Indel molecular marker for identifying ricefield eel strains in two Guangdong regions and application of Indel molecular marker

Abstract

The invention discloses an Indel molecular marker for identifying ricefield eel strains in two Guangdong regions. The nucleotide sequence of the Indel molecular marker A is shown as SEQ ID NO: 5 or SEQ ID NO: 7; the nucleotide sequence of the Indel marker B is as shown in SEQ ID NO: 6 or SEQ ID NO: 8. The invention also provides a primer pair for amplifying the Indel molecular marker. By adopting the Indel molecular marker primer pair provided by the invention to amplify genome DNA of ricefield eel strains in different regions, the ricefield eel strains in the two regions can be quickly screened out according to amplified fragments. The Indel marker provided by the invention can be applied to rapid identification of germplasm resources of a specific geographical strain so as to obtain excellent characters of the strain and finally realize precise breeding.

Description

Technical Field

[0001] The invention belongs to the technical field of aquatic molecular breeding, and specifically relates to an Indel molecular marker for identifying yellow eel strains in Guangdong and Guangxi regions and application thereof. Background Art

[0002] Yellow field eel (Monopterus albus), belonging to the order Synbranchiformes, family Synbranchidae, genus Monopterus, is widely distributed in rice fields, swamps and mud ponds in Asian countries, and is widely distributed in tropical and temperate regions. Due to its rich nutritional value, special flavor and unique taste, it has outstanding commercial value and is known as one of the most economically valuable "special freshwater fish" in China. According to the 2024 China Fisheries Statistical Yearbook, the domestic production of yellow field eels has exceeded 355,000 tons, and the current resource production is in short supply, the price is high, and its market potential is huge. However, the germplasm resources and reserves of wild yellow field eels are decreasing, and their genetic structure is severely damaged. Therefore, it is particularly necessary to accurately and targetedly screen high-quality wild germplasm. The Guangdong-Guangxi region is one of the regions with the richest water resources in China, and has abundant high-quality germplasm resources.

[0003] At present, there is no effective method for targeted screening of eel strains in different regions, so it is necessary to develop molecular markers for screening eel strains in specific regions. Molecular markers are genetic markers based on nucleotide sequence variations in genetic material between individuals, and can reflect specific DNA fragments of certain differences in the genome between populations. Compared with other morphological markers, cytological markers, microsatellite markers, etc., Indel markers have the advantages of simple operation, high accuracy and efficiency, and high repeatability. In addition, DNA from different tissues at different stages of biological development can be used for marker analysis. At present, there is no effective method for targeted screening of eel strains in Guangdong and Guangxi, so it is necessary to develop molecular markers for screening eel strains in Guangdong and Guangxi. Summary of the invention

[0004] The purpose of the present invention is first to provide an Indel molecular marker A or B for identifying the strains of yellow eels in Guangdong and Guangxi.

[0005] The nucleotide sequence of the Indel marker A is shown in SEQ ID NO:5 or SEQ ID NO:7; the nucleotide sequence of the Indel marker B is shown in SEQ ID NO:6 or SEQ ID NO:8.

[0006] If there is a deletion of the following sequence at 65-89 bp of the sequence shown in SEQ ID NO:7: AAGCATTTAAAGTCTGGTGCTTCAC, then the corresponding sequence is SEQ ID NO:5;

[0007] If there is a deletion of the following sequence at the 29-51 bp base of the sequence shown in SEQ ID NO:8: GTGATCAGTCGCTGCGTCTGTG, then the corresponding sequence is SEQ ID NO:6.

[0008] Another object of the present invention is to provide primer pair 1 and primer pair 2, which are used to amplify the above-mentioned Indel molecular markers A and B, respectively. The nucleotide sequences of the primer pairs are shown in SEQ ID NOs: 1-4 in Table 1:

[0009] Table 1 Nucleotide sequences of two primer pairs

[0010]

[0011] When the primer pairs of SEQ ID NO:1-4 are used to amplify the genomic DNA of the yellow eel in the tested area, the yellow eel strain in Guangdong and Guangxi can be quickly screened out according to the amplified fragments. If the nucleotide sequence of the amplified product is shown in SEQ ID NO:5 or SEQ ID NO:6, it is identified as the yellow eel strain in Guangdong and Guangxi; if the nucleotide sequence of the amplified product is shown in SEQ ID NO:7 or SEQ ID NO:8, it is identified as the yellow eel strain not in Guangdong and Guangxi.

[0012] The present invention also provides a kit for identifying yellow eel strains in Guangdong and Guangxi, comprising one or two of the primer pair 1 shown in SEQ ID NO: 1-2 and the primer pair 2 shown in SEQ ID NO: 3-4.

[0013] The present invention also provides the use of the above-mentioned Indel marker, the primer pair of SEQ ID NO: 1-4 or a kit containing the primer pair shown in SEQ ID NO: 1-4 for identifying the strains of yellow eel in Guangdong and Guangxi regions.

