Antisense nucleic acid targeting KRAS gene and pharmaceutical preparation and application thereof

Abstract

The invention provides antisense nucleic acid of a targeted KRAS gene as well as a pharmaceutical preparation and application of the antisense nucleic acid, and belongs to the technical field of biological medicines. The nucleotide sequence of the antisense nucleic acid provided by the invention is as shown in at least one of SEQ ID NO: 1 to SEQ ID NO: 7; the nucleotide sequence of the antisense nucleic acid further comprises a modified nucleotide sequence as shown in SEQ ID NO: 1 and a modified nucleotide sequence as shown in SEQ ID NO: 8. The antisense nucleic acid can target a 3 '-UTR region of mRNA of KRAS, down-regulate corresponding mRNA and various mutants of the mRNA and inhibit growth of tumor cells, a pharmaceutical preparation of the antisense nucleic acid can deliver the target antisense nucleic acid to a tumor site and exert a remarkable inhibition effect, and the antisense nucleic acid has huge application potential in the field of tumor gene therapy of KRAS mutation.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to an antisense nucleic acid targeting the KRAS gene and a pharmaceutical preparation and application thereof. Background Art

[0002] Gene therapy, that is, the treatment of diseases through nucleic acid drugs, has attracted people's attention in recent years. Nucleic acid drugs mainly include double-stranded small interfering RNA (siRNA), antisense oligonucleotides (ASOs), CRISPR / Cas9 single-stranded RNA and mRNA, aptamers, etc. Antisense nucleic acids are generally 13-30nt oligodeoxynucleotides, which can degrade target mRNA molecules through RNase mechanisms and other methods. They can be chemically synthesized, which is simple to synthesize and has great development prospects.

[0003] About 25% of human tumors have RAS mutations, of which KRAS mutations are the main type of mutations. However, due to the high GTP binding activity of the KRAS protein GTP binding pocket, it is difficult to develop specific inhibitors based on this pocket. In addition, the KRAS protein lacks other binding pockets on its surface, so the KRAS protein is also known as an "undruggable" target.

[0004] AZD4785 is an antisense nucleic acid developed by AstraZeneca targeting the 3'-UTR of KRAS mRNA. It adopts a gapmer modification strategy with three 2', 4'-bridged ethyl (cEt) groups at each end of the PS backbone, and reduces the immunogenicity of the nucleic acid through 5mC modification. Thanks to the high chemical stability brought by the cEt gapmer and the lipophilicity of PS, AZD4785 can be administered in vivo and in vitro without the use of a delivery vector. However, in the Phase 1 clinical trial (NCT03101839), a number of adverse reactions related to the intravenous injection of antisense nucleic acids occurred. Due to safety and in vivo efficacy issues, the development of AZD4785 has stagnated.

[0005] The toxicity problem that may be caused by high-dose naked administration of nucleic acids has not been resolved. How to achieve in vivo tumor treatment with antisense nucleic acids has become a technical challenge that needs to be urgently solved in this field. Summary of the invention

[0006] In view of this, an object of the present invention is to provide an antisense nucleic acid targeting the KRAS gene, wherein the antisense nucleic acid has the function of targeting the KRAS gene.

[0007] Another object of the present invention is to provide an antisense nucleic acid pharmaceutical preparation targeting the KRAS gene, wherein the antisense nucleic acid pharmaceutical preparation can silence the KRAS gene and has a significant inhibitory effect on tumor cells.

[0008] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0009] The present invention provides an antisense nucleic acid targeting the KRAS gene, wherein the nucleotide sequence of the antisense nucleic acid includes at least one of SEQ ID NO:1 to SEQ ID NO:7; the nucleotide sequence of the antisense nucleic acid also includes a modified nucleotide sequence of SEQ ID NO:1 and a modified nucleotide sequence of SEQ ID NO:8; the modification includes one or more modifications selected from the group consisting of 2'-O-methyl modification, 2'-O-methoxyethyl modification, 5-methylcytosine modification and phosphothioate modification.

[0010] The present invention also provides an antisense nucleic acid pharmaceutical preparation targeting the KRAS gene, wherein the antisense nucleic acid pharmaceutical preparation comprises the antisense nucleic acid, a nucleoside lipid material DNCA, and a cationic lipid material CLD.

[0011] Preferably, the molar ratio of the antisense nucleic acid, the nucleoside lipid material DNCA and the cationic lipid material CLD is 1:10-30:10-30.

[0012] Preferably, the antisense nucleic acid pharmaceutical preparation further comprises a surfactant.

