Nucleic acid detection system based on constant-temperature nucleic acid amplification and CRISPR and application

Abstract

The invention provides a nucleic acid detection system based on constant temperature nucleic acid amplification and CRISPR (clustered regularly interspaced short palindromic repeats) and application. According to the invention, a group of universal RPA primer sequences aiming at methylated and normal Septin9 target genes are firstly screened out, so that amplification of BCmSeptin9 and BCSeptin9 can be effectively realized; meanwhile, the two kinds of CRISPR (clustered regularly interspaced short palindromic repeats) sgRNAs (mSeptin9-sgRNA / Septin9-sgRNA) used by the detection system can be used for detecting target genes. According to the mSeptin9 and / or Septin9 one-tube two-step CRISPR nucleic acid detection system constructed from the two aspects, the detection time is 30 min, Septin9 methylation trace detection under the background of high wild type genes is achieved, and the detection rapidness and sensitivity of the system are improved.

Description

Technical Field

[0001] The present invention belongs to the field of medical biological detection technology, and relates to the detection of mSeptin9 and / or Septin9, and specifically uses constant temperature nucleic acid amplification and CRISPR combination to detect mSeptin9 and / or Septin9. It relates to a primer composition for RPA amplification, an RPA detection kit containing the primer composition, a CRISPR guide RNA and a CRISPR detection system, an RPA-CRISPR nucleic acid detection system, and provides a corresponding detection method. Background Art

[0002] The relationship between Septin9 and malignant tumors has become a research hotspot, and it is abnormally expressed in many malignant tumors. The importance of Septin9 as an early screening marker for malignant tumors has been emphasized by the development of methylated Septin9 (mSeptin9) detection technology in the blood of colorectal cancer patients. These studies suggest that the Septin9 gene and its methylation may play an important role in the development of malignant tumors and may become a new target for personalized anticancer treatment.

[0003] The Septin9 gene is located on chromosome 17q25.3. The Septin family is a group of highly conserved GTP-binding proteins that are widely present in human cells and provide structural support during cell division. The detection target of the CRC early diagnosis kit is the SEPT-V2 region. Abnormally methylated Septin9 genes are not only present in colorectal cancer tissues and peripheral blood of patients, but are also closely related to breast cancer, ovarian cancer, leukemia and lymphoma. Grutzmann et al. conducted a systematic study on the methylation levels of the Septin9 gene in the plasma of patients with various tumors and non-tumor diseases, and found that the detection rate of Septin9 methylation in the plasma of CRC patients was much higher than that of patients with non-colorectal cancer tumors, patients with non-tumor diseases and normal people, indicating that plasma Septin9 methylation has a high sensitivity and specificity for detecting CRC, and has significant differences from patients with non-colorectal cancer tumors, patients with non-tumor diseases and normal people, which provides a clinical basis for Septin9 methylation as a specific diagnostic marker for CRC.

[0004] Although Septin9 methylation can be used as an effective biomarker for early screening of CRC, the proportion of abnormal methylation of Septin9 is extremely low compared with wild-type genes with normal methylation, usually only 0.01% to 10% depending on the tumor stage. Therefore, the biggest challenge in Septin9 methylation detection is how to detect trace abnormal methylation genes in the context of high wild-type genes.

[0005] CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) was originally discovered from the natural immune system of bacteria. By targeting specific gene sequences, it can accurately edit and modify the genome and is widely used in the field of gene editing. As researchers continue to deepen their research on CRISPR technology, they have discovered that type V and type VI Cas proteins have trans-cleavage activity, which can be applied to the field of nucleic acid detection, and have developed corresponding CRISPR nucleic acid detection systems, the most representative of which are SHERLOCK developed by Dr. Zhang Feng's team and HOLMES developed by Dr. Wang Jin's team. The CRISPR nucleic acid detection system has high specificity and sensitivity and can be used to detect a variety of biological markers such as viruses, bacteria, and gene mutations. The system has broad application prospects in medical diagnosis, animal infectious disease detection, and food safety, and has attracted much attention due to its rapid detection, low equipment requirements, and flexible and diverse detection methods.

[0006] The CRISPR nucleic acid detection system first adopted a two-step CRISPR nucleic acid detection system. During this detection process, the nucleic acid template must first be amplified, and then the amplified product is added to the CRISPR nucleic acid detection system for detection. The two-step CRISPR nucleic acid detection fully utilizes the trans-cleavage activity of the Cas protein and has high sensitivity and high specificity, but there are problems such as a slightly cumbersome operation process and the amplification product opening and sample addition detection is prone to aerosol contamination. In order to improve the shortcomings of the two-step CRISPR nucleic acid detection, Dr. Wang Jin's team took the lead in developing a one-step CRISPR nucleic acid detection system HOLMESv2 based on isothermal amplification. This one-step CRISPR nucleic acid detection system completes isothermal amplification (such as LAMP) and CRISPR nucleic acid detection in a one-tube reaction system, which simplifies the operation process and avoids the risk of aerosol contamination caused by opening the amplification product during the two-step CRISPR nucleic acid detection process.

[0007] There are currently no studies or reports on the detection of mSeptin9 and / or Septin9 based on isothermal nucleic acid amplification and CRISPR combination. Summary of the invention

[0008] The present invention aims to establish a detection technology for mSeptin9 and / or Septin9 by utilizing constant temperature nucleic acid amplification and CRISPR technology, so as to realize the trace detection of Septin9 methylation in a high wild-type gene background and improve its detection speed and sensitivity.

[0009] In order to achieve the above object, the specific technical solution adopted by the present invention is as follows:

[0010] In a first aspect of the present invention, a guide RNA is provided, comprising a first guide RNA and / or a second guide RNA, wherein the sequences of the first guide RNA and the second guide RNA are shown in SEQ ID NO. 10 and SEQ ID NO. 11, respectively. The first guide RNA is used to implement CRISPR nucleic acid detection of mSeptin9, and the second guide RNA is used to implement CRISPR nucleic acid detection of Septin9.

[0011] Both guide RNAs use the trans-cleavage activity of VB-type Cas proteins for CRISPR nucleic acid detection. The first guide RNA is used to detect mSeptin9 CRISPR nucleic acid, preferably using a one-tube two-step CRISPR nucleic acid detection; the second guide RNA is used to detect Septin9 CRISPR nucleic acid, also preferably using a one-tube two-step CRISPR nucleic acid detection.

[0012] In a second aspect, the present invention provides a CRISPR nucleic acid detection system, comprising guide RNA, VB-type Cas protein, nuclease-free water, a trans-cleavage reporter molecule, and optionally a buffer.

[0013] In the present invention, CRISPR nucleic acid detection system is a general term, and "system" may refer to a composition, product combination, reagent, kit or system.

[0014] The guide RNA is as described above, including a first guide RNA and / or a second guide RNA. The first guide RNA sequence is shown in SEQ ID NO.10, including a direct repeat sequence capable of binding to a VB type Cas protein and a guide sequence capable of targeting BC_mSeptin9; the second RNA sequence is shown in SEQ ID NO.11, including a direct repeat sequence capable of binding to a VB type Cas protein and a guide sequence capable of targeting BC_Septin9. Among them, the sequence of BC_mSeptin9 is shown in SEQ ID NO.1, and the sequence of BC_Septin9 is shown in SEQ ID NO.2;

[0015] The trans-cleavage reporter molecule does not hybridize with the guide sequence of the guide RNA. It can be selected from a single-stranded nucleic acid reporter molecule, a single-stranded nucleic acid analog reporter molecule, or a single-stranded nucleic acid and nucleic acid analog reporter molecule. Preferably 5'

[0016] - / 6-FAM / TTTTTTTT / BHQ1 / -3';

[0017] The VB type Cas protein is a Cas12b protein, preferably AapCas12b, more preferably AapCas12b;

[0018] Both nuclease-free water and buffer are from the prior art. In a preferred embodiment, the buffer for the CRISPR nucleic acid detection portion is omitted.