[0014] The present invention also provides a method for identifying the strains of yellow eels in the southwest region, comprising the following steps:

[0015] 1. Take the muscle tissue from the tail of the yellow eel to be tested, and use it to extract the yellow eel genomic DNA;

[0016] 2. Using the genomic DNA of the yellow eel as a template, perform PCR amplification using one or more of the primer pairs shown in SEQ ID NOs: 1-2 or 3-4 to obtain an amplified product;

[0017] 3. Compare the nucleotide sequence of the amplified product with SEQ ID NO:5-6 or SEQ ID NO:7-8 for identification; if the nucleotide sequence of the amplified product is as shown in SEQ ID NO:5 or SEQ ID NO:6, it is identified as a yellow eel strain from Guangdong and Guangxi; if the nucleotide sequence of the amplified product is as shown in SEQ ID NO:7 or SEQ ID NO:8, it is identified as a yellow eel strain not from Guangdong and Guangxi.

[0018] The innovative features of the present invention are:

[0019] The present invention provides an Indel marker for identifying the strains of yellow eels in Guangdong and Guangxi. The molecular marker primers required for detection provided by the present invention are used to perform PCR amplification on yellow eel strains in different regions, and whether the yellow eel strain is from Guangdong and Guangxi can be quickly identified according to the amplified fragment. The Indel marker provided by the present invention is applied in practice to realize the rapid identification of the germplasm resources of the yellow eel strains in Guangdong and Guangxi, thereby obtaining the excellent traits of the strains, and finally realizing precision breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 :Gel electrophoresis of PCR amplification of DNA from 18 rice field eel strains using primer pair 1

[0021] Figure 2 :Gel electrophoresis of PCR amplification of DNA from 18 rice field eel strains using two pairs of primers

[0022] The numbers 1-18 represent the following 18 eel strains:

[0023] 1. Nanning, Guangxi; 2. Zhanjiang, Guangdong; 3. Guangzhou, Guangdong; 4. Hefei, Anhui; 5. Changsha, Hunan; 6. Weinan, Shaanxi; 7. Ankang, Shaanxi; 8. Ganzhou, Jiangxi; 9. Jiujiang, Jiangxi; 10. Chengdu, Sichuan; 11. Zhengzhou, Henan; 12. Dali, Yunnan; 13. Dandong, Liaoning; 14. Dongying, Shandong; 15. Huai'an, Jiangsu; 16. Baoding, Hebei; 17. Sanya, Hainan; 18. Xiantao, Hubei DETAILED DESCRIPTION

[0024] The following examples are only used to further illustrate the content of the present invention, but should not be construed as limiting the present invention. Without departing from the spirit and essence of the present invention, the modification or replacement of the method, steps or conditions of the present invention all belong to the scope of the present invention. The experimental methods without specifying specific conditions in the examples and the reagents and materials without specifying the formula are all in accordance with the conventional conditions in the art, and the reagents used can all be purchased.

[0025] The invention provides an Indel marker for identifying whether a yellow eel is a yellow eel strain from Guangdong and Guangxi. The method for obtaining the molecular marker is as follows: based on the existing yellow eel genome sequence, yellow eels of strains from different regions are resequenced, and genome-wide association analysis is used to identify the genome region of the yellow eel strain in Guangdong and Guangxi that is different from the yellow eel strain in other regions, which is located at the physical positions of the 62393694-62393718 site on chromosome 2 (Chr2) of the yellow eel and the 61693628-61693651 site on chromosome 2 (Chr2). The flanking sequences of 200 bp before and after the Indel mutation on the genome region are selected for primer development. After the Indel marker is PCR amplified by the primer, it is identified whether the yellow eel to be tested is the yellow eel strain from Guangdong and Guangxi by the difference of the amplified fragments. The amplified fragments respectively conform to the nucleotide sequences of the Indel marker SEQ ID NO: 5-6 of the invention are yellow eel strains from Guangdong and Guangxi.

[0026] The present invention provides two pairs of primers for detecting the Indel molecular markers, and their forward and reverse primer sequences are shown in SEQ ID NOs: 1-4, respectively.

[0027] Example 1: Identification of Monopterus albus strains from 18 regions

[0028] (1) Extraction of genomic DNA from eel samples

[0029] A small piece of tail muscle of about 0.5 g was cut from the tested yellow eel, and the genomic DNA was extracted using a tissue genomic DNA extraction kit (brand: Tiangen, item number: 69504). The purity and concentration of the obtained DNA sample were detected using a NanoDrop2000 spectrophotometer. The extracted DNA can be stored at -20°C for a long time.

[0030] (2) PCR amplification of Indel-tagged fragments

[0031] Using the above-obtained genomic DNA of the yellow eel as a template, PCR amplification was performed using the primer pair with the nucleotide sequence shown in primer pair 1 SEQ ID NO: 1-2 or primer pair 2 SEQ ID NO: 3-4 in Table 1.

