Method for identifying desert nitrogen-fixing cyanobacteria by using nitrogenase gene
By using amplification primers and PCR amplification technology based on nitrogenase nif gene and combined with bioinformatics analysis, the problem of identification of desert nitrogen-fixing cyanobacteria in desert soil was solved, and a rapid and accurate identification effect was achieved.
Patent Information
- Application Number
- CN202411800771.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-09
- Publication Date
- 2025-03-18
AI Technical Summary
It is difficult to quickly and accurately identify the categories of desert nitrogen-fixing cyanobacteria in desert soils.
The amplification primers based on the nitrogenase nif gene were used to quickly identify the categories of desert nitrogen-fixing cyanobacteria through PCR amplification technology and bioinformatics analysis.
It achieves rapid and accurate identification of desert nitrogen-fixing cyanobacteria categories, which is highly operable and easy to master.
Abstract
Description
Technical Field
[0001] The invention relates to the field of identification of desert nitrogen-fixing cyanobacteria, and in particular to a method for identifying desert nitrogen-fixing cyanobacteria in desert soil by utilizing nitrogenase nif genes. Background Art
[0002] Nitrogen-fixing cyanobacteria (Cyanophyta) are a type of lower algae, and are the species with obvious nitrogen-fixing ability among cyanobacteria. About 160 species and variants have been studied or measured for their nitrogen-fixing ability. Most of them belong to the Nostocales. Such as Nostoc, Anabae-na, Tolypothrix, Cylindros, permum, Anabaenopsis, Calothrix, etc. In addition, some species of Chrococophorales and Eucladocerales also have the ability to fix nitrogen.
[0003] Nitrogen-fixing cyanobacteria reduce free molecular nitrogen in the atmosphere into nitrogen compounds that can be used by plants through the action of nitrogenase in their cells. At the same time, they continuously secrete nitrogen-containing compounds and active substances such as amino acids and polypeptides during their growth and reproduction. In addition, nitrogen-fixing cyanobacteria release a large amount of ammonia nitrogen after death, which greatly increases soil fertility. Most nitrogenases of nitrogen-fixing cyanobacteria are present in a special cell called heterocystis, so heterocystis is considered to be the main nitrogen fixation site of cyanobacteria.
[0004] Nitrogen-fixing cyanobacteria have strong ecological adaptability and can exist in a free state or form symbioses with certain organisms in many habitats. They are important microbial resources in tropical and subtropical regions. In recent years, domestic and foreign studies have shown that they have broad application prospects in biofertilizers, biopesticides, functional foods, new drugs, new energy, new materials, pollution remediation, etc. Paddy field nitrogen-fixing cyanobacteria can not only provide nitrogen and organic matter for crops, increase phosphate solubility, and reduce water and soil pollution, but also supply oxygen to crop roots, secrete plant hormones, and inhibit weed growth, etc., to maintain ecological balance and promote sustainable agricultural development.
[0005] Since nitrogen-fixing cyanobacteria can produce a large number of secondary metabolites with different properties, some algae-derived compounds have been commercially used in medicine. It is expected that the commercial development of cyanobacterial compounds will have application value in weed control and pest control.
[0006] The nitrogen fixation synthase (Nitrogenase) of desert nitrogen-fixing cyanobacteria is controlled and regulated by the nitrogen fixation gene (nif). The nitrogenase complex is mainly composed of two parts: the iron protein encoded by nifH and the molybdenum iron protein encoded by nifDK. In the genome of nitrogenase, the nitrogen fixation-related nif genes exist as one or several gene clusters. Because the sequences of the common gene clusters in the known nitrogen-fixing cyanobacteria nif gene clusters can be used to discover and detect new possible desert nitrogen-fixing cyanobacteria. Summary of the invention
[0007] In view of the characteristics existing in the prior art, the present invention discloses a desert cyanobacteria genome amplification primer and a method for identifying desert nitrogen-fixing cyanobacteria based on the primer, so as to realize the rapid identification of the nitrogen-fixing cyanobacteria category in desert cyanobacteria.
[0008] The adopted technical scheme is that the present invention firstly discloses an amplification primer of the desert cyanobacteria genome, and the amplification primer is an amplification primer based on the nif gene of the nitrogen-fixing cyanobacteria.
