A Cymbidium goeringii flowering regulation gene CsFTL3, its encoded protein and applications

Abstract

The present invention discloses a gene for regulating the flowering of Cymbidium goeringii CsFTL3 and its encoded protein and applications, belonging to the field of plant molecular biology. The gene for regulating the flowering of Cymbidium goeringii was isolated from the flower bud cDNA of the Cymbidium sinense variety 'Xiaoxiang' in the present invention CsFTL3 , which encodes 174 amino acids. By constructing an expression vector of the CsFTL3 gene and overexpressing it in wild-type Arabidopsis thaliana, after heterologously overexpressing the CsFTL3 gene in Arabidopsis thaliana, it was found that the bolting and flowering period of Arabidopsis thaliana were significantly delayed, the flower stem was significantly thickened and lengthened, the number of rosette leaves was significantly increased, and the growth period was extended, indicating that this gene has the function of delaying the flowering time of Arabidopsis thaliana. The gene for regulating the flowering of Cymbidium goeringii of the present invention can be used for the research on the molecular mechanism of the flowering time of Orchidaceae plants, delaying the flowering time of Cymbidium goeringii and promoting the vegetative growth of plants, which can extend the overall ornamental time of Cymbidium goeringii and promote the genetic improvement and variety selection of Cymbidium goeringii.

Description

Technical Field

[0001] The present invention belongs to the field of plant molecular biology, and particularly relates to a gene for regulating the flowering of Cymbidium CsFTL3 and its encoded protein and applications. Background Art

[0002] Cymbidium is a traditional famous flower in China, with profound cultural heritage and important economic value, and its annual output value exceeds 10 billion yuan. The flowering period is one of the important factors determining the ornamental value and economic benefits of Cymbidium. However, at present, the research on the flowering regulation mode and molecular mechanism of action of Cymbidium is relatively lacking, which severely restricts the industrial development of Cymbidium.

[0003] Floral induction is a crucial step in determining the flowering time and is strictly regulated by multiple flowering pathways. There are 7 floral induction pathways in Arabidopsis thaliana, such as the photoperiod pathway, vernalization pathway, and autonomous pathway. Among these pathways, the florigen FT (Flowering Locus T) is a key downstream integrator in the flowering regulation network. It belongs to the FT-like subfamily of the PEBP gene family, is highly conserved in plants, and is crucial for plant flowering. In Arabidopsis thaliana, FT the gene is expressed in leaves, is transported to the shoot apical meristem (SAM) after binding to the FTIP protein, and interacts with the transcription factor FD and the 14-3-3 protein to jointly form a protein complex to promote flowering. In different species FT the gene usually has a conserved function of promoting flowering, such as in rice Hd3a and tomato SFT and maize ZCN8 etc. However, some FT homologous genes also have the function of inhibiting flowering. For example, under long-day conditions, overexpression of barley HvFT4 delays its own flowering time. Overexpression of Arabidopsis thaliana in Phalaenopsis shows the function of inhibiting flowering. Rice OsFTL12 forms a floral inhibition complex by interacting with GF14b and OsFD1, delaying the heading time. In recent years, researchers have also explored the conservation and diversity of PhFT6 genes in different plants through methods such as comparative genomics and epigenetics, revealing the important role of these genes in the process of plant evolution. FT At present,

[0004] Currently, FT the biological functions of homologous genes in Cymbidium are still largely unknown, and it is impossible to precisely regulate the flowering period of Cymbidium. Moreover, the long floral bud development cycle of many Cymbidium species hinders the development of the Cymbidium industry. Therefore, deeply exploring FTIdentifying homologous genes and analyzing their regulatory roles in the flowering of national orchids can provide powerful technical guidance for the efficient growth of plants, year-round flowering, etc. At the same time, it will also provide excellent gene resources and theoretical guidance for the precise regulation of the flowering period of Orchidaceae plants in future molecular breeding using techniques such as genetic transformation and gene editing. Summary of the Invention

[0005] In order to overcome the disadvantages and deficiencies of the prior art, the object of the present invention is to provide a national orchid flowering regulatory gene CsFTL3 and its encoded protein and application, which can delay the flowering time of transgenic plants, increase the growth period, and regulate the flowering period of plants.