[0013] More preferably, the surfactant comprises DSPE-PEG 2000 or DSPE-PEG 2000 -cRGD.

[0014] The present invention also provides a method for preparing the antisense nucleic acid pharmaceutical preparation, comprising the following steps: dissolving the nucleoside lipid material DNCA and the cationic lipid material CLD in anhydrous ethanol respectively to obtain the nucleoside lipid material DNCA anhydrous ethanol mother liquor and the cationic lipid material CLD anhydrous ethanol mother liquor for use, dissolving the antisense nucleic acid in enzyme-free water to obtain the antisense nucleic acid mother liquor for use; adding the nucleoside lipid material DNCA anhydrous ethanol mother liquor and the cationic lipid material CLD anhydrous ethanol mother liquor to the antisense nucleic acid mother liquor, and placing in 40-60°C water for ultrasonication for 15-30 minutes.

[0015] Preferably, the concentration of the antisense nucleic acid stock solution is 10 μM to 10 mM.

[0016] The present invention provides an application of the antisense nucleic acid or the antisense nucleic acid pharmaceutical preparation in the preparation of a KRAS gene targeting drug.

[0017] The present invention provides an application of the antisense nucleic acid or the antisense nucleic acid pharmaceutical preparation in preparing drugs for preventing and / or treating tumors.

[0018] Preferably, the tumor is pancreatic cancer, colon cancer, endometrial cancer or lung cancer caused by KRAS gene mutation.

[0019] Compared with the prior art, the present invention has the following beneficial effects:

[0020] The present invention provides a group of antisense nucleic acids, which can target the 3'-UTR region of KRAS mRNA and downregulate the corresponding mRNA and its various mutants, inhibiting tumor cell growth, and its pharmaceutical preparation can deliver the target antisense nucleic acid to the tumor site and exert a significant inhibitory effect. It has great application potential in the field of KRAS mutant tumor gene therapy. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 The in vitro proliferation inhibition activity of a series of antisense nucleic acids encapsulated by DNCA / CLD;

[0022] Figure 2 The silencing efficiency of KRAS gene by DNCA / CLD-encapsulated antisense nucleic acid series;

[0023] Figure 3 The growth curves of axillary tumors in the blank group, M4, D / C, D / C / M4 / 0.7% PEG, and D / C / M4 / 1% cRGD mice;

[0024] Figure 4 The blank group, M4, D / C, D / C / M4 / 0.7% PEG, D / C / M4 / 1% cRGD tumor site KRAS G12D mRNA silencing conditions;

[0025] Figure 5 Tumor images of the blank group, M4, D / C, D / C / M4 / 0.7%PEG, and D / C / M4 / 1%cRGD;

[0026] Figure 6 The tumor weights of the blank group, M4, D / C, D / C / M4 / 0.7%PEG, and D / C / M4 / 1%cRGD were counted;

[0027] Figure 7 These are the immunohistochemical sections of the blank group, M4, D / C, D / C / M4 / 0.7% PEG, and D / C / M4 / 1% cRGD groups. DETAILED DESCRIPTION