[0009] As a preferred technical solution of the present invention, the amplification primer is at least one of nifH-F and nifH-R; The gene sequence of the nifH-F amplification primer is: 5'-AAAGGYGGWATCGGYAARTCCACCAC-3'; The gene sequence of the nifH-R amplification primer is: 5'-TTGTTSGCSGCRTACATSGCCATACAT-3'.
[0010] The present invention also discloses a method for identifying desert nitrogen-fixing cyanobacteria based on the above primers, and the technical scheme adopted is comprising the following steps: Step 1, purifying and culturing the sample using anoxic culture medium to obtain a cultured sample, wherein the purification and culturing is performed here to exclude interference from exogenous bacteria or microorganisms such as algae; Step 2, extracting DNA from the cultured sample obtained in step 1 and performing PCR amplification to obtain an amplified sequence; the PCR amplification uses at least one of nifH-F and nifH-R; Step 3: Data processing and bioinformatics analysis.
[0011] As a preferred technical solution of the present invention, in step 2, the PCR amplification uses the extracted sample DNA as a template and the nifH gene sequence as the target region fragment for amplification.
[0012] As a preferred technical solution of the present invention, in step 3, the amplified sequence gene fragments obtained in step 2 are spliced and merged using the Editseq and Seqman subroutines in the DNAstar7.0 software package, and sorted using ClustalW1.83. If bidirectional sequencing is used here, splicing processing is required, and if unidirectional sequencing is used, sorting can be performed directly. After sorting, a nuclear check is performed and sorting errors are corrected, and then the modified amplified sequence is homologously aligned to obtain the category of desert nitrogen-fixing cyanobacteria.
[0013] The beneficial effects of the present invention are as follows: the present invention firstly utilizes nitrogen-deficient culture medium to culture desert nitrogen-fixing cyanobacteria cells to observe whether they can grow normally, then uses the extracted desert nitrogen-fixing cyanobacteria genomic DNA as a template and the nifH gene sequence as an amplified target region fragment for conventional PCR amplification to test whether a single amplification product of the nifH gene sequence can appear, and can rapidly identify the types of desert nitrogen-fixing cyanobacteria in a step-by-step manner in a simple and easy-to-operate method, has strong operability, is simple and easy to master, and can rapidly identify desert nitrogen-fixing cyanobacteria from desert cyanobacteria. DETAILED DESCRIPTION
[0014] Example 1
[0015] The present invention discloses a method for identifying desert nitrogen-fixing cyanobacteria by using nitrogenase genes. The technical scheme adopted comprises the following steps:
[0016] Step 1: Purify and culture desert cyanobacteria samples
[0017] Weigh 50 g of desert soil sample, put it into a conical flask containing 100 mL of sterilized BBM culture medium, and place it in a culture rack with 12 h light and 12 h dark, and mix and culture it at 29°C for 2 weeks.
[0018] Take an appropriate amount of the mixed culture fluid after culturing for 2 weeks and calculate the cell density with a hemocytometer. Dilute it to 200 μL containing 1 or 2 single algae cells according to the average density of the algae fluid counted multiple times. Use the 96-well plate limiting dilution method to separate the algae species. Place it in a light culture rack with 20 hours of light and 4 hours of darkness, the temperature is 29°C, and the light intensity is 2500 lux. Regularly inspect the cultured algae fluid under a microscope, and take pictures with an optical microscope to record the status of the algae species. The purification is successful when the morphology of the algae cells observed under a 100x oil microscope is consistent.
[0019] Purified desert cyanobacteria were cultured in BG11-N medium under nitrogen deficiency mode. The components of BG11-N medium are: K2HPO 4.3H2O0.04g / L, MgSO4.7H2O0.075g / L, CaCl2.2H2O0.036g / L, citric acid 0.006g / L, ferricammoniumcitrate 0.006g / L, EDTANa20.001g / L, Na2CO30.02g / L, pH value is 7.4.
[0020] Step 2: Microscope observation
[0021] Take about 50 μL of samples from algae species in the logarithmic growth period, observe their cell morphology using Nikon Ni-E advanced research-level automatic differential interference optical microscope, and take photos and record them. Use the plankton counting and analysis intelligent identification system AlgaeC to take photos and record the cells of the desert algae species to be identified, and use the cell characteristics corresponding to the retrieval table of "Chinese Freshwater Algae System, Classification and Ecology" for morphological identification.