[0006] The object of the present invention is achieved by the following technical solutions:

[0007] The first object of the present invention is to provide a national orchid flowering regulatory gene—— FTL3 , which is isolated from the flower bud cDNA of Cymbidium sinense ( Cymbidium sinense ) variety 'Xiaoxiang'. Its nucleotide sequence consists of 525 bases, as shown in SEQ ID NO: 1, and is named CsFTL3 .

[0008] The second object of the present invention is to provide the protein encoded by the above national orchid flowering regulatory gene, which consists of 174 amino acid residues, as shown in SEQ ID NO: 2.

[0009] The third object of the present invention is to provide an expression cassette, recombinant expression vector, transgenic cell, recombinant bacterium or transgenic material containing the national orchid flowering regulatory gene CsFTL3 .

[0010] The starting vector of the expression vector is any binary vector that can be used for Agrobacterium-mediated plant transformation or a vector that can be used for plant microprojectile bombardment, such as pBI series vectors, pCAMBIA series vectors, pBin series vectors or other derivative plant expression vectors. The pOCA30 plasmid is used in the present invention.

[0011] The host bacterium of the recombinant bacterium is Agrobacterium; preferably Agrobacterium GV3101.

[0012] The fourth object of the present invention is to provide CsFTL3 the gene, the encoded protein, the expression cassette, recombinant expression vector, transgenic cell, recombinant bacterium or transgenic material containing CsFTL3 the gene in at least one of the following (a)-(e):

[0013] (a) Regulating the bolting time and / or flowering time of plants;

[0014] (b) Regulating the number of rosette leaves of plants;

[0015] (c) Adjusting the color of plant leaves;

[0016] (d) Adjusting the traits of plant flower stems;

[0017] (e) Adjusting the vegetative growth stage of plants.

[0018] Preferably, the plant is Arabidopsis thaliana, Cymbidium, etc.

[0019] Preferably, the flower stem traits include thickness, length, and / or quantity.

[0020] Preferably, the application is achieved by overexpressing CsFTL3 a gene;

[0021] Specifically, after overexpressing CsFTL3 the gene in plants, the flowering time of the plants is delayed, the number of rosette leaves is increased, the leaf color of the plants is deepened, the flower stems are thickened, the flower stems are lengthened, the number of flower stems is reduced, and the growth period is prolonged.

[0022] The fifth object of the present invention is to provide a method for delaying the flowering of plants and / or increasing the number of rosette leaves, and / or prolonging the vegetative growth stage of plants, comprising the following steps: transforming CsFTL3 the gene into plant cells, tissues or organs, and then cultivating them into plants to express the CsFTL3 gene in the plants, so as to delay the flowering time of the plants and / or increase the number of rosette leaves, and / or prolong the vegetative growth stage of the plants.

[0023] Preferably, the plant is Arabidopsis thaliana, Cymbidium, etc.

[0024] Preferably, the transformation method includes the floral dip method.

[0025] Through molecular biology techniques, the present invention discovers that overexpression of the Cymbidium flowering regulatory gene in Arabidopsis thaliana can change the flowering traits of plants and cause a phenomenon of delayed flowering, indicating that this gene has the function of delaying the flowering of Arabidopsis thaliana. Therefore, CsFTL3 the gene and its encoded protein are used in the research of the regulation pathway of flowering traits such as the flowering period of Cymbidium, which can delay the flowering time of Cymbidium, thereby increasing the flowering ornamental period of the entire Cymbidium variety, and promoting the genetic improvement and variety breeding of Cymbidium.

[0026] The present invention has the following advantages and effects compared with the prior art:

[0027] (1) The present invention isolated the key gene FTL3 that controls flowering from the flower bud cDNA of the Cymbidium sinense variety 'Xiaoxiang' of Cymbidium, and named it CsFTL3 . Through the analysis of the expression patterns in different tissue parts, it was found that CsFTL3The expression is the highest in Cymbidium sinense; among different flower development stages of Cymbidium sinense, CsFTL3 the expression level rapidly decreases during the floral transition period, then remains at a relatively low level until the flower opens, when it is highly expressed again, suggesting that it may play a role in the floral transition process of Cymbidium sinense.