[0028] The present invention provides an antisense nucleic acid targeting the KRAS gene, wherein the nucleotide sequence of the antisense nucleic acid includes at least one of SEQ ID NO: 1 to SEQ ID NO: 7; the nucleotide sequence of the antisense nucleic acid also includes a modified nucleotide sequence of SEQ ID NO: 1 and a modified nucleotide sequence of SEQ ID NO: 8; the modification includes one or more modifications of 2'-O-methyl modification (2'-OMe), 2'-O-methoxyethyl modification (2'-O-MOE), 5-methylcytosine modification (5'-MeC) and phosphorothioate modification. The specific information of the nucleotide sequence of the antisense nucleic acid is shown in Table 1, wherein the nucleotide sequence of the antisense nucleic acid named O, S, M1, M2, M3, M4, M5, O1, O2, O3, O4 and O5 is obtained by modifying GCTATT AGGAGTCTTT (SEQ ID NO: 8) as the basic sequence; the nucleotide sequence of the antisense nucleic acid named K1-4 is obtained by modifying ACTGGGTCTGCCTTAA (SEQ ID NO: 1) as the basic sequence. Among them, the nucleotide sequence of sequence O is GmCTATTAGGAGTmCTTT, in which the fifth carbon element of the cytosine "C" at the 2nd and 13th positions is methylated to form 5-methylcytosine; the nucleotide sequence of sequence S is GsmCsTsAsTsTsAsGsGsAsGsTsmCsTsTsT, in which all phosphates are thiolated, and the fifth carbon element of the cytosine "C" at the 2nd and 13th positions is methylated to form 5-methylcytosine; the nucleotide sequence of sequence M1 is G moe smCsTsAsTsTsAsGsGs AsGsTsm CsTsTsT moe All phosphates in this sequence are thiolated, and the fifth carbon of the cytosine "C" at the 2nd and 13th positions is methylated to form 5-methylcytosine, and the hydrogen on the 2'-OH of the guanine "G" at the 1st position and the thymine "T" at the 16th position is replaced by a methoxyethyl group; the nucleotide sequence of sequence M2 is G moe S m moe sTs AsTsTs AsGsGs AsGsTsmCsTsT moe sT moe All phosphates in this sequence are thiolated, and the fifth carbon of the cytosine "C" at the 2nd and 13th positions is methylated to form 5-methylcytosine, and the hydrogen on the 2'-OH of the guanine "G" at the 1st position, the cytosine "C" at the 2nd position, and the thymine "T" at the 15th and 16th positions is replaced by a methoxyethyl group; the nucleotide sequence of sequence M3 is G moe S m moe sT moes AsTsTs AsGsGs AsGsTsmCsT moe sT moe sT moe All phosphates in this sequence are thiolated, and the fifth carbon of the cytosine "C" at the 2nd and 13th positions is methylated to form 5-methylcytosine, and the hydrogen on the 2'-OH of guanine "G" at the 1st position, cytosine "C" at the 2nd position, and thymine "T" at the 3rd, 14th, 15th and 16th positions is replaced by methoxyethyl; the nucleotide sequence of sequence M4 is G moe S m moe sT moe s A moe sTsTs AsGsGs AsGsTs mC moe sT moe sT moe sT moe All phosphates in the sequence are thiolated, and the fifth carbon of the cytosine "C" at the 2nd and 13th positions is methylated to form 5-methylcytosine, and the hydrogen on the 2'-OH of guanine "G" at the 1st position, cytosine "C" at the 2nd and 13th positions, adenine "A" at the 4th position, and thymine "T" at the 3rd, 14th, 15th and 16th positions is replaced by methoxyethyl; the nucleotide sequence of sequence M5 is G moe S m moe sT moe S moe sT moe sTs AsGsGs AsGsT moe mxD moe sT moe sT moe sT moe All phosphates in the sequence are thiolated, and the fifth carbon of the cytosine "C" at the 2nd and 13th positions is methylated to form 5-methylcytosine, and the hydrogen on the 2'-OH of guanine "G" at the 1st position, cytosine "C" at the 2nd and 13th positions, adenine "A" at the 4th position, and thymine "T" at the 3rd, 5th, 12th, 14th, 15th and 16th positions is replaced by methoxyethyl; the nucleotide sequence of sequence O1 is G ome smCsTsAsTsTsAsGsGsAsGsTsmCsTsTsT ome All phosphates in this sequence are thiolated, and the fifth carbon of the cytosine "C" at the 2nd and 13th positions is methylated to form 5-methylcytosine, and the hydrogen on the 2'-OH of the guanine "G" at the 1st position and the thymine "T" at the 16th position is replaced by a methyl group; the nucleotide sequence of sequence O2 is G ome S m omesTs AsTsTs AsGsGs AsGsTsmCsTsT ome sT ome All phosphates in this sequence are thiolated, and the fifth carbon of the cytosine "C" at the 2nd and 13th positions is methylated to form 5-methylcytosine, and the hydrogen on the 2'-OH of guanine "G" at the 1st position, cytosine "C" at the 2nd position, and thymine "T" at the 15th and 16th positions is replaced by a methyl group; the nucleotide sequence of sequence O3 is G ome S m ome sT ome s AsTsTsAsGsGs AsGsTs mCsT ome sT ome sT ome All phosphates in the sequence are thiolated, and the fifth carbon of the cytosine "C" at the 2nd and 13th positions is methylated to form 5-methylcytosine, and the hydrogen on the 2'-OH of guanine "G" at the 1st position, cytosine "C" at the 2nd position, and thymine "T" at the 3rd, 14th, 15th and 16th positions is replaced by a methyl group; the nucleotide sequence of sequence O4 is G ome S m ome sT ome s A ome sTsTs AsGsGs AsGsTs mC ome sT ome sT ome sT ome All phosphates in the sequence are thiolated, and the fifth carbon of the cytosine "C" at the 2nd and 13th positions is methylated to form 5-methylcytosine, and the hydrogen on the 2'-OH of guanine "G" at the 1st position, cytosine "C" at the 2nd and 13th positions, adenine "A" at the 4th position, and thymine "T" at the 3rd, 14th, 15th and 16th positions is replaced by a methyl group; the nucleotide sequence of sequence O5 is G ome S m ome sT ome S ome sT moe sTs AsGsGs AsGsT moe mxD moe sT moe sT moe sT moeAll phosphates in the sequence are thiolated, and the fifth carbon of the cytosine "C" at the 2nd and 13th positions is methylated to form 5-methylcytosine, and the hydrogen on the 2'-OH of guanine "G" at the 1st position, cytosine "C" at the 2nd and 13th positions, adenine "A" at the 4th position, and thymine "T" at the 3rd, 5th, 12th, 14th, 15th and 16th positions is replaced by a methyl group; the nucleotide sequence of sequence K1-4 is A moe S m moe sT moe s G moe sGsGsTsCsTs GsCsCs T moe sT moe S moe S moe All phosphates in the sequence are thiolated, and the fifth carbon element of cytosine "C" at position 2 is methylated to form 5-methylcytosine, and the hydrogen on the 2'-OH of adenine "A" at positions 1, 15 and 16, cytosine "C" at position 2, guanine "G" at position 4, and thymine "T" at positions 3, 13 and 14 is replaced by methoxyethyl.