[0019] In a third aspect, the present invention provides a primer composition for isothermal nucleic acid amplification of BC_mSeptin9 or BC_Septin9, wherein the nucleic acid sequences of the upstream primer and the downstream primer are shown in SEQ ID NO.4 and SEQ ID NO.5, respectively.

[0020] In a fourth aspect, the present invention provides a constant temperature nucleic acid amplification system for BC_mSeptin9 or BC_Septin9, comprising the above-mentioned primer composition, an activator, a nucleic acid amplification enzyme, dNTP and a buffer.

[0021] Similarly, the isothermal nucleic acid amplification system described in the present invention is also a general term, and "system" may refer to a composition, a product combination, a reagent, a kit or a system.

[0022] Preferably, the constant temperature nucleic acid amplification system is selected from the RPA / RAA / ERA / MIRA amplification system, which is used to amplify BC_mSeptin9 and / or BC_Septin9, or to detect mSeptin9 and / or Septin9.

[0023] In a fifth aspect, the present invention provides a one-tube two-step CRISPR nucleic acid detection system for mSeptin9 and / or Septin9, comprising the isothermal amplification reaction system and the CRISPR nucleic acid detection system described above.

[0024] Preferably, the isothermal nucleic acid amplification system is composed of the following:

[0025] RT-basic freeze-dried microspheres, 1 part;

[0026] Activator, 1 μL;

[0027] Sample to be tested, 5 μL;

[0028] Upstream primer, sequence as shown in SEQ ID NO.4, 10 μM, 1.5 μL;

[0029] Downstream primer, sequence as shown in SEQ ID NO.5, 10 μM, 1.5 μL;

[0030] Nuclease-free water, 19 μL,

[0031] The composition of the CRISPR nucleic acid detection system is as follows:

[0032] 10×TOLO Buffer1, 2 μL;

[0033] AapCas12b, 10 μM, 1 μL;

[0034] The first guide RNA, the sequence is shown in SEQ ID NO. 10, 10 μM, 1 μL;

[0035] trans -cleavage reporter 5′- / 6-FAM / TTTTTTTT / BHQ1 / -3′, 10 μM, 1 μL;

[0036] Nuclease-free water, 13 μL;

[0037] and / or

[0038] 10×TOLO Buffer1, 2 μL;

[0039] AapCas12b, 10 μM, 1 μL;

[0040] The second guide RNA, the sequence is shown in SEQ ID NO.11, 10 μM, 1 μL;

[0041] trans -cleavage reporter, 5′- / 6-FAM / TTTTTTTT / BHQ1 / -3′, 10 μM, 1 μL;

[0042] Nuclease-free water, 13 μL.

[0043] Preferably, the constant temperature nucleic acid amplification system and the CRISPR nucleic acid detection system are arranged in a reaction tube, the constant temperature nucleic acid amplification system is arranged in the tube body of the reaction tube, and the CRISPR nucleic acid detection system is arranged on the tube cover and is located on the side facing the tube body. Constant temperature nucleic acid amplification is first performed in the tube body, and then the CRISPR nucleic acid detection system in the tube cover is placed in the tube body for sequencing.

[0044] In a sixth aspect, the present invention provides a method for detecting mSeptin9 and / or Septin9 using a one-tube two-step CRISPR nucleic acid detection system, comprising the following steps: obtaining a sample to be tested by nucleic acid extraction, and converting the sample to be tested in advance when performing mSeptin9 detection; placing the sample to be tested into a tube body of a reaction tube and contacting it with a constant temperature nucleic acid amplification system for constant temperature nucleic acid amplification, and then allowing the CRISPR nucleic acid detection system to fall into the tube body of the reaction tube by centrifugation, inversion and / or shaking, measuring the change in the signal, and achieving nucleic acid detection.

[0045] Preferably, when the sample to be tested is transformed, cytosine in the non-methylated nucleic acid is converted into uracil while cytosine in the methylated nucleic acid remains unchanged, or cytosine in the methylated nucleic acid is converted into thymine while cytosine in the non-methylated nucleic acid remains unchanged;

[0046] Preferably, when performing constant temperature nucleic acid amplification, the final concentration of the primer is 550nM-650nM (preferably 600nM), the temperature of the nucleic acid amplification reaction is 37-42°C (preferably 37°C), and the time of the nucleic acid amplification reaction is 20-30min (preferably 25min);

[0047] Preferably, when performing nucleic acid detection, the final concentration of AapCas12b is 100-1100 nM; the final concentration of the trans-cleavage reporter molecule is 0.5-2.5 μM; the final concentration of the first guide RNA is 100-2200 nM, and the final concentration of the second guide RNA is 100-2200 nM; the detection temperature is 60-65°C (preferably 60°C).

[0048] The beneficial protection and effects of the present invention are as follows:

[0049] In terms of detection efficiency, the present invention first screened out a set of universal RPA primer sequences for methylated and normal Septin9 target genes, which can effectively achieve the amplification of BC_mSeptin9 and BC_Septin9; at the same time, the two CRISPR sgRNAs (mSeptin9-sgRNA / Septin9-sgRNA) used in this detection system can both detect the target genes. The mSeptin9 and / or Septin9 one-tube two-step CRISPR nucleic acid detection system constructed from these two aspects has a detection time of 30 minutes, has the characteristics of fast detection, convenient operation, etc., and also has high detection sensitivity.

[0050] In terms of detection conditions, RPA amplification no longer requires a thermal cycler. A large amount of amplification products can be obtained by reacting at a constant temperature of 37-40°C for 20 minutes. Detection can be achieved using a water bath or other device that can provide such constant temperature conditions. This not only reduces the cost of detection, but also avoids dependence on expensive instruments, which will help promote its application in clinical practice, especially in resource-poor areas.

[0051] In terms of accuracy, the CRISPR one-tube detection system does not require a second opening of the lid for sample addition, which not only avoids aerosol contamination, but also uses CRISPR technology to improve the specificity of isothermal amplification detection and avoid the risk of false positive results.

[0052] In terms of sensitivity, by linearly fitting the standard curve constructed by CRISPR detection fluorescence signal and methylation level, this detection system can quantitatively detect Septin9 methylation level with excellent sensitivity. BRIEF DESCRIPTION OF THE DRAWINGS

[0053] Figure 1 A schematic diagram of the mSeptin9 / Septin9 one-tube two-step CRISPR nucleic acid detection is shown.

[0054] Figure 2 The graph shows the primer screening results of the mSeptin9 / Septin9 one-tube two-step CRISPR nucleic acid detection system in Example 1 (template is 200 copies / test).

[0055] Figure 3 The graph shows the primer screening results of the mSeptin9 / Septin9 one-tube two-step CRISPR nucleic acid detection system in Example 1 (template is 100 copies / test).

[0056] Figure 4 The figure shows the results of the RPA primer concentration screening of the mSeptin9 / Septin9 one-tube two-step CRISPR nucleic acid detection system in Example 1.

[0057] Figure 5 The figure shows the RPA reaction temperature screening results of the mSeptin9 / Septin9 one-tube two-step CRISPR nucleic acid detection system in Example 1.

[0058] Figure 6 The figure shows the RPA amplification time screening results of the mSeptin9 / Septin9 one-tube two-step CRISPR nucleic acid detection system in Example 1.

[0059] Figure 7 The figure shows the results of the RPA sample loading screening of the mSeptin9 / Septin9 one-tube two-step CRISPR nucleic acid detection system in Example 1.

[0060] Figure 8 The figure shows the results of the sensitivity test of Septin9 detected by the mSeptin9 / Septin9 one-tube two-step CRISPR nucleic acid detection system in Example 1.