[0028] (2)By constructing CsFTL3 the expression vector of the gene and overexpressing it in wild-type Arabidopsis thaliana, after heterologously overexpressing CsFTL3 the gene in Arabidopsis thaliana, it was found that the bolting and flowering of Arabidopsis thaliana were significantly delayed, the flower stalks were significantly thickened and lengthened, the number of rosette leaves was significantly increased, and the growth period was extended, indicating that this gene has the function of delaying the flowering of Arabidopsis thaliana. The gene for regulating the flowering of Chinese orchids in the present invention can be used for the study of the molecular mechanism of the flowering time of Orchidaceae plants, delaying the flowering time of Chinese orchids and promoting the vegetative growth of plants, which can extend the overall ornamental time of Chinese orchids and promote the genetic improvement and variety breeding of Chinese orchids. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 For Example 1 of the present invention, CsFTL3 Multiple sequence homology alignment.

[0030] Figure 2 For Example 1 of the present invention, CsFTL3 Phylogenetic tree analysis.

[0031] Figure 3 For Example 2 of the present invention, CsFTL3 Analysis of the expression pattern in different organs of Cymbidium sinense. Note: A: Phenotypes of different organs; B: CsFTL3 Expression level analysis chart.

[0032] Figure 4 For Example 2 of the present invention, CsFTL3 Analysis of the expression pattern in different flower development stages of Cymbidium sinense. Note: A: Phenotypes of different flower development stages FD1-FD9; B: CsFTL3 Expression level analysis chart.

[0033] Figure 5 For Example 3 of the present invention, the electrophoresis diagram for identifying positive transgenic plants. Note: Line2-4 represents 3 transgenic lines.

[0034] Figure 6 For Example 3 of the present invention, phenotypic analysis of transgenic Arabidopsis thaliana. Note: A: CsFTL3 Late-flowering phenotype of transgenic Arabidopsis thaliana; B: Statistics of the flowering time of Arabidopsis thaliana; C: Statistics of the number of rosette leaves of Arabidopsis thaliana. DETAILED DESCRIPTION OF THE INVENTION

[0035] To make the objectives, technical solutions, and beneficial technical effects of the present invention clearer, the present invention will be further described in detail below in conjunction with the accompanying drawings and embodiments. It should be understood that the embodiments described in this specification are only for explaining the present invention and not for limiting the present invention. The parameters, ratios, etc. of the embodiments can be selected according to local conditions without having a substantial impact on the results.

[0036] The pOCA30 plasmid in the embodiment is disclosed in the literature "Liu D, Yu D. MicroRNA (miR396) negatively regulates expression of ceramidase-like genes in Arabidopsis [J].Progress in Natural Science, 2009, 19(6): 781-785. DOI:10.1016 / j.pnsc.2008.09.006."

[0037] Example 1 CsFTL3 Cloning and sequence analysis of genes

[0038] 1. Extraction of RNA and obtaining of cDNA

[0039] Take about 2 g of flower buds of Cymbidium sinense variety 'Xiaoxiang', quickly freeze them in liquid nitrogen, grind them with a grinder, and then use the RNA extraction kit of Novizan Company (Fastpure Universal Plant Total RNA Isolation Kit) to extract the total RNA of the flower buds, and store it at -80 °C in the refrigerator for later use. Reverse transcribe the above-extracted total RNA into cDNA using the reverse transcription kit of Novizan Company (HiScript III 1st Strand cDNA Synthesis Kit (+gDNA wiper)), and store it at -20 °C in the refrigerator.

[0040] 2. Target gene CsFTL3 obtaining

[0041] Using PCR primers CsFTL3 -F (ATGTCAGGGAGTTCTTCAAACC) and CsFTL3 -R (TTAAGTGAAGAATCTCCGACCACC), using the flower bud cDNA obtained in step 1 as a template, and using the high-fidelity enzyme of Novizan Company (2xPhanta Flash Master Mix (Dye Plus)) for PCR. The PCR reaction system is 50 μL, including 25 μL of high-fidelity enzyme, 2 μL of each primer, 2 μL of cDNA, and make up with ddH 20 to 50 μL. PCR reaction program: pre-denaturation at 95 °C for 30 s; denaturation at 95 °C for 10 s, annealing at 56 °C for 5 s, extension at 72 °C for 5 s, 35 cycles; finally, complete extension at 72 °C for 1 min. The PCR product was recovered by 1% agarose gel electrophoresis, and then the recovered product was ligated to a cloning vector (5 min TA / Blunt-Zero Cloning Kit) and sent to Shanghai Sangon Biotech Co., Ltd. for sequencing. Sequencing result analysis found that the amplified fragment contained the complete CDS sequence of the target gene, consisting of 525 bases, and the nucleotide sequence was as shown in SEQ ID NO: 1, named Cymbidium sinense flowering regulation gene CsFTL3 gene, and the CsFTL3 nucleotide sequence was translated into a protein sequence using SnapGene software (the sequence was as shown in SEQ ID NO: 2), and the amino acid sequence of the encoded protein consisted of 174 amino acid residues, named Cymbidium sinense flowering regulation protein CsFTL3 protein. The obtained Escherichia coli containing CsFTL3 is currently stored in the Institute of Environmental Horticulture, Guangdong Academy of Agricultural Sciences.