[0029] The present invention also provides an antisense nucleic acid pharmaceutical preparation targeting the KRAS gene, wherein the antisense nucleic acid pharmaceutical preparation comprises the antisense nucleic acid, a nucleoside lipid material DNCA, and a cationic lipid material CLD. The structural formulas of the nucleoside lipid material DNCA and the cationic lipid material CLD are as follows:

[0030] For the structural information of the nucleoside lipid material DNCA and the cationic lipid material CLD, please refer to "Mol Pharm, 2014, 11(12): 4415-4424", "New J Chem, 2014, 38, 4952-4962" and "Biomaterials, 2018, 178: 147-157".

[0031] In the present invention, the molar ratio of the antisense nucleic acid, the nucleoside lipid material DNCA and the cationic lipid material CLD is preferably 1:10-30:10-30, more preferably 1:20:20.

[0032] In the present invention, the antisense nucleic acid pharmaceutical preparation further comprises a surfactant. In the present invention, the surfactant more preferably comprises DSPE-PEG 2000 or DSPE-PEG 2000-cRGD, the surfactant can be purchased from conventional commercial products. In the present invention, when the antisense nucleic acid pharmaceutical preparation contains a surfactant, the molar ratio of the antisense nucleic acid, the nucleoside lipid material DNCA, the cationic lipid material CLD and the surfactant is 1:0.1-0.5:10-30:10-30, more preferably 1:0.2-0.4:20:20, and further preferably 1:0.28:20:20 or 1:0.4:20:20.

[0033] The present invention also provides a method for preparing the antisense nucleic acid pharmaceutical preparation, comprising the following steps: dissolving the nucleoside lipid material DNCA and the cationic lipid material CLD in anhydrous ethanol to obtain the nucleoside lipid material DNCA anhydrous ethanol mother solution and the cationic lipid material CLD anhydrous ethanol mother solution for use, dissolving the antisense nucleic acid in enzyme-free water to obtain the antisense nucleic acid mother solution for use; adding the nucleoside lipid material DNCA anhydrous ethanol mother solution and the cationic lipid material CLD anhydrous ethanol mother solution to the antisense nucleic acid mother solution, placing in 40-60°C water for ultrasonication for 15-30 minutes. In the present invention, the ultrasonic condition is preferably placed in 50°C water for ultrasonication for 20 minutes. In the present invention, the concentration of the nucleoside lipid material DNCA anhydrous ethanol mother solution is preferably 5mM to 15mM, more preferably 10mM or 8 to 12mM; the concentration of the cationic lipid material CLD anhydrous ethanol mother solution is preferably 5mM to 15mM, more preferably 10mM or 8 to 12mM; the antisense nucleic acid mother solution is preferably 10μM to 10mM, more preferably 50μM or 2mM. In the present invention, those skilled in the art can synthesize the nucleoside lipid material DNCA and the cationic lipid material CLD by conventional means.