[0061] Fig. 9 The figure shows the results of the sensitivity test of mSeptin9 detected by the mSeptin9 / Septin9 one-tube two-step CRISPR nucleic acid detection system in Example 1.

[0062] Fig.10 The Septin9 detection limit analysis diagram of the mSeptin9 / Septin9 one-tube two-step CRISPR nucleic acid detection system in Example 1 is shown.

[0063] Fig.11 The Septin9 detection limit analysis diagram of the mSeptin9 / Septin9 one-tube two-step CRISPR nucleic acid detection system in Example 1 is shown.

[0064] Fig.12 The result analysis diagram of the mSeptin9 / Septin9 one-tube two-step CRISPR nucleic acid detection system quantitative test (mSeptin9) in Example 1 is shown.

[0065] Fig.13 The result analysis diagram of the mSeptin9 / Septin9 one-tube two-step CRISPR nucleic acid detection system quantitative test (mSeptin9) in Example 1 is shown. DETAILED DESCRIPTION

[0066] The implementation of the present invention is described in detail below in conjunction with the embodiments of the present invention. The following embodiments are implemented on the premise of the technical solution of the present invention, and provide detailed implementation methods and specific operating processes, but the protection scope of the present invention is not limited to the following embodiments.

[0067] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0068] 1. Terminology

[0069] The term "CRISPR" refers to Clustered regularly interspaced short palindromic repeats, which are derived from the immune system of microorganisms.

[0070] The term "CRISPR-Cas" refers to a unique genomic element derived from bacteria and archaea that acts as an adaptive immune defense system to defend against invading bacteriophages or foreign nucleic acids. The system consists of clustered regularly interspaced short palindromic repeats (CRISPR) and CRISPR-associated proteins (abbreviated as Cas proteins, Cas).

[0071] The term "Cas protein" refers to CRISPR-associated protein, which is a related protein in the CRISPR system. The "Cas protein" described herein refers to CRISPR-associated protein (some documents translate it as CRISPR-Cas effector protein, CRISPR / Cas effector protein, CRISPR-Cas effector, CRISPR / Cas effector), which can be a V-type Cas protein or a VI-type Cas protein. Once the V-type Cas protein binds to the cis-cleavage substrate under the guidance of the guide RNA to form a ternary complex of Cas protein-guide RNA-cis-cleavage substrate, it can induce its trans-cleavage activity, that is, random cleavage of single-stranded nucleic acids and their equivalents (nucleic acid equivalents such as nucleic acid analogs).

[0072] The Cas protein described in this specific embodiment is a protein with trans-cleavage activity. In particular, it is a Cas protein that is still active, especially trans-cleavage activity, at a temperature higher than the system temperature for isothermal amplification reaction.

[0073] The term "Cas12a" (formerly known as "Cpf1") is a crRNA-dependent endonuclease, which is a type VA enzyme in the CRISPR system classification.

[0074] The term "Cas12b" (formerly known as "C2c1") is a sgRNA-dependent endonuclease, which is a type VB enzyme in the CRISPR system classification.

[0075] The term "PAM" refers to the protospacer-adjacent motif, which is a short DNA sequence directly adjacent to the DNA sequence targeted by the CRISPR effector protein and is required for Cas12a or Cas12b to cut double-stranded DNA. For example, the PAM of Cas12a is TTTV, and the PAM of AacCas12b is the TTN sequence.

[0076] The term "target DNA or RNA molecule" refers to the DNA or RNA to be detected or a specific portion thereof when the molecule to be detected is a nucleic acid molecule; when the molecule to be detected is a non-nucleic acid molecule, the target DNA or RNA molecule is a pre-designed nucleic acid sequence.

[0077] The term "system" should be understood in a broad sense, and may refer to a composition, a product combination, a reagent, a kit, or an instrument containing the aforementioned composition, product combination, reagent, kit, or a mixture (system) formed when the composition, product combination, reagent, kit is used for detection, as well as an instrument containing the aforementioned mixture, etc.

[0078] The term "system temperature" refers to the temperature of a system (a mixture formed during detection), and the reaction temperature herein refers to the system temperature.

[0079] The term "one-tube two-step CRISPR nucleic acid test", abbreviated as "one-tube two-step method", also known as "one-tube two-step CRISPR test", "CRISPR one-tube two-step nucleic acid test", "CRISPR one-tube two-step nucleic acid test", "CRISPR one-tube two-step test", "CRISPR one-tube two-step method", refers to the nucleic acid amplification and CIRSPR nucleic acid detection carried out in steps in the same container.

[0080] The term "guide RNA" refers to mature crRNA fused with tracrRNA as a guide RNA, or mature crRNA fused with scoutRNA as a guide RNA, or crRNA alone as a guide RNA.

[0081] In general, the guide RNA may include direct repeat sequences (also known as DR sequences) and guide sequences, or may consist essentially of or consist of direct repeat sequences and guide sequences (also known as spacers in the context of endogenous CRISPR systems). In different CRISPR systems, gRNA may include crRNA and tracrRNA, or may include crRNA and scoutRNA, or may contain only crRNA, depending on the Cas protein on which it depends. crRNA and tracrRNA may be artificially modified and fused to form a single guide RNA (sgRNA). In some cases, the guide sequence is a polynucleotide sequence that has sufficient complementarity with the cis-cutting substrate DNA to hybridize with the cis-cutting substrate DNA and guide the CRISPR / Cas protein-guide RNA complex to specifically bind to the cis-cutting substrate DNA, typically having a sequence length of 15-28nt. The direct repeat sequence may be folded to form a specific structure (such as a stem-loop structure) for recognition by the Cas protein to form a complex. The guide sequence does not need to be 100% complementary to the cis-cutting substrate DNA. The guide sequence is not complementary to the nucleic acid in the trans-cleavage reporter molecule.

[0082] In certain embodiments, when optimally aligned, the degree of complementarity (match) between the guide sequence and its corresponding cis-cleaved substrate DNA is at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 99%. Determining optimal alignment is within the capabilities of one of ordinary skill in the art. For example, there are publicly available and commercially available alignment algorithms and programs, such as, but not limited to, ClustalW, Smith-Waterman in matlab, Bowtie, Geneious, Biopython, and SeqMan.

[0083] The terms "polynucleotide", "nucleotide sequence", "nucleic acid sequence", "nucleic acid molecule" and "nucleic acid" are used interchangeably and include DNA, RNA or hybrids thereof, which may be double-stranded or single-stranded.

[0084] The term "nucleic acid analogs" refers to a class of derivatives of RNA and DNA. Nucleic acids are mainly composed of phosphate, pentose and bases, while nucleic acid analogs replace at least one of them with some other substances. The main nucleic acid analogs include peptide nucleic acid (PNA), morpholino (MNA), bridged nucleic acid (BNA), locked nucleic acid (LNA), glycol nucleic acid (GNA) and threose nucleic acid (TNA). Some of these nucleic acid analogs can even carry out biological processes such as replication and translation in vitro (Brudno, Yevgeny; Birnbaum, Michael E; Kleiner, Ralph E; Liu, David R. "An in vitro translation, selection and amplification system for peptide nucleic acids". Nature Chemical Biology. 6(2): 148–155. doi: 10.1038 / nchembio.280.PMC2808706. PMID 20081830).

[0085] The terms "homology" or "identity" are used to refer to the matching of sequences between two polypeptides or between two nucleic acids. When a position in the two sequences being compared is occupied by the same base or amino acid monomer subunit (e.g., a position in each of the two DNA molecules is occupied by adenine, or a position in each of the two polypeptides is occupied by lysine), then the molecules are identical at that position between the two sequences. Typically, the comparison is made when the two sequences are aligned to produce maximum identity. Such comparison can be by using, for example, the identity of amino acid sequence can be determined by conventional methods, with reference to, for example, Smith and Waterman, 1981, Adv. Appl. Math. 2: 482 Pearson & Lipman, 1988, Pro. Natl. Acad. Sci. USA 85: 244, Thompson et al., 1994, Nucleic Acids Res 22: 467 380, etc., by computerized operation algorithm (GAP, BESTFIT, FASTA, and TFASTA, Genetics Computer Group in Wisconsin Genetics Software Package). It can also be determined using the BLAST algorithm available from the National Center for Biotechnology Information (NCBI www.ncbi.nlm.nih.gov / ) using default parameters.