[0042] 3. CsFTL3 Gene sequence analysis

[0043] The conserved domain of CsFTL3 protein was analyzed by the Conserved Domain Search function of the NCBI database, and it was found that CsFTL3 had a highly conserved PEBP-domain of the PEBP family, with a G-x-H-R module, but did not have the conserved sequence D-P-D-x-P.

[0044] The Cymbidium sinense CsFTL3 gene was searched for homologous sequences in NCBI, and the encoded amino acids of the homologous sequences were aligned using the software MEGA ( Figure 1 ), and a phylogenetic tree was constructed ( Figure 2 ). The results showed that CsFTL3 had 90.80% homology with MaFT1a-3 (QLM02171.1) of Maxillaria tenuifolia ( Maxillaria aurea ), 89.66% homology with DcHd3a-like (XP_020703352.1) of Dendrobium officinale ( Dendrobium catenatum ), 84.48% homology with PeHd3a-like (XP_020599121.1) of Phalaenopsis aphrodite ( Phalaenopsis equestris ), 79.65% homology with EaFT1a (QLM02138.1) of Encyclia tampensis ( Elleanthus aurantiacus ), and 79.65% homology with Epiolaena marginata ( Masdevallia coccinea)McFT1a (QLM02156.1) has 78.41% homology, with Dendrobium officinale Dendrobium catenatum )DcHd3a (XP_020703351.1) has 76.88% homology, with Corybas robertsonii Miltoniopsis roezlii )MrFT1a (QLM02181.1) has 75.86% homology, with Vanda coerulea Masdevallia wendlandiana )MwFT1a (QLM02161.1) has 77.58% homology, with Apostasia shenzhenica Apostasia shenzhenica )AsHd3a (PKA64473.1) has 68.97% homology.

[0045] Example 2 CsFTL3 Expression pattern in Cymbidium sinense

[0046] 1. RNA extraction and cDNA acquisition

[0047] Take about 2 g of samples from different organs (roots, stems, leaves, flowers, fruits) and different flower development stages (FD1 - FD9) of the Cymbidium sinense variety 'Xiaoxiang', quickly freeze them in liquid nitrogen, grind them with a grinder, and use the RNA extraction kit (Fastpure Universal Plant Total RNA Isolation Kit) of Novizan to extract the total RNA of flower buds, and store it at -80 °C in the refrigerator for later use. Reverse transcribe the above-extracted total RNA into cDNA using the reverse transcription kit (Thermo Scientific RevertAid First Strand cDNA Synthesis Kit) of Thermo Fisher Scientific, and store it at -20 °C in the refrigerator.

[0048] 2. qRT-PCR detection

[0049] Use the forward primer qRT- CsFT L3-F (CTTCGATCAGTCAGTGAGGTT) and the reverse primer qRT- CsFTL3 -R (AACACGCAGATCTTCTCCTC) to perform qRT-PCR analysis on the gene expression levels in different tissues and organs and different flower development stages of Cymbidium sinense. Use the primers qRT- CsFTL3 -F (GGTGATGTGCTGGATCCTTT) and qRT- CsActin -R (TACTGGATTGGTTGGGCTTG) to amplify CsActin Actin ​As an internal reference. qRT-PCR reaction procedure: pre-denaturation at 95°C for 30 s; denaturation at 95°C for 5 s, annealing at 60°C for 30 s, 40 cycles. The real-time fluorescence quantitative reaction was carried out using the qTOWER 2.2 fluorescence quantitative PCR instrument from Analytik Jena AG, and the operation was carried out according to the instructions of the Taq Pro Universal SYBR qPCR Master Mix kit.