[0034] In the present invention, the preparation method of the antisense nucleic acid pharmaceutical preparation is more preferably as follows: dissolve the nucleoside lipid material DNCA and the cationic lipid material CLD in anhydrous ethanol to obtain the nucleoside lipid material DNCA anhydrous ethanol mother solution and the cationic lipid material CLD anhydrous ethanol mother solution for use, and dissolve the antisense nucleic acid in enzyme-free water to obtain the antisense nucleic acid mother solution for use; first add a certain volume of antisense nucleic acid mother solution to the bottom of the EP tube, then add half the volume of GenOpti, then add the nucleoside lipid material DNCA anhydrous ethanol mother solution and the cationic lipid material CLD anhydrous ethanol mother solution, add GenOpti to supplement the system, cover the EP tube, and place it in 50°C water for ultrasonication for 20 minutes. In the present invention, the GenOpti is a cell transfection optimization solution well known in the art, which can be purchased through conventional channels.

[0035] The present invention provides an application of the antisense nucleic acid or the antisense nucleic acid pharmaceutical preparation in the preparation of a KRAS gene targeting drug.

[0036] The present invention provides an application of the antisense nucleic acid or the antisense nucleic acid pharmaceutical preparation in the preparation of a drug for preventing and / or treating tumors. In the present invention, the tumor is preferably pancreatic cancer, colon cancer, endometrial cancer or lung cancer caused by KRAS gene mutation.

[0037] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0038] The experimental methods in the following examples are conventional methods unless otherwise specified. The experimental materials used in the following examples are commercially available products unless otherwise specified.

[0039] Example 1

[0040] A group of antisense nucleic acids targeting KRAS gene, the specific sequences of the antisense nucleic acids are shown in Table 1:

[0041] Table 1 Antisense nucleic acid modified sequences

[0042]

[0043]

[0044] Example 2

[0045] A group of antisense nucleic acid drug preparations targeting KRAS gene, the antisense nucleic acid drug preparations comprising the antisense nucleic acid in Example 1, a nucleoside lipid material DNCA, and a cationic lipid material CLD; the molar ratio of the antisense nucleic acid, the nucleoside lipid material DNCA, and the cationic lipid material CLD is 1:20:20.

[0046] The preparation method of the above antisense nucleic acid pharmaceutical preparation is as follows: the antisense nucleic acid dry powder of Example 1 is dissolved in enzyme-free water to obtain an antisense nucleic acid mother solution for use, and the nucleoside lipid material DNCA and the cationic lipid material CLD are respectively dissolved in anhydrous ethanol to obtain 10mM nucleoside lipid material DNCA anhydrous ethanol mother solution and 10mM cationic lipid material CLD anhydrous ethanol mother solution for use; first add a certain volume of antisense nucleic acid mother solution to the bottom of the EP tube, then add half the volume of GenOpti, and then add the nucleoside lipid material DNCA anhydrous ethanol mother solution and the cationic lipid material CLD anhydrous ethanol mother solution, add GenOpti to make up the system, cover the EP tube tightly, and place it in 50°C water for ultrasonication for 20 minutes.

[0047] Example 3

[0048] A group of antisense nucleic acid drug preparations targeting KRAS gene, the antisense nucleic acid drug preparations comprising the antisense nucleic acid in Example 1, a nucleoside lipid material DNCA, a cationic lipid material CLD, and a surfactant; the surfactant is DSPE-PEG 2000; The molar ratio of the antisense nucleic acid, nucleoside lipid material DNCA, cationic lipid material CLD, and surfactant is 1:20:20:0.28.

[0049] The preparation method of the antisense nucleic acid pharmaceutical preparation is as follows: the antisense nucleic acid dry powder of Example 1 is dissolved in enzyme-free water to obtain an antisense nucleic acid mother solution for use, and the nucleoside lipid material DNCA and the cationic lipid material CLD are respectively dissolved in anhydrous ethanol to obtain 10mM nucleoside lipid material DNCA anhydrous ethanol mother solution and 10mM cationic lipid material CLD anhydrous ethanol mother solution for use; first add a certain volume of antisense nucleic acid mother solution to the bottom of the EP tube, then add half the volume of GenOpti, and then add the nucleoside lipid material DNCA anhydrous ethanol mother solution, the cationic lipid material CLD anhydrous ethanol mother solution and the surfactant DSPE-PEG 2000 , add GenOpti supplement system, cover the EP tube tightly, and place it in 50℃ water for 20 minutes.

[0050] Example 4

[0051] A group of antisense nucleic acid drug preparations targeting KRAS gene, the antisense nucleic acid drug preparations comprising the antisense nucleic acid in Example 1, a nucleoside lipid material DNCA, a cationic lipid material CLD, and a surfactant; the surfactant is DSPE-PEG 2000 -cRGD; the molar ratio of the antisense nucleic acid, nucleoside lipid material DNCA, cationic lipid material CLD, and surfactant is 1:20:20:0.4.