[0086] The term "RPA" refers to Recombinase Polymerase Amplification (RPA); the term "RAA" refers to Recombinase Aided Amplification (RAA); the term "ERA" refers to Enzymatic Recombinase Amplification (ERA). The term "MIRA" refers to Multienzyme Isothermal Rapid Amplification (MIRA), which is a constant temperature rapid nucleic acid amplification technology that relies on the synergistic action of multiple functional proteins (helicase, recombinase, single-strand binding protein, DNA polymerase, etc.) to achieve rapid nucleic acid amplification at room temperature. Compared with other isothermal amplification technologies, these four isothermal amplification technologies have the advantages of milder reaction conditions and simpler primer design, and the detection principles are similar.

[0087] 2. Detection Principle

[0088] See also Figure 1The method for detecting mSeptin9 and / or Septin9 provided by the present invention comprises the following steps: a) obtaining a sample to be tested by nucleic acid extraction, placing the sample to be tested into a tube body of a reaction tube and contacting it with a constant temperature nucleic acid amplification system for constant temperature nucleic acid amplification; b) then contacting it with a CRISPR nucleic acid detection system, measuring the change of the signal, and realizing nucleic acid detection.

[0089] Preferably, when detecting mSeptin9, the sample to be tested is also transformed so that the cytosine in the non-methylated nucleic acid is converted into uracil while the cytosine in the methylated nucleic acid remains unchanged (e.g. Figure 1 ), or converting cytosine in methylated nucleic acids to thymine instead of leaving cytosine in methylated nucleic acids unchanged ( Figure 1 (not shown); the nucleic acid conversion composition / product combination / reagent / kit / system / system used in the conversion is a chemical nucleic acid conversion composition / product combination / reagent / kit / system / system; more preferably, the chemical nucleic acid conversion composition / product combination / reagent / kit / system / system includes hydrazine salt, bisulfite, bisulfite or pyrosulfite; or, the nucleic acid conversion composition / product combination / reagent / kit / system / system used in the conversion is an enzymatic nucleic acid conversion composition / product combination / reagent / kit / system / system; more preferably, the enzymatic method is TAPS enzyme conversion method, DM-seq enzyme conversion method or EM-seq enzyme conversion method. Conversion is a prior art and will not be described in detail.

[0090] Preferably, in step a), in the same container, the sample to be tested first contacts the part of the system for RPA / RAA / ERA / MIRA nucleic acid amplification, and then contacts the part for CRISPR nucleic acid detection.

[0091] Furthermore, the container is a reaction tube, the sample to be tested and the part for RPA / RAA / ERA / MIRA nucleic acid amplification in the system are arranged in the tube body of the reaction tube, the part for CRISPR nucleic acid detection is arranged on the tube cover of the reaction tube and is located on the side facing the tube body of the reaction tube, and after the sample to be tested contacts the part for RPA / RAA / ERA / MIRA nucleic acid amplification, the part for CRISPR nucleic acid detection falls into the tube body of the reaction tube by centrifugation, inversion and / or shaking, thereby achieving contact between the sample to be tested and the part for CRISPR nucleic acid detection.

[0092] Further, in step a), the part used for RPA / RAA / ERA / MIRA nucleic acid amplification forms the following system:

[0093] RT-basic lyophilized microspheres from XtremeGene, 1 part;

[0094] Activator of the first gene, 1 μL;

[0095] Sample to be tested, 2 μL;

[0096] F primer, sequence as shown in SEQ ID NO.4, 10 μM, 1.5 μL;

[0097] R primer, sequence as shown in SEQ ID NO.5, 10 μM, 1.5 μL;

[0098] Nuclease-free water, 19 μL.

[0099] Preferably, the F primer and the R primer are universal primers of RPA / RAA / ERA / MIRA, which are used to amplify BC_mSeptin9 (SEQ ID NO.1) and / or BC_Septin9 (SEQ ID NO.2), or to detect mSeptin9 and / or Septin9.

[0100] Other components in the system can be obtained from existing technologies. Therefore, RPA / RAA / ERA / MIRA primers can form products independently, or form compositions, product combinations, reagents, kits, systems or systems with other components.

[0101] In step b), the part used for CRISPR nucleic acid detection uses the reagent of Tolo Biotechnology to form the following system:

[0102] 10×TOLO Buffer1, 2 μL;

[0103] AapCas12b, 10 μM, 1 μL;

[0104] A first guide RNA, the sequence of which is shown in SEQ ID NO. 10, 10 μM, 1 μL;

[0105] trans-cleavage reporter, the trans-cleavage reporter is 5'- / 6-FAM / TTTTTTTT / BHQ1 / -3', 10 μM, 1 μL;

[0106] Nuclease-free water, 13 μL;

[0107] and / or

[0108] 10×TOLO Buffer1, 2 μL;

[0109] AapCas12b, 10 μM, 1 μL;

[0110] The second guide RNA, the second RNA sequence is shown in SEQ ID NO.11, 10 μM, 1 μL;

[0111] trans-cleavage reporter, the trans-cleavage reporter is 5'- / 6-FAM / TTTTTTTT / BHQ1 / -3', 10 μM, 1 μL;

[0112] Nuclease-free water, 13 μL.

[0113] Preferably, (1) the VB type Cas protein is Cas12b. The source of the Cas12b is selected from the following group: Alicyclobacillus acidiphilus, Alicyclobacillus kaegawensis, Alicyclobacillus macrosporangiidus, Bacillus sp. V3-13, Bacillus hisashii, Bacillus, Lentisphaeriabacterium, Desulfovibrio inopinatus, Laceyella sediminis, Spirochaetes bacterium, Tuberibacillus calidus or a combination thereof.

[0114] In another preferred embodiment, the Cas12b is selected from the following group: from Bacillus acidophilus

[0115] Cas12b from Alicyclobacillus acidiphilus (AaCas12b), Cas12b from Alicyclobacillus kakegawensis (AkCas12b), Cas12b from Alicyclobacillus macrosporangiidus (AmCas12b), Cas12b from Bacillus hisashii (BhCas12b), BsCas12b from Bacillus, Cas12b from Bacillus sp. V3-13 (Bs3Cas12b), Cas12b from Desulfovibrio inopinatus), Cas12b from Laceyella sedimentinis (LsCas12b), Cas12b from Spirochaetes bacterium (SbCas12b), and Cas12b from Tuberibacillus calidus (TcCas12b).

[0116] In another preferred embodiment, the Cas12b is selected from the following group: AapCas12b, AacCas12b, AaCas12b, BthCas12b, AkCas12b, AmCas12b, BsCas12b, Bs3Cas12b, LsCas12b, BvCas12b, BrCas12b, EbCas12b or a combination thereof.

[0117] (2) Both guide RNAs use the trans-cleavage activity of VB-type Cas proteins for CRISPR nucleic acid detection. The first guide RNA is used to detect mSeptin9 CRISPR nucleic acid, preferably using a one-tube two-step CRISPR nucleic acid detection method; the second guide RNA is used to detect Septin9 CRISPR nucleic acid, and preferably using a one-tube two-step CRISPR nucleic acid detection method.

[0118] (3) The above-mentioned isothermal amplification reaction system and CRISPR nucleic acid detection system together constitute the nucleic acid detection system of mSeptin9 and / or Septin9, and the trans-cleavage activity of VB-type Cas protein is used for nucleic acid detection. Preferably, the nucleic acid detection is a one-tube two-step CRISPR nucleic acid detection of mSeptin9 and / or Septin9.