[0022] Step 3, extraction and PCR amplification of desert cyanobacteria genomic DNA:
[0023] Take 500 mL of the culture medium of the desert nitrogen-fixing cyanobacteria in the logarithmic growth phase, divide it into 50 mL centrifuge tubes, centrifuge it at 4000 rpm / min for 10 min, and discard the supernatant.
[0024] The genomic DNA of desert cyanobacteria was extracted using a genomic DNA extraction kit according to the method in the kit manual. The PCR product was tested for DNA integrity by electrophoresis using 4S Green Plus 2.0% agarose gel (prepared with 1×TAE) containing a non-toxic nucleic acid dye, and photographed and recorded using an Alphalmager 200 gel imaging system. The molecular weight standard used was B500351 (100 bp to 5000 bp) (a product of Sangon Biotechnology (Shanghai) Co., Ltd., Sangon Biotechnology (Shanghai) Co., Ltd. hereinafter referred to as “Shanghai Sangon”).
[0025] Using the DNA of the desert nitrogen-fixing cyanobacteria genome as a template, PCR reactions were performed on an Eppendorf AG Mastercycler X50s thermal cycler.
[0026] The primer sequences for amplification of the nif gene are nifH-F: 5'-AAAGGYGGWATCGGYAARTCCACCAC-3'; nifH-R: 5'-TTGTTSGCSGCRTACATSGCCATACAT-3'.
[0027] The total volume of the PCR reaction was 50 μL, including 20.0 μL ultrapure water, 25 μL PCR mixture (mix), 2.0 μL 10 mmol / L primers (1 μL each of nifH-F and nifH-R), and 3.0 μL template DNA (100 ng).
[0028] The reaction procedure was: pre-denaturation at 95°C for 5 min followed by 30 cycles, each cycle including 95°C for 45 sec, 56°C for 45 sec, 72°C for 2 min, and finally extension at 72°C for 10 min.
[0029] The PCR product was detected by electrophoresis using 4S Green Plus 2.0% agarose gel (prepared with 1×TAE) containing non-toxic nucleic acid dyes and photographed and recorded using an Alphalmager 200 gel imaging system; the molecular weight standard used was B500351 (100 bp to 5000 bp) (product of Shanghai Biotechnology), and the amplified sequence of the nifH gene was sequenced.
[0030] Step 4. Data processing and bioinformatics analysis
[0031] Unidirectional sequencing was used and sorted. Obvious sorting errors were manually modified to obtain a gene sequence table. The obtained sequence was compared with the sequence in the GenBank database through online BLAST to quickly and accurately identify the category of desert nitrogen-fixing cyanobacteria. Nitrogen fixation function verification test
[0032] Experiment 1 Medium Validation
[0033] Desert nitrogen-fixing cyanobacteria cells are cultured in liquid culture under light using nitrogen-deficient culture medium. If the cyanobacteria cells continue to maintain a state of normal growth and reproduction, it is preliminarily determined that the above cyanobacteria have the function of nitrogen fixation.
[0034] In order to further confirm the nitrogen-fixing function of desert nitrogen-fixing cyanobacteria, take an appropriate amount of culture solution of nitrogen-fixing cyanobacteria in the logarithmic growth phase and spread it on a nitrogen-deficient solid culture medium. If the cyanobacterial cells continue to maintain a state of normal growth and reproduction, it is further confirmed that the above cyanobacteria have the function of nitrogen fixation.