[0052] The preparation method of the antisense nucleic acid pharmaceutical preparation is as follows: the antisense nucleic acid dry powder of Example 1 is dissolved in enzyme-free water to obtain an antisense nucleic acid mother solution for use, and the nucleoside lipid material DNCA and the cationic lipid material CLD are respectively dissolved in anhydrous ethanol to obtain 10mM nucleoside lipid material DNCA anhydrous ethanol mother solution and 10mM cationic lipid material CLD anhydrous ethanol mother solution for use; first add a certain volume of antisense nucleic acid mother solution to the bottom of the EP tube, then add half the volume of GenOpti, and then add the nucleoside lipid material DNCA anhydrous ethanol mother solution, the cationic lipid material CLD anhydrous ethanol mother solution and the surfactant DSPE-PEG 2000 -cRGD, add GenOpti supplement system, cover the EP tube tightly, and place it in 50℃ water for 20 minutes.

[0053] Example 5

[0054] This example studies the antisense nucleic acid pharmaceutical preparation prepared in Example 2 on the PANC-1 pancreatic cancer cell proliferation inhibition activity. The antisense nucleic acid pharmaceutical preparation is obtained according to the preparation method of Example 2. The specific ratios and experimental groups are shown in Table 2:

[0055] Table 2 Ratio relationship of antisense nucleic acid drug preparations and experimental groups

[0056]

[0057]

[0058] Experimental method: CCK-8 kit was used to test the cytotoxicity of each experimental group and the empty lipid material group: A549 cells were plated into 96-well plates at 12,000 cells / well and incubated in a cell culture incubator (37°C, 5% CO 2 ) for 24 hours, followed by administration (20 μL per well, wall-adherent administration or drop-administration). 48 hours after administration, the culture medium was aspirated, and 100 μL of culture medium containing 10% CCK-8 substrate (the culture medium was DMEM containing 10% FBS) was added to each well, and incubated for 0.5 hours in the dark at 37°C. The absorbance at 450 nm was detected using a multifunctional microplate reader (Spark), and the absorbance of the blank culture medium was corrected. The cell viability was calculated according to the following equation:

[0059] Cell survival rate = (R A -R E ) / (R B -R E )×100%, where R A , R B and R E Represent the absorbance of the experimental group, the group without transfection reagent and the blank control group, respectively.

[0060] Figure 1 The PANC-1 cell proliferation inhibitory activity of D / C / O, D / C / S, D / C / M1, D / C / M2, D / C / M3, D / C / M4, D / C / M5, D / C / O1, D / C / O2, D / C / O3, D / C / O4, D / C / O5, D / C / K1, D / C / K2, D / C / K3, D / C / K4, D / C / K5, D / C / K6, D / C / K7, D / C / K1-4, and D / C groups. The dosage of the nucleic acid administration group was 100 nM in terms of nucleic acid, and the D / C group was an empty lipid material group.

[0061] from Figure 1 It can be seen that sequences such as K1-4 have certain tumor cell proliferation inhibitory effects. In addition, the empty lipid material group has no significant toxicity, indicating that it is a drug delivery system with high biocompatibility.

[0062] Example 6

[0063] This example studies the effect of the antisense nucleic acid drug preparation prepared in Example 2 on the KRAS expression in PANC-1 pancreatic cancer cells. G12DGene silencing activity: an antisense nucleic acid pharmaceutical preparation was obtained according to the preparation method of Example 2, and the specific ratios and experimental groups were as shown in Table 2.

[0064] Experimental method: PANC-1 cells were plated in 12-well plates (1.2×10 5 / well), cultured in an incubator for 24 hours and then administered (100 μL per well, adherent administration or drop administration), Trizol was added to extract RNA 24 hours after administration, 500 μL Trizol was added to each well, the cells were blown evenly and transferred to a 1.5 mL EP tube, 100 μL chloroform was added thereto, shaken and allowed to stand for 3 minutes, centrifuged at 13000 rpm for 15 minutes (4°C), the supernatant was carefully aspirated, an equal volume of pre-cooled isopropanol was added, shaken and allowed to stand at 4°C for 15 minutes, centrifuged at 13000 rpm for 15 minutes (4°C), a small amount of precipitation was visible at the bottom of the tube, the supernatant was discarded, 800 μL 70% ethanol was added to blow up the RNA precipitation (do not blow it apart), centrifuged at 13000 rpm for 5 minutes (4°C), the supernatant was discarded, and the RNA was dried. RNA was dissolved in enzyme-free water, and the RNA quality was quantified and tested using Nanodrop. Dilute RNA to 100 ng / μL (10 μL in total) with enzyme-free water and heat at 70°C for 10 min. Use a reverse transcription kit to reverse transcribe mRNA into cDNA, add GoTaq (Promega) and primers, and perform real-time fluorescence quantitative PCR using the following program: 30°C for 5 min; 55°C for 15 min, 85°C for 5 min, 40 cycles, where the primer sequences are shown in Table 3:

[0065] Table 3 Primer sequences

[0066] name sequence KRAS forward primer GACTGAATATAAACTTGTGGTAGTTGGA(SEQ ID NO:9) KRAS reverse primer CATATTCGTCCACAAAATGATTCTG(SEQ ID NO:10) 18S forward primer GTAACCCGTTGAACCCCATT(SEQ ID NO:11) 18S reverse primer CCATCCAATCGGTAGTAGCG(SEQ ID NO:12)

[0067] Figure 2 For D / C / O, D / C / S, D / C / M1, D / C / M2, D / C / M3, D / C / M4, D / C / M5, D / C / O1, D / C / O2, D / C / O3, D / C / O4 , D / C / O5, D / C / K1, D / C / K2, D / C / K3, D / C / K4, D / C / K5, D / C / K6, D / C / K7, D / C / K1-4, D / C group silent KRAS G12D Gene status: The dosage of each nucleic acid administration group was 50 nM in terms of antisense nucleic acid, and the D / C group was an empty lipid material group.

[0068] Depend on Figure 2 It can be seen that after D / C packaging, both M4 and K1-4 showed good KRAS G12D Gene silencing activity.

[0069] Example 7

[0070] This example further verifies the in vivo efficacy of the antisense nucleic acid M4 after D / C encapsulation. The antisense nucleic acid pharmaceutical preparation M4 is obtained according to the preparation methods of Examples 2 to 4. The specific ratios and experimental groups are shown in Table 4:

[0071] Table 4 Relationship between the ratio of antisense nucleic acid drug preparation M4 and experimental groups

[0072] name The ratio of the amount of substance Air-repellent material set (D / C) DNCA / CLD=20:20 M4 Group Corresponding dose of M4+GeneOpti buffer solution, no lipid material added Experimental group 6 (D / C / M4) DNCA / CLD / M4=20:20:1 Experimental group 21 (D / C / M4 / 0.7% PEG) <![CDATA[DNCA / CLD / M4 / DSPE-PEG 2000 =20:20:1:0.28]]> Experimental group 22 (D / C / M4 / 1% cRGD) <![CDATA[DNCA / CLD / M4 / DSPE-PEG 2000 -cRGD=20:20:1:0.4]]>

[0073] Test method:

[0074] Female BALB / c-nude mice aged 4 to 6 weeks were selected and inoculated with 3×10 PANC-1 cells in the axilla. 6 Each tumor volume (volume = length × width 2 ×0.5) grows to about 50mm 3 , the tumor-bearing mice were randomly divided into groups (5 mice in each group). After grouping, the tumor was measured, which was taken as day 0, and then the first administration (preparation containing M4) was carried out, with a dosage concentration of 2mpk, 100μL per mouse, and injection through the tail vein. The administration was done on days 1, 4, 7, 10, 14 and 18, respectively, for a total of 6 times. The tumor was measured and weighed every two days, and the tumor volume and mouse weight were recorded. After the tumor was measured and weighed on the 22nd day, blood was taken and the mice were killed, and the tumor, liver and kidney were dissected out. After the tumor was weighed and photographed, it was divided into two parts. One part was fixed with 4% paraformaldehyde and stained with KRAS antibody; the other part was added with Trizol and ground, RNA was extracted, and KRAS was investigated by RT-qPCR experiment. G12D mRNA level; among them, the M4 group was the corresponding dose of M4+GeneOpti buffer solution without adding lipid material.

[0075] Figure 3 The growth curves of axillary tumors in the blank group, M4, D / C, D / C / M4 / 0.7% PEG, and D / C / M4 / 1% cRGD mice; Figure 4 The blank group, M4, D / C, D / C / M4 / 0.7% PEG, D / C / M4 / 1% cRGD tumor site KRAS G12D mRNA silencing conditions; Figure 5 Tumor images of the blank group, M4, D / C, D / C / M4 / 0.7%PEG, and D / C / M4 / 1%cRGD; Figure 6 The tumor weights of the blank group, M4, D / C, D / C / M4 / 0.7%PEG, and D / C / M4 / 1%cRGD were counted; Figure 7 These are the immunohistochemical sections of the blank group, M4, D / C, D / C / M4 / 0.7% PEG, and D / C / M4 / 1% cRGD groups.