[0119] As a product form, the VB-type Cas protein, the first guide RNA, the second guide RNA, the trans-cleavage reporter molecule, the RPA / RAA / ERA / MIRA primer, the RPA / RAA / ERA / MIRA nucleic acid amplification enzyme, dNTP, and the buffer for the RPA / RAA / ERA / MIRA nucleic acid amplification part can exist separately and then be combined, or can be combined in pairs and then combined, or can be combined together.

[0120] In the system or kit, the VB-type Cas protein, the first guide RNA, the second guide RNA, the trans-cleavage reporter molecule, the RPA / RAA / ERA / MIRA primer, the RPA / RAA / ERA / MIRA nucleic acid amplification enzyme, the dNTP, and the buffer for the RPA / RAA / ERA / MIRA nucleic acid amplification part can be separately contained in eight containers, or in two containers (one container each for the RPA / RAA / ERA / MIRA nucleic acid amplification part and the CRISPR nucleic acid detection part) or in the same container.

[0121] Example 1

[0122] 1. Experimental Materials and Methods

[0123] 1.1 Experimental instruments

[0124] Table 1 Experimental instruments

[0125]

[0126]

[0127] 1.2 Experimental Reagents

[0128] Table 2 Experimental reagents

[0129]

[0130] 1.3 Experimental methods and results

[0131] 1.3.1. Septin9 detection target selection

[0132] Based on the references and related sequence analysis and comparison, BC_Septin9 was selected as the specific detection target for Septin9, and BC_mSeptin9 was selected as the specific detection target for methylated Septin9. According to the sequence comparison results, the above-mentioned specific conserved sequence regions were selected as the detection regions, and the constructed plasmids were named pUC57-BC_mSeptin9 and pUC57-BC_Septin9.

[0133] (1) Synthesis of pUC57 - BC_mSeptin9 plasmid

[0134] The BC_mSeptin9 sequence (SEQ ID NO.1) is as follows.

[0135] ATTTAGTTGAGTTAGGGGGTTTAGGGGTTTTTTCGGCGGTTAGTTTTGTATTGTAGGAGCGCGGGCGCGGCGTTTTAGTTAGCGCGTAGGGTTCGGGTTTCGTCGGGGGCGTTTTTTCGTCGTTGTTTTTCGCGCGATTCGTTGTTTATTAGTTATTATGTCGGATTTCGCGGTTAACGCGTAGTTGGATGGGATTATTTCGGATTTCGAAGGTGGGTGTTGGGTTGGTTGTTGCGGTCGCGGACGTGTTGGAGAGGATTTTGCGGGTGGGTTTGGCGCGGGACGGGGGTGCGTTGAGGGGAGACGGGAGTGCGTTGAGGGGAGACGGGATTTTTAATTTAGGCGTTTTTTCGTTGAGAGCGTCGCGCGTTTTCGGTTTCGTGTTCGCGTCGTTTACGTGGGGGATTTTGTTAGGGGTATTCGCGTAGATTTTGCGCGTTTTTATAGGATTTTGTGTTCGTTTTGCGTATTGTCGTTTGGGTTTTTTTTTTTTTATTGTTGTTTGTGTTT.

[0136] pUC57: 2710bp + 510bp = 3220bp

[0137] Average plasmid concentration diluted with 100 μL TE: 59 ng / μL.

[0138] Calculated concentration: 1.70×10 10 copies / μL.

[0139] Concentration calculated by dPCR: 224.88×4×10 7 copies / μL = 9.0×10 9 copies / μL

[0140] (2) Synthesis of pUC57 - BC_Septin9 plasmid

[0141] The BC_Septin9 sequence (SEQ ID NO.2) is as follows.

[0142] ATTTAGTTGAGTTAGGGGGTTTAGGGGTTTTTTTGGTGGTTAGTTTTGTATTGTAGGAGTGTGGGTGTGGTTTTAGTTAGTGTGTAGGGTTTGGGTTTTGTTGGGGGTGTTTTTTTGTTGTTGTT TTTTGTGTGATTTGTTGTTTATTAGTTATTATGTTGGATTTTGTGGTTAATGTGTAGTTGGATGGGATTATTTTGGATTTTGAAGGTGGGTGTGGGGTTGGTTGTTGTGGTTGTGGATGTGTTGGAGA GGATTTTGTGGGTGGGTTTGGTGGTGGGATGGGGGTGTGTTGAGGGGAGATGGGAGTGTGTTGAGGGGAGATGGGATTTTTAATTTAGGTGTTTTTTTGTTGAGAGTGTGTGTGTTTTTGGTTTTGT GTTTGTGTTGTTTATGTGGGGGATTTTGTTAGGGGTATTTGTGTAGATTTTGTGTGTTTTTATAGGATTTTGTGTTTGTTTTGTGTATTGTTGTTTGGGTTTTTTTTTTTATTGTTGTTTGTGTTT

[0143] pUC57: 2710 bp + 510 bp = 3220 bp

[0144] The average plasmid concentration in 100 μL TE dilution is 25 ng / μL.

[0145] The calculated concentration is: 7.19×10 9 copies / μL.

[0146] The concentration calculated by dPCR was 218.13 × 4 × 10 7 copies / μL=8.73×10 9 copies / μL

[0147] 1.3.2. Septin9 RPA Primer Design

[0148] RPA universal primers are designed based on the selected Septin9 specific conserved sequence region. The length of RPA primers is generally 30-35 bp, and other design requirements are similar to those of PCR primers. The Septin9 universal RPA primer design sequence is shown in Table 3.

[0149] Table 3 Septin9 RPA primers

[0150] Primer name Sequence (5'-3') Sequence number S9-F1 ATTTAGTTGAGTTAGGGGGTTTAGGGGTTT SEQ ID NO.3 S9-F2 TTTTYGGYGGTTAGTTTTGTATTGTAGGAG SEQ ID NO.4 S9-R1 ACCRCAACAACCAACCCACACCCACCTTC SEQ ID NO.5 S9-R2 CCAAACCCACCCRCAAAATCCTCTCCAACAC SEQ ID NO.6 S9-R3 CCTAAATTAAAATCCCRTCTCCCCTCAAC SEQ ID NO.7 S9-R4 TCTACRCRAATACCCCTAACAAAATCCCCCAC SEQ ID NO.8 S9-R5 TACRCAAAACRAACACAAAATCCTATAAAAAC SEQ ID NO.9

[0151] 1.3.3 Septin9 sgRNA design

[0152] The corresponding Cas12b sgRNA was designed within the fragment range, and the sequences are shown in Table 4.

[0153] Table 4 Septin9 sgRNA sequence (the underlined sequence is the target sequence)

[0154]

[0155] 1.3.4. Establishment of Septin9 one-tube two-step CRISPR nucleic acid detection system

[0156] (1) Septin9 Cas12b sgRNA in vitro transcription and purification

[0157] The Cas12b High Yield sgRNA Synthesis and Purification Kit (Cat. No. 31904, ToloBio) of ToloBio was used to perform in vitro transcription and purification of Cas12b sgRNA. The specific process is as follows. Cas12b Sense Oligo, PCR Master premix, Transcript Max Reaction Buffer, NTP premix, Transcript Max Enzyme premix, DNaseⅠ Buffer, and DNaseⅠ are all provided by ToloBio's Cas12b High Yield sgRNA Synthesis and Purification Kit.

[0158] ① DNA transcription template preparation

[0159] After the annealing and extension reaction between Cas12b Sense Oligo and mSeptin9-sgRNA-R and Septin9-sgRNA-R primers is completed, it can be used as a transcription template.

