claims 1-2 or the kit described in any one of claims 3-4 in identifying and / or quantitatively detecting Lactobacillus jinshanaceticus.

6. The use according to claim 5, characterized in that: The application is the application of the primer pair or the kit in identifying and / or quantitatively detecting Lactobacillus jinshanensis in fermented food or in a food fermentation process; and / or The application is the application of the primer pair or the kit in identifying and distinguishing Lactobacillus jinshanaceticus from Lactobacillus plantarum, Weissella, Pediococcus acidilactici and Lactobacillus acidophilus.

7. A method for specific identification of Lactobacillus aceticus Jinshan, characterized in that: The nucleic acid in the sample to be tested is detected using the primer pair described in any one of claims 1 to 2 or the kit described in claim 3, and the Lactobacillus jinshanensis in the sample to be tested is identified by observing the product band position through gel electrophoresis or sequencing results.

8. A method for specific quantitative detection of Lactobacillus aceticus Jinshan, characterized in that: The following steps are involved: S1: Extract the genome of the microorganisms in the sample to be tested; S2: using the primer pair described in any one of claims 1-2 or the kit described in claim 3, and taking the genomic DNA extracted by S1 as a template, a fluorescent quantitative PCR amplification reaction is performed, and the Lactobacillus jinshanensis in the sample to be tested is quantified based on the Ct value obtained by amplification.

9. A method for specific quantitative detection of Lactobacillus aceticus Jinshan based on CRISPR-Cas12a, characterized in that: The following steps are involved: S1: Extract genomic DNA from the sample to be tested; S2: The genomic DNA described in S1 or the genomic DNA described in S1 is used as a template, and the primer pair described in any one of claims 1 to 2 or the kit described in claim 4 is used to perform PCR amplification to obtain an amplification product, which is added to a CRISPR-Cas12a reaction system containing crRNA, a fluorescent reporter probe, a buffer and Cas12a; the nucleic acid sequence of the crRNA is shown in SEQ ID NO.9; the fluorescent reporter probe is a double-labeled single-stranded DNA sequence, the 5' end of which is labeled with a fluorescent group and the 3' end is labeled with a quenching group. S3: After the reaction is completed, the fluorescence intensity of the reaction system is detected to obtain a fluorescence signal; and the Lactobacillus jinshanensis in the sample to be tested is quantified based on the obtained fluorescence signal.

10. The method for specific quantitative detection of Lactobacillus jinshanensis based on CRISPR-Cas12a according to claim 9, characterized in that: The fluorescence intensity detection was performed at an excitation wavelength of 484 nm and an emission wavelength of 529 nm.

Images