[0076] from Figures 3 to 7 It can be seen that compared with the blank group, D / C / M4 / 0.7% PEG and D / C / M4 / 1% cRGD can significantly inhibit tumor growth; there is no significant difference in the tumor growth curve between the two groups; the tumor weight of the two groups of D / C / M4 / 0.7% PEG and D / C / M4 / 1% cRGD is lighter, and the tumor inhibition rates of the two groups of D / C / M4 / 0.7% PEG and D / C / M4 / 1% cRGD are 53% and 74%, respectively; KRAS was detected by RT-qPCR G12S At the mRNA level, compared with the blank group, the D / C / M4 / 0.7% PEG and D / C / M4 / 1% cRGD groups could significantly inhibit the expression of KRAS in tumor tissues after tail vein injection. G12S mRNA expression, and the inhibition rates were 34% and 39%, respectively; the immunohistochemistry results showed that each drug-treated group could reduce the expression of KRAS protein, indicating that D / C / DSPE-PEG or D / C / DSPE-PEG-cRGD-encapsulated M4 is a class of in vivo anti-tumor preparations with great potential.

[0077] It can be seen from the above examples that the antisense nucleic acids M4 and K1-4 provided by the present invention have the best anti-tumor effects, and the other sequences also have great anti-tumor potential. M4 is effective in vivo and can effectively achieve in vivo tumor treatment.

[0078] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. An antisense nucleic acid targeting the KRAS gene, characterized in that: The nucleotide sequence of the antisense nucleic acid includes at least one of SEQ ID NO: 1 to SEQ ID NO: 7; the nucleotide sequence of the antisense nucleic acid also includes a modified nucleotide sequence of SEQ ID NO: 1 and a modified nucleotide sequence of SEQ ID NO: 8; the modification includes one or more modifications selected from 2'-O-methyl modification, 2'-O-methoxyethyl modification, 5-methylcytosine modification and phosphothioate modification.

2. An antisense nucleic acid drug preparation targeting the KRAS gene, characterized in that: The antisense nucleic acid pharmaceutical preparation comprises the antisense nucleic acid according to claim 1, a nucleoside lipid material DNCA, and a cationic lipid material CLD.

3. The antisense nucleic acid pharmaceutical preparation according to claim 2, characterized in that: The molar ratio of the antisense nucleic acid, the nucleoside lipid material DNCA and the cationic lipid material CLD is 1:10-30:10-30.

4. The antisense nucleic acid pharmaceutical preparation according to claim 2, characterized in that: The antisense nucleic acid pharmaceutical preparation further comprises a surfactant.

5. The antisense nucleic acid pharmaceutical preparation according to claim 4, characterized in that: The surfactant includes DSPE-PEG 2000 or DSPE-PEG 2000 -cRGD.

6. The method for preparing the antisense nucleic acid pharmaceutical preparation according to any one of claims 2 to 5, characterized in that: The method comprises the following steps: dissolving a nucleoside lipid material DNCA and a cationic lipid material CLD in anhydrous ethanol respectively to obtain a nucleoside lipid material DNCA anhydrous ethanol mother liquor and a cationic lipid material CLD anhydrous ethanol mother liquor for use, dissolving an antisense nucleic acid in enzyme-free water to obtain an antisense nucleic acid mother liquor for use; adding a nucleoside lipid material DNCA anhydrous ethanol mother liquor and a cationic lipid material CLD anhydrous ethanol mother liquor to the antisense nucleic acid mother liquor, and placing the mixture in water at 40 to 60° C. and ultrasonicating the mixture for 15 to 30 minutes.

7. The preparation method according to claim 6, characterized in that: The concentration of the antisense nucleic acid mother solution is 10 μM to 10 mM.

8. Use of the antisense nucleic acid according to claim 1 or the antisense nucleic acid pharmaceutical preparation according to any one of claims 2 to 5 in the preparation of a drug targeting the KRAS gene.

9. Use of the antisense nucleic acid according to claim 1 or the antisense nucleic acid pharmaceutical preparation according to any one of claims 2 to 5 in the preparation of drugs for preventing and / or treating tumors.

10. The use according to claim 9, characterized in that: The tumor is pancreatic cancer, colon cancer, endometrial cancer or lung cancer caused by KRAS gene mutation.

Images