[0160] Table 5mSeptin9-sgRNA-R and Septin9-sgRNA-R primer sequences

[0161]

[0162] a. Annealing and extension system preparation

[0163] Table 6 Annealing and extension system preparation

[0164]

[0165] b. PCR annealing extension program settings

[0166] Table 7 PCR annealing extension program settings

[0167]

[0168] ②Cas12b sgRNA in vitro transcription

[0169] a. Prepare the reaction system according to the order of reagents in Table 8.

[0170] Table 8 Reaction system

[0171]

[0172] b. Mix the above reagents thoroughly, then centrifuge briefly and incubate at 37°C for 2-4 hours for in vitro transcription. Prolonging the transcription time can increase the transcription yield. If the transcription product is used for one-tube two-step CRISPR nucleic acid detection, overnight transcription for 12-16 hours is recommended.

[0173] c. After the 37°C incubation, prepare 30 μL of DNase I reaction solution according to the table below and add it to 20 μL of in vitro transcription product to remove the DNA template in the transcription system.

[0174] Table 9 DNaseⅠ reaction solution

[0175]

[0176] DNaseⅠ reaction conditions: 37℃, 30min.

[0177] ③ Magnetic bead purification of Cas12b sgRNA transcription products

[0178] a. First, take the magnetic beads out of the 4°C refrigerator and place them at room temperature for about 30 minutes to allow the temperature to equilibrate to room temperature. Invert or vortex to mix the magnetic beads thoroughly, pipette 25 μL of magnetic beads and 50 μL of isopropanol into 50 μL of the sgRNA sample to be purified, and mix thoroughly by pipetting.

[0179] b. Incubate at room temperature for 5 minutes to allow the RNA to bind to the magnetic beads.

[0180] c. Place the sample on the magnetic rack for 5 minutes. After the solution becomes clear, carefully remove the supernatant.

[0181] d. Keep the sample on the magnetic rack, add 200 μL of freshly prepared 80% (v / v) ethanol to rinse the magnetic beads, incubate at room temperature for 30 seconds, and carefully remove the supernatant.

[0182] e. Repeat step 4 and rinse 2 times in total.

[0183] f. Keep the sample on the magnetic rack at all times and open the lid to air-dry the magnetic beads for 5 minutes.

[0184] g. Remove the sample from the magnetic rack, add 50 μL of nuclease-free water, mix thoroughly by pipetting, and let stand at room temperature for 5 minutes.

[0185] h. Place the sample on a magnetic stand for 5 minutes. After the solution is clarified, carefully transfer the supernatant to a new nuclease-free PCR tube to obtain the purified Cas12b sgRNA.

[0186] (2) Primer screening for Septin9 RPA reaction system

[0187] Prepare the RPA reaction system according to Table 10 below, flick the reaction system to mix evenly, centrifuge briefly to collect the reagent at the bottom of the tube, then add it to the basic reaction unit, gently flick the basic reaction unit to allow the lyophilized powder to fully dissolve evenly, then centrifuge briefly to collect the reagent at the bottom of the tube. Finally, open the reaction unit, add 5 μL template and 1 μL activator (provided with the RT-basic lyophilized microsphere kit of Xinda Gene) to each reaction unit, and immediately put it on the machine.

[0188] Table 10mSeptin9 / Septin9 one-tube two-step CRISPR nucleic acid detection-RPA reaction system

[0189] Reagent name Volume (μL) S9-F1 / 2 (10 μM) 1 S9-R1 / 2 / 3 / 4 / 5 (10 μM) 1 Nuclease-free water 17 Total 25

[0190] The reaction procedure was: constant temperature at 37°C and reaction time of 20 min.

[0191] The specific CRISPR reaction is shown in Table 11 below. Take 2 μL of the above reaction product and add it to the tube cap. The reaction tube is placed in a handheld centrifuge for short centrifugation to collect the reagent at the bottom of the tube and then placed in a constant temperature device.

[0192] Table 11mSeptin9 / Septin9 one-tube two-step CRISPR nucleic acid detection system-CRISPR reaction system

[0193]

[0194] Among them, the T8-FQ probe is 5'- / 6-FAM / TTTTTTTT / BHQ1 / -3', the same below.

[0195] The reaction procedure is: constant temperature 60℃, FAM fluorescence channel signal is collected every 30s, and the reaction time is 10min. Figure 2 , Figure 3 .from Figure 2 It can be seen that the fluorescence signals of the primer combinations S9-F2 / S9-R1 and S9-F2 / S9-R3 are higher. The template concentration is reduced for further comparison. Finally, according to Figure 3 S9-F2 / S9-R1 was selected as the best amplification primer. In subsequent experiments, unless otherwise specified, the amplification primers were all S9-F2 / S9-R1.

[0196] 1.3.5. Optimization of mSeptin9 / Septin9 one-tube two-step CRISPR detection system

[0197] ①RPA amplification primer concentration screening

[0198] Optimize the primer concentration according to the Septin9 primers selected in Tables 10 and 11, and the primer concentration range is 300-600nM. Prepare the reaction system according to Tables 12 and 13, flick the RPA reaction system to mix it evenly, centrifuge it briefly to collect the reagent at the bottom of the tube, and then add it to the basic reaction unit. Gently flick the basic reaction unit to allow the lyophilized powder to fully dissolve evenly, and then centrifuge it briefly to collect the reagent at the bottom of the tube. Finally, open the reaction unit, add 5μL template and 1μL activator to each reaction unit, and immediately put it on the machine.

[0199] Table 12mSeptin9 / Septin9 one-tube two-step CRISPR nucleic acid detection-RPA reaction system

[0200] Reagent name Volume (μL) S9-F2 (10 μM) 0.75 / 1 / 1.25 / 1.5 S9-R1 (10 μM) 0.75 / 1 / 1.25 / 1.5 Nuclease-free water 17.5 / 17 / 16.5 / 16 Total 25

[0201] The reaction procedure was: constant temperature at 37°C and reaction time of 20 min.

[0202] The specific CRISPR reaction is shown in Table 13 below. Take 2 μL of the above reaction product and add it to the tube cap. The reaction tube is placed in a handheld centrifuge for short centrifugation to collect the reagent at the bottom of the tube and then placed in a constant temperature device.

[0203] Table 13mSeptin9 / Septin9 one-tube two-step CRISPR nucleic acid detection system-CRISPR reaction system

[0204] Reagent name Volume (μL) 10×TOLOBuffer1 2 Septin9-sgRNA / mSeptin9-sgRNA (10μM) 1 T8-FQ probe (10 μM) 1 AapCas12b (10 μM) 1 Nuclease-free water 13 Total 18

[0205] The reaction procedure was: constant temperature 60°C, FAM fluorescence channel signal was collected every 30 seconds, and the reaction time was 10 minutes. Figure 4 .

[0206] from Figure 4The results show that the optimal RPA primer concentration in the mSeptin9 / Septin9 one-tube two-step CRISPR nucleic acid detection system is 600nM. Overall, the detection signals of normal Septin9 and methylated Septin9 are higher at this concentration. Unless otherwise specified in subsequent experiments, the RPA primer concentration is 600nM.

[0207] ②RPA amplification temperature screening

[0208] According to the Septin9 primer concentration selected in Tables 10 and 11, the RPA reaction temperature in the mSeptin9 / Septin9 one-tube two-step CRISPR nucleic acid detection system is optimized, and the screening is performed according to 55-60°C and ΔT=1°C. Prepare the reaction system according to Tables 14 and 15, mix the RPA reaction system by hand, centrifuge briefly, and then add it to the basic reaction unit. Gently flick the basic reaction unit so that the lyophilized powder can be fully dissolved and evenly, and then centrifuge briefly to collect the liquid to the bottom of the tube. Finally, open the reaction unit, add 5μL template and 1μL activator to each reaction unit, and immediately put it on the machine.