[0050] 3. Expression analysis

[0051] Analysis of the qRT-PCR results revealed that CsFTL3 the gene was most highly expressed in the flowers among different organs of Cymbidium sinense, followed by the stems ( Figure 3 ); among different stages of flower development in Cymbidium sinense, CsFTL3 it was highly expressed in the buds from FD1 to FD2, and was lowly expressed at the onset of floral transition at FD3, and the expression level increased significantly only at the stage of fully bloomed petals at FD9 ( Figure 4 ).

[0052] Example 3 CsFTL3 Functional analysis of Arabidopsis thaliana overexpressing the gene

[0053] 1. Construction of plant overexpression vector

[0054] The pOCA30 plasmid was double digested (the restriction enzyme sites were Sac I and Sal Ⅰ, Takara), and the linearized vector was recovered and purified; homologous recombination primers pOCA30- CsFTL3 -F ( CsFTL3 -F ( CTCTCGAGCTTTCGCGAGCTC ATGTCAGGGAGTTCTTCAAACCTT) and pOCA30-Cs FTL3 -R ( CTT GCATGCCTGCAGGTCGAC TTAAGTGAAGAATCTCCGACCACC) were designed according to the sequences of the double digestion sites, and the target fragments were recovered and purified. The linearized vector and the target fragments were subjected to homologous recombination using a seamless cloning kit (CloneExpress Ultra One Step Cloning Kit). After sequencing verification, the recombinant plasmid was named pOCA30- CsFTL3 , that is, the CsFTL3 gene was inserted into the pOCA30 plasmid.

[0055] 2. Transformation of Arabidopsis thaliana plants

[0056] 2.1 Agrobacterium transformation

[0057] Take out the competent cells of Agrobacterium tumefaciens GV3101 from the -80 °C refrigerator and place them on ice to dissolve. Add 200 ng of pOCA30- CsFTL3 plasmid, and let it stand on ice for 5 min, in liquid nitrogen for 5 min, in a 37 °C water bath for 5 min, and in an ice bath for 5 min in sequence. Then add 700 μL of LB culture medium without antibiotics in the ultra-clean workbench and pipette and mix well. Place it in a shaking incubator at 28 °C and 200 rpm for culture. After 1 - 2 h, centrifuge (5000 rpm, 3 min) to collect the bacteria. Remove the supernatant in the ultra-clean workbench. Resuspend the remaining about 100 μL of bacterial liquid by pipetting. Transfer 50 μL of the bacterial liquid and spread it on an LB solid medium plate containing 50 μg / mL Spec + 25 μg / mL Rif antibiotics, and culture it inverted in an incubator at 28 °C for 2 - 3 days.

[0058] Pick a round and growing monoclonal bacterium into an LB liquid medium containing 50 μg / mL Spec + 25 μg / mL Rif antibiotics, and culture it overnight (12 - 16 h) in a shaker at 28 °C and 200 rpm. Verify the positive bacteria by PCR. Pipette 1 mL of the verified bacterial liquid into 50 mL of LB liquid medium containing 50 μg / mL Spec + 25 μg / mL Rif antibiotics, and culture it overnight in a shaker at 28 °C and 200 rpm until the OD value of the bacterial liquid reaches 1.0. Centrifuge the bacterial liquid at 5000 rpm for 5 min to collect the bacteria, and pour out the supernatant. Oscillate and mix the bacterial mass with a 5% sucrose solution, resuspend the suspension until the OD value is 0.4 - 0.6, add 0.15% acetosyringone (AS), let it stand in the dark for 2 - 3 h to activate the bacteria, and finally add 0.015% Silwet-77 to prepare for infection.

[0059] 2.2 Transformation of wild-type Arabidopsis thaliana by floral dip method

[0060] One day before infection, cut off the siliques and open flowers on the plant and water the plant thoroughly. Immerse the inflorescence of Arabidopsis thaliana in the resuspended bacterial liquid of Agrobacterium tumefaciens obtained in step 2.1 for 10 - 15 s to ensure that the bacterial liquid fully covers the surface of the inflorescence. Then place the infected plant in an environment at 23 - 25 °C and high humidity and keep it in the dark for more than 16 h. Subsequently, place the plant back into the growth chamber for normal cultivation. Repeat the infection once a week thereafter, for a total of 3 times, to improve the transformation efficiency.