[0032] Use a premixed PCR kit with dye (brand: TaKaRa, item number: RR903A) to prepare the following 20 μl reaction system: Premix Taq 10 μl, 10 μM forward primer 0.5 μl, 10 μM reverse primer 0.5 μl, template DNA 1 μl, and add ddH2O to a total volume of 20 μl.

[0033] The PCR amplification program was as follows: pre-denaturation at 98°C for 10 min, denaturation at 98°C for 10 s, annealing at 60°C for 30 s, extension at 72°C for 1 min, 35 cycles, and extension at 72°C for 5 min.

[0034] (3) Agarose gel electrophoresis of the amplified product

[0035] A 2% agarose gel was prepared, and the PCR amplification product was added and electrophoresed using a 50 bp DNA marker as a marker. The electrophoresis conditions were set to a voltage of 110 V and an electrophoresis time of 60 min. The bands were photographed using a gel imager to obtain gel images.

[0036] (4) Identification of amplification products

[0037] Identification was performed based on the bands on the gel image or the sequencing results of the PCR amplification products (sequencing was performed at Shanghai Sangon Biotechnology Co., Ltd.).

[0038] When a band is shown at 180 bp on the electrophoresis gel using primer pair 1 or the sequencing result of the amplified product is as shown in SEQ ID NO:5, the tested eel is a strain from Guangdong and Guangxi; if a band is shown at 205 bp or the sequencing result of the amplified product is as shown in SEQ ID NO:7, the tested eel is a strain not from Guangdong and Guangxi.

[0039] When a band is shown at 118 bp on the electrophoresis gel using primer pair 2 or the sequencing result of the amplified product is as shown in SEQ ID NO:6, the tested eel is a strain from Guangdong and Guangxi; if a band is shown at 141 bp or the sequencing result of the amplified product is as shown in SEQ ID NO:8, the tested eel is a strain not from Guangdong and Guangxi.

[0040] The experimental results are as follows Figure 1 and Figure 2 shown.

[0041] Figure 1 The amplified product bands of samples 1-3 are located at 180 bp, and the amplified product bands of samples 4-18 are located at 205 bp.

[0042] Figure 2 The amplified product bands of samples 1-3 were located at 118 bp, and the amplified product bands of samples 4-18 were located at 141 bp.

[0043] from Figure 1 and Figure 2 It can be clearly seen that No. 1-3 from Nanning, Guangxi, Zhanjiang, Guangdong, and Guangzhou, Guangdong are indeed eel strains from the Guangdong and Guangxi regions, while No. 4-18 eels come from other regions.

[0044] The above results show that the Indel marker A or B can effectively identify whether it is a yellow eel strain from Guangdong and Guangxi. Therefore, the Indel marker provided by the present invention can be used for the rapid identification of germplasm resources of a specific geographical strain, so as to obtain the excellent traits of the strain and ultimately achieve precision breeding.

Claims

1. An Indel marker A or B for identifying the strains of yellow eels in Guangdong and Guangxi, characterized in that The nucleotide sequence of the Indel marker A is shown in SEQ ID NO:5 or SEQ ID NO:7; the nucleotide sequence of the Indel marker B is shown in SEQ ID NO:6 or SEQ ID NO:

8.

2. A primer pair for amplifying the Indel marker A or B according to claim 1, which is used to amplify the Indel marker A or B, respectively, characterized in that The nucleotide sequence of the primer pair 1 is shown in SEQ ID NO: 1-2; the nucleotide sequence of the primer pair 2 is shown in SEQ ID NO: 3-4.

3. A kit for identifying the strains of yellow eels in Guangdong and Guangxi, characterized in that It comprises one or both of the primer pair 1 shown in SEQ ID NO: 1-2 and the primer pair 2 shown in SEQ ID NO: 3-4.

4. Use of the Indel molecular marker A or B according to claim 1 for identifying rice field eel strains in Guangdong and Guangxi regions.

5. Use of the primer pair 1 and 2 described in claim 2 for identifying the strains of yellow eel in Guangdong and Guangxi regions.

6. Use of the kit according to claim 3 for identifying strains of yellow eels in Guangdong and Guangxi regions.

7. A method for identifying the strains of yellow eels in Guangdong and Guangxi, characterized in that The steps include: (1) taking muscle tissue from the tail of the yellow eel to be tested, and using it to extract yellow eel genomic DNA; (2) using the genomic DNA of the yellow eel as a template, and performing PCR amplification using the primer pair shown in SEQ ID NO: 1-2 or one or two pairs of the primer pairs shown in SEQ ID NO: 3-4 to obtain an amplified product; (3) The nucleotide sequence of the amplified product is compared with SEQ ID NO:5-6 or SEQ ID NO:7-8 for identification; if the nucleotide sequence of the amplified product is as shown in SEQ ID NO:5-6, it is identified as a strain of yellow eel from the southwest region; if the nucleotide sequence of the amplified product is as shown in SEQ ID NO:7-8, it is identified as a strain of yellow eel from outside the southwest region.

Images