[0209] Table 14 SmSeptin9 / Septin9 one-tube two-step CRISPR nucleic acid detection system-RPA reaction system

[0210] Reagent name Volume (μL) S9-F2 (10 μM) 1.5 S9-R1 (10 μM) 1.5 Nuclease-freewater 16 Total 25

[0211] The reaction procedure was: constant temperature 35 / 37 / 39 / 41°C, and reaction time 20 min.

[0212] The specific CRISPR reaction is shown in Table 15 below. Take 2 μL of the above reaction product and add it to the tube cap. Place the reaction tube in a handheld centrifuge for short centrifugation and then put it into a constant temperature device.

[0213] Table 15mSeptin9 / Septin9 one-tube two-step CRISPR nucleic acid detection system-CRISPR reaction system

[0214] Reagent name Volume (μL) 10×TOLOBuffer1 2 Septin9-sgRNA / mSeptin9-sgRNA (10μM) 1 T8-FQ probe (10 μM) 1 AapCas12b (10 μM) 1 Nuclease-free water 13 Total 18

[0215] The reaction procedure was as follows: constant temperature at 60°C, FAM fluorescence channel signal was collected every 30 seconds, and the reaction time was 10 minutes.

[0216] Results Figure 5 .from Figure 5 The results show that the optimal RPA reaction temperature in the mSeptin9 / Septin9 one-tube two-step CRISPR nucleic acid detection system is 37°C. Overall, the detection signals of normal Septin9 and methylated Septin9 are higher at this temperature. Unless otherwise specified in subsequent experiments, the RPA reaction temperature is 37°C.

[0217] ③RPA amplification time screening

[0218] The mSeptin9 / Septin9 one-tube two-step CRISPR nucleic acid detection system was prepared according to Tables 14 and 15, and the RPA amplification reaction time was 10-25min and ΔT=5min to screen the optimal amplification time. Figure 6 .from Figure 6 The results show that the optimal RPA amplification time in the mSeptin9 / Septin9 one-tube two-step CRISPR nucleic acid detection system is 25 minutes. Unless otherwise specified in subsequent experiments, the RPA amplification time is 25 minutes.

[0219] ④RPA sample volume screening

[0220] Prepare the mSeptin9 / Septin9 one-tube two-step CRISPR nucleic acid detection system according to Tables 16 and 17. Mix the RPA reaction system by hand, centrifuge briefly to collect the reagent at the bottom of the tube, and then add it to the basic reaction unit. Gently flick the basic reaction unit to allow the lyophilized powder to fully dissolve evenly, and then centrifuge briefly to collect the reagent at the bottom of the tube. Finally, open the reaction unit, add 2 / 3 / 4 / 5μL template and 1μL activator to each reaction unit, and immediately put it on the machine.

[0221] Table 16mSeptin9 / Septin9 one-tube two-step CRISPR nucleic acid detection system-RPA reaction system

[0222]

[0223]

[0224] The reaction procedure is: constant temperature at 37°C, reaction time is 25 min. The CRISPR reaction is specifically shown in Table 17 below. Take 2 μL of the above reaction product and add it to the tube cap. Place the reaction tube in a handheld centrifuge for a short centrifugation and then put it into a constant temperature device.

[0225] Table 17mSeptin9 / Septin9 one-tube two-step CRISPR nucleic acid detection system-CRISPR reaction system

[0226] Reagent name Volume (μL) 10×TOLOBuffer1 2 Septin9-sgRNA / mSeptin9-sgRNA (10μM) 1 T8-FQ probe (10 μM) 1 AapCas12b (10 μM) 1 Nuclease-free water 13 Total 18

[0227] The reaction procedure was: constant temperature 60°C, FAM fluorescence channel signal was collected every 30 seconds, and the reaction time was 10 minutes. Figure 7 .from Figure 7The results show that the optimal sample volume of the RPA system in the mSeptin9 / Septin9 one-tube two-step CRISPR nucleic acid detection system is 2 μL. In subsequent experiments, unless otherwise specified, the sample volume is 2 μL.

[0228] 1.3.6. Performance test of mSeptin9 / Septin9 one-tube two-step CRISPR nucleic acid detection system

[0229] ①mSeptin9 / Septin9 one-tube two-step CRISPR nucleic acid detection system sensitivity test

[0230] According to the optimized mSeptin9 / Septin9 one-tube two-step CRISPR nucleic acid detection system, the sensitivity test was performed, and the quantified pUC57-BC_Septin9 plasmid and pUC57-BC_mSeptin9 plasmid were tested according to the gradient concentration of 100 copies / test, 75 copies / test, 50 copies / test, 25 copies / test, 12.5 copies / test, and 6.25 copies / test. Each concentration was tested for 6 replicates. The mSeptin9 / Septin9 one-tube two-step CRISPR nucleic acid detection system is shown in Tables 18 and 19 below. According to Table 18, the reaction system was prepared, the above reaction system was manually flicked to mix, and the reagent was collected at the bottom of the tube by brief centrifugation, and then added to the basic reaction unit. The basic reaction unit was gently flicked to allow the lyophilized powder to be fully dissolved and evenly dissolved, and then the reagent was collected at the bottom of the tube by brief centrifugation. Finally, the reaction unit was opened, and 2 μL of template and 1 μL of activator were added to each reaction unit, and the machine was immediately put on.

[0231] Table 18mSeptin9 / Septin9 one-tube two-step CRISPR nucleic acid detection-RPA reaction system

[0232] Reagent name Volume (μL) S9-F2 (10 μM) 1.5 S9-R1 (10 μM) 1.5 Nuclease-free water 19 Total 25

[0233] The reaction procedure was: constant temperature at 37°C and reaction time of 20 min.

[0234] The specific CRISPR reaction is shown in Table 19 below. Take 2 μL of the above reaction product and add it to the tube cap. The reaction tube is placed in a handheld centrifuge for short centrifugation to collect the reagent at the bottom of the tube and then placed in a constant temperature device.

[0235] Table 19mSeptin9 / Septin9 one-tube two-step CRISPR nucleic acid detection system-CRISPR reaction system

[0236] Reagent name Volume (μL) 10×TOLOBuffer1 2 Septin9-sgRNA / mSeptin9-sgRNA (10μM) 1 T8-FQ probe (10 μM) 1 AapCas12b (10 μM) 1 Nuclease-free water 13 Total 18

[0237] The reaction procedure was as follows: constant temperature at 60°C, FAM fluorescence channel signal was collected every 30 seconds, and the reaction time was 10 minutes.

[0238] Results Figure 8 , Fig. 9 And the following table. Figure 8 , 9 It can be seen that the detection sensitivity results of the mSeptin9 / Septin9 one-tube two-step CRISPR nucleic acid detection system are shown in the following table.

[0239] Table 20mSeptin9 / Septin9 one-tube two-step CRISPR nucleic acid detection system detection sensitivity

[0240] Templates (copies / T) 100 75 50 25 12.5 6.25 Septin9 detection rate 6 / 6 6 / 6 6 / 6 6 / 6 5 / 6 3 / 6 mSeptin9 detection rate 6 / 6 6 / 6 6 / 6 6 / 6 5 / 6 1 / 6

[0241] from Fig.10 , 11 Analysis shows that the detection limit of Septin9 in the mSeptin9 / Septin9 one-tube two-step CRISPR nucleic acid detection system is 15.5 copies / test, and the detection limit of mSeptin9 is 14.7 copies / test.