[0061] 2.3 Resistance screening of transgenic Arabidopsis thaliana

[0062] The T0 generation seeds harvested after 3 infections were planted and harvested to obtain T1 generation Arabidopsis thaliana seeds. The harvested T1 generation Arabidopsis thaliana seeds were sown on 1 / 2 MS medium containing 50 μg / mL Kan resistance, refrigerated at 4 °C for 2 d, transferred to an artificial climate chamber for 10 d and then transplanted. Arabidopsis thaliana with green leaves and normal roots on the medium was selected (in the medium containing Kan antibiotic, only positive plants would show green leaves, while false positive plants had yellow leaves) and transplanted into the substrate for cultivation, and planted together with wild-type Arabidopsis thaliana, and cultured in a climate chamber under long-day conditions at 22 °C.

[0063] 3. Phenotypic analysis of transgenic Arabidopsis thaliana

[0064] DNA was extracted from the leaves of transgenic plants, and PCR reactions were carried out using primers pOCA30-F (TTGGAGAGGACACGCTGAAA) and pOCA30- CsFTL3 -R, and wild-type Arabidopsis thaliana WT was used as a negative control. The PCR products were subjected to agarose gel electrophoresis, and samples with corresponding size bands were identified as positive plants, indicating that the target DNA fragment had been successfully inserted into the plant genome ( Figure 5 ). Each positive plant was separately harvested and planted to the T3 generation to obtain a stable phenotype. Three transgenic positive lines (Line2, Line3, Line4) were selected to count phenotypic traits. The flowering time was counted with the time from the start of plant transplantation to when the bolting was 1 cm as the flowering date, the number of rosette leaves was counted at the time of recording the flowering period, and other phenotypes were also counted.

[0065] The research results found that the flowering time of transgenic Arabidopsis thaliana plants overexpressing CsFTL3 gene was about 35 days later than that of the wild type on average, and the number of rosette leaves increased by about 21 ( Figure 6 ). In addition, all transgenic lines showed characteristics such as darker leaf color, thicker and longer flower stems, and fewer flower stem numbers.

[0066] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited by the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications made without departing from the spirit and principle of the present invention shall be equivalent replacement methods and are all included in the protection scope of the present invention.

Claims

1. Cymbidium flowering regulatory protein CsFTL3, characterized by: Its amino acid sequence is shown in SEQ ID NO:

2.

2. A Cymbidium flowering regulation gene encoding the Cymbidium flowering regulation protein CsFTL3 described in claim 1 FTL3 .

3. The flowering regulating gene of Cymbidium sinense according to claim 2 FTL3 , characterized in that: The nucleotide sequence is shown in SEQ ID NO:

1.

4. The biological material related to the flowering regulatory protein CsFTL3 of Cymbidium sinense according to claim 1, characterized in that: Any one or more combinations of the following biological materials: (1) Containing the gene according to claim 2 or 3 FTL3 expression cassette; (2) Containing the gene according to claim 2 or 3 FTL3 A recombinant expression vector; (3) a recombinant expression vector containing the expression cassette described in (1); (4) Containing the gene according to claim 2 or 3 FTL3 Recombinant bacteria; (5) A recombinant bacterium containing the expression cassette described in (1); (6) A recombinant bacterium containing the recombinant expression vector described in (2) or (3).

5. The flowering regulatory protein CsFTL3 of Cymbidium indica according to claim 1, and the flowering regulatory gene of Cymbidium indica according to any one of claims 2 to 3 FTL3 Or the use of the biomaterial according to claim 4, characterized in that: The application is at least one of the following applications: Overexpression in plants FTL3 After the gene is added, the flowering time of the plant is delayed, the number of rosette leaves is increased, the leaf color of the plant is deepened, the flower stems are thickened, the flower stems are longer, the number of flower stems is reduced, and the growth period is extended; The plants are Arabidopsis thaliana and Cymbidium sinense.

6. A method for delaying flowering of a plant and / or increasing the number of rosette leaves, and / or extending the vegetative growth phase of a plant, characterized in that: The steps include: The flowering regulating gene of Cymbidium sinense according to claim 2 or 3 FTL3 Transformed into plant cells, tissues or organs, and then cultivated into plants, so that the FTL3 Genes are expressed in plants to delay flowering time and / or increase the number of rosette leaves, and / or extend the vegetative growth phase of the plant; The plants are Arabidopsis thaliana and Cymbidium sinense.

7. The method according to claim 6, characterized in that: The transformation method includes the inflorescence infection method.

Images