[0035] Experiment 2 Molecular Biology Validation
[0036] Using the extracted desert nitrogen-fixing cyanobacteria genomic DNA as a template and the nifH gene sequence as the target region for amplification, conventional PCR amplification was performed to obtain a PCR product of 750 bp in length as shown below:
[0037] cgacgctctc gctgctcggc aagcgcgtgc tgcagatcgg ctgcgatccc aagcatgaca gcaccttcac gctgaccaag aagctgatgc cgacggtgat cgacgtgctc gaaacggtcg atttccatca cgaggaactg cggcccgagg attacatgtt cgagggcttc aacggcgtga tgtgcgtcga ggcgggcggt ccgccggcgg gcactggctg cggcggctat gtcgtcggcc agacggtcaa gctgctcaag cagcaccatc tgctcgaggataccgatgtc gtgatcttcg acgtgctggg cgatgtggtg tgcggcggct ttgccgcgcc gctccagcat gccgagcgcg cggtggtcgt ggcggccaat gatttcgaca gcatcttcgc gatgaaccgc atcgtcgccg ccatcaaggc caagtcgaag aattacgagg tccgcatggc gggcgtcatc gccaaccgct ctgccgcgac cgacgagatc gaccgtttca acgaggcgac cggcctcaag cgcctcgcgc atttccccga tctcgacgcg atccgccgca gccgcctgaa gaaatgcacg atcttcgaga tggattcgac ccccgagatc gaggcggtga agaacgaatatctgcgcctc gccgcaacgc tctgggcggg caccgatgcg ctcgacgccg atgccgatga aggatcgcga gatcttcgag ttcctggggt ttgaatgatg gccatgttg If the band is bright and clear, without any other bands, and is within the standard molecular weight marker B500351 The length of the nifH gene fragment was about 750 bp (100 bp~5000 bp) (product of Shanghai Biotechnology), which was consistent with the amplification band designed by the primers, indicating that the nifH gene fragment was amplified successfully.
[0038] The PCR amplification product of the nifH gene fragment of the desert nitrogen-fixing cyanobacteria was sequenced using the ABI 3730xl DNA Analyzer, and the sequencing reagent was BigDye terminatorv3.1. Under normal circumstances, due to the interference of fluorescent dyes, the instrument and software may sometimes misread or miss bases during sequencing, and the sequencing results may not be accurately read in the 10 to 30 bases after the 3' end of the primer, and in severe cases, more than 70 bases may not be accurately read. Therefore, in order to ensure the accuracy of the sequence, the forward and reverse strands are sequenced simultaneously. Only when the two sequences are completely consistent can the obtained sequence be 100% reliable.
[0039] The obtained sequence is compared with the sequences in the GenBank database by online BLAST. If the obtained sequence has a very high homology with the nifH gene fragment sequence of the nitrogen-fixing cyanobacteria registered in the GenBank database, it can be determined that the obtained sequence is indeed the target fragment of the nifH gene fragment of the desert nitrogen-fixing cyanobacteria.
[0040] Although the specific embodiments of the present invention are described in detail above, the present invention is not limited to the above embodiments. Various changes can be made within the knowledge of ordinary technicians in this field without departing from the purpose of the present invention, and modifications or deformations without creative labor are still within the protection scope of the present invention.
Claims
1. A desert cyanobacteria genome amplification primer, characterized in that: The amplification primers are amplification primers based on the nitrogenase nif gene.
2. The desert cyanobacteria genome amplification primer according to claim 1, characterized in that: The amplification primer is at least one of nifH-F and nifH-R; The gene sequence of the nifH-F amplification primer is: 5'-AAAGGYGGWATCGGYAARTCCACCAC-3'; The gene sequence of the nifH-R amplification primer is: 5'-TTGTTSGCSGCRTACATSGCCATACAT-3'.
3. A method for identifying desert nitrogen-fixing cyanobacteria using the amplification primers as claimed in claim 2, characterized in that: The following steps are involved: Step 1, purifying and culturing the sample to obtain a cultured sample; Step 2, extracting DNA from the cultured sample obtained in step 1 and performing PCR amplification to obtain an amplified sequence; the PCR amplification uses at least one of nifH-F and nifH-R; Step 3: Data processing and bioinformatics analysis.
4. The method for identifying desert nitrogen-fixing cyanobacteria using nitrogenase gene according to claim 3, characterized in that: In the step 1, a hypoxic medium is used for culturing.
5. The method for identifying desert nitrogen-fixing cyanobacteria using nitrogenase gene according to claim 3, characterized in that: In step 2, the PCR amplification uses the extracted sample DNA as a template and the nifH gene sequence as the target region fragment for amplification.
6. The method for identifying desert nitrogen-fixing cyanobacteria using nitrogenase gene according to claim 3, characterized in that: In the step 3, the amplified sequences obtained in the step 2 are sorted, the sorting errors are checked and corrected, and then the modified amplified sequences are subjected to homology comparison to obtain the category of the desert nitrogen-fixing cyanobacteria.