[0242] ②mSeptin9 / Septin9 one-tube two-step CRISPR nucleic acid detection system quantitative test

[0243] The quantified pUC57-BC_Septin9 plasmid and pUC57-BC_mSeptin9 plasmid were diluted and mixed according to four different ratios of 100%, 50%, 25%, and 0% to obtain different degrees of methylation standards. The standard curve was constructed according to the fluorescence signal and the methylation level. The mSeptin9 / Septin9 one-tube two-step CRISPR nucleic acid detection system is shown in Tables 21 and 22 below. Prepare the reaction system according to Table 21, mix the above reaction system by hand, centrifuge briefly to collect the reagent at the bottom of the tube, and then add it to the basic reaction unit. Gently flick the basic reaction unit so that the lyophilized powder can be fully dissolved and evenly, and then centrifuge briefly to collect the reagent at the bottom of the tube. Finally, open the reaction unit, add 2μL template and 1μL activator to each reaction unit, and immediately put it on the machine.

[0244] Table 21mSeptin9 / Septin9CRISPR two-step method-RPA reaction system

[0245] Reagent name Volume (μL) S9-F2 (10 μM) 1.5 S9-R1 (10 μM) 1.5 Nuclease-free water 19 Total 25

[0246] The reaction procedure was: constant temperature at 37°C and reaction time of 20 min.

[0247] The specific CRISPR reaction is shown in Table 22 below. Take 2 μL of the above reaction product and add it to the tube cap. The reaction tube is placed in a handheld centrifuge for short centrifugation to collect the reagent at the bottom of the tube and then placed in a constant temperature device.

[0248] Table 22mSeptin9 / Septin9CRISPR two-step system-CRISPR reaction system

[0249] Reagent name Volume (μL) 10×TOLOBuffer1 2 Septin9-sgRNA / mSeptin9-sgRNA (10μM) 1 T8-FQ probe (10 μM) 1 AapCas12b (10 μM) 1 Nuclease-free water 13 Total 18

[0250] The reaction procedure is: constant temperature 60℃, FAM fluorescence channel signal is collected every 30s, and the reaction time is 10min. Fig.12 , Fig.13 By linearly fitting the standard curve constructed by CRISPR detection fluorescence signal and methylation level, this detection system can quantitatively detect the methylation level of Septin9.

[0251] The beneficial effects of this specific implementation are as follows:

[0252] 1. This experiment first screened out a set of universal RPA primer sequences for methylated and normal Septin9 target genes.

[0253] 2. Both CRISPR sgRNAs (mSeptin9-sgRNA / Septin9-sgRNA) used in this detection system can detect target genes with high specificity.

[0254] 3. Through CRISPR detection of RPA products, this detection system has a high detection sensitivity.

[0255] 4. By constructing a standard curve for linear fitting of the CRISPR detection fluorescence signal and the methylation level, this detection system can quantitatively detect the methylation level of Septin9.

[0256] 5. Establish a one-tube two-step CRISPR nucleic acid detection system for mSeptin9 and / or Septin9 with a detection time of 30 minutes. It has the characteristics of rapid detection, convenient operation, and high detection sensitivity.

[0257] 6. The CRISPR one-tube detection system does not require a second opening of the lid for sample addition, which not only avoids aerosol contamination, but also uses CRISPR technology to improve the specificity of isothermal amplification detection and avoid the risk of false positive results.

[0258] 7. The present invention does not require more professional equipment or more professional personnel to operate, and is suitable for promotion in areas with limited resources.

[0259] The embodiments of the present invention have been specifically described above, but the present invention is not limited to the embodiments. Those skilled in the art may make various equivalent modifications or substitutions without violating the spirit of the present invention. These equivalent modifications or substitutions are all included in the scope defined by the claims of this application.

Claims

1. A guide RNA, characterized in that It includes a first guide RNA and / or a second guide RNA, and the sequences of the first guide RNA and the second guide RNA are shown as SEQ ID NO.10 and SEQ ID NO.11, respectively.

2. A CRISPR nucleic acid detection system, characterized in that: Including the guide RNA of claim 1, the first guide RNA is used to achieve CRISPR nucleic acid detection of mSeptin9, and the second guide RNA is used to achieve CRISPR nucleic acid detection of Septin9.

3. The CRISPR nucleic acid detection system according to claim 2, characterized in that: Also includes: VB type Cas protein, nuclease-free water and a trans-cleavage reporter molecule, wherein the trans-cleavage reporter molecule does not hybridize with the guide sequence of the guide RNA, and optionally also includes a buffer.

4. A primer composition for isothermal nucleic acid amplification of mSeptin9 or Septin9, characterized in that: The nucleic acid sequences of the upstream primer and the downstream primer are shown in SEQ ID NO.4 and SEQ ID NO.5, respectively.

5. A constant temperature nucleic acid amplification system for mSeptin9 or Septin9, characterized in that: The primer composition according to claim 4 also includes an activator, a nucleic acid amplification enzyme, dNTPs and a buffer.

6. A one-tube two-step CRISPR nucleic acid detection system for mSeptin9 and / or Septin9, characterized in that: Including isothermal amplification reaction system and CRISPR nucleic acid detection system, Among them, the isothermal amplification reaction system is the constant temperature nucleic acid amplification system described in claim 5, and the CRISPR nucleic acid detection system is the CRISPR nucleic acid detection system described in claim 2 or 3.

7. The one-tube two-step CRISPR nucleic acid detection system for mSeptin9 and / or Septin9 according to claim 6, characterized in that: in, The composition of the constant temperature nucleic acid amplification system is as follows: RT-basic freeze-dried microspheres; Activator; Samples to be tested; Upstream primer, the sequence is shown in SEQ ID NO.4; Downstream primer, the sequence is shown in SEQ ID NO.5; Nuclease-free water, The composition of the CRISPR nucleic acid detection system is as follows: 10×TOLO Buffer1; AapCas12b, 10 μM; The first guide RNA, the sequence is shown in SEQ ID NO. 10, 10 μM; trans -cleavage reporter 5′- / 6-FAM / TTTTTTTT / BHQ1 / -3′, 10 μM; Nuclease-free water; and / or 10×TOLO Buffer1; AapCas12b, 10 μM; The second guide RNA, the sequence is shown in SEQ ID NO. 11, 10 μM; trans -cleavage reporter, 5′- / 6-FAM / TTTTTTTT / BHQ1 / -3′, 10 μM; Nuclease-free water.

8. The one-tube two-step CRISPR nucleic acid detection system for mSeptin9 and / or Septin9 according to claim 7, characterized in that: The constant temperature nucleic acid amplification system is arranged in the tube body of the reaction tube, and the CRISPR nucleic acid detection system is arranged on the tube cover of the reaction tube and is located on the side facing the tube body.

9. A method for detecting mSeptin9 and / or Septin9 using the one-tube two-step CRISPR nucleic acid detection system according to any one of claims 6 to 8, characterized in that: The steps include: The sample to be tested is obtained by nucleic acid extraction. When performing mSeptin9 detection, the sample to be tested is transformed in advance; the sample to be tested is placed in the body of a reaction tube and contacted with a constant temperature nucleic acid amplification system for constant temperature nucleic acid amplification, and then the CRISPR nucleic acid detection system is made to fall into the body of the reaction tube by centrifugation, inversion or oscillation to achieve nucleic acid detection.

10. The detection method according to claim 9, Features: Wherein, when the sample to be tested is transformed, cytosine of non-methylated nucleic acid is transformed into uracil while cytosine of methylated nucleic acid remains unchanged, or cytosine of methylated nucleic acid is transformed into thymine while cytosine of non-methylated nucleic acid remains unchanged; When performing constant temperature nucleic acid amplification, the final concentration of the primer is 550nM-650nM, the temperature of the nucleic acid amplification reaction is 37-42°C, and the time of the nucleic acid amplification reaction is 20-30min; When performing nucleic acid detection, the final concentration of AapCas12b is 100-1100 nM; the final concentration of the trans-cleavage reporter molecule is 0.5-2.5 μM; the final concentration of the first guide RNA is 100-2200 nM, and the final concentration of the second guide RNA is 100-2200 nM; the detection temperature is 60-65°C.

Images