Molecular marker VsChr1244133225 related to anti-cracking character of vicia sativa and application of molecular marker VsChr1244133225

Abstract

The invention discloses a molecular marker VsChr1244133225 related to the anti-cracking character of vicia sativa and application of the molecular marker VsChr1244133225, and belongs to the technical field of biology. The molecular marker VsChr1244133225 is located on a chromosome 1 of a common vetch reference genome (the downloading website is http: / / dx.doi. Org / 10.5524 / 100954), and the molecular marker VsChr1244133225 is located on the chromosome 1 of the common vetch reference genome. The nucleotide sequence of the insertion or deletion fragment is as shown in SEQ ID NO.3. The nucleotide sequences of the primer pair for amplifying the InDel molecular marker are as shown in SEQ ID NO.1-2. The character selection is realized by selecting the marker, the breeding efficiency is greatly improved, and the effect of quickly screening the anti-cracking vicia sativa variety is realized.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to molecular markers related to crack resistance traits of pea vine. Background Art

[0002] As a genetic marker that reflects genetic diversity at the DNA level, molecular markers are widely used in species identification, breeding, and gene localization. The first generation of molecular marker technology is based on molecular hybridization, mainly restriction fragment length polymorphism marker RFLP, which produces molecular marker polymorphism by adding or deleting restriction endonuclease cutting sites; the second generation of molecular marker technology is based on PCR reaction, which is widely used due to its low cost, convenient and accurate detection, such as random amplified polymorphism marker RAPD, simple sequence repeat marker SSR and amplified fragment length polymorphism marker AFLP, etc.; and with the development of second-generation sequencing and third-generation sequencing technology, high-throughput sequencing has become possible, and the genomes of various species can be assembled and improved. The third generation of molecular markers was born in this context and became a new type of efficient, accurate and stable molecular marker. It integrates the principles and technologies of molecular biology, genetics and bioinformatics, and can quickly transform sequencing results into molecular marker-assisted breeding and quickly improve existing varieties.

[0003] Vicia sativa L. is an annual or biennial closed-pollinated plant belonging to the genus Vicia of the Fabaceae family. It is an important forage and green manure crop in China's high-altitude areas. Due to its short domestication time, pod cracking is common in Vicia sativa L., and the pod cracking rate of most Vicia sativa L. varieties is high, which is unfavorable for seed production and breeding. In addition, the molecular research foundation of Vicia sativa L. is weak, and its pod cracking mechanism has not yet been elucidated. The development of InDel molecular markers associated with crack resistance traits by combining Vicia sativa L. genome-wide association analysis (GWAS) and third-generation molecular marker technology can accelerate the selection of crack-resistant Vicia sativa L., thereby greatly improving the breeding efficiency of Vicia sativa L. Summary of the invention

[0004] One of the purposes of the present invention is to provide a molecular marker related to the crack resistance trait of pea.

[0005] The second object of the present invention is to provide the application of the above-mentioned molecular markers related to the crack resistance trait of pea.

[0006] To achieve the above object, the present invention adopts the following technical solutions:

[0007] The invention discloses a pair of molecular markers related to the crack resistance trait of pea vetch, which are located on chromosome 1 of pea vetch, and the molecular markers are named Vs_Chr1_244133225.

[0008] A primer pair for amplifying a molecular marker related to the crack resistance trait of pea, the primer pair sequence corresponding to the molecular marker Vs_Chr1_244133225 is:

[0009] Vs_Chr1_244133225-F: CACTCCAACTCTCTCATCA (shown in SEQ ID NO. 1);

[0010] Vs_Chr1_244133225-R: CGACAGCAATGGGTTATT (shown in SEQ ID NO. 2).

[0011] The InDel sequence of Vs_Chr1_244133225 is: TCACTTATTTAAATAACCAA (shown in SEQ ID NO. 3).

[0012] The present invention also discloses the use of the molecular marker primer pair in auxiliary breeding of the crack resistance trait of pea. That is to say, the molecular marker of the present invention can be used in future molecular marker assisted breeding, by extracting DNA from leaves at the seedling stage, detecting whether the molecular marker of the present invention exists, and then identifying the crack trait of pea. The detection can use the PCR detection method, specifically the molecular marker primer pair mentioned above, and the detection can also be performed by sequencing method.

[0013] The present invention also discloses the application of the molecular marker in identifying the crack resistance trait of pea stalks, especially in screening and identifying crack resistance pea stalks. Specifically, the specific steps for identifying whether pea stalks have crack resistance trait are as follows:

[0014] (1) The DNA of the test germplasm was used as a template for PCR amplification, and the primer pair corresponding to the marker Vs_Chr1_244133225 was used as a primer. The reaction system of PCR amplification is shown in Table 1:

[0015] Table 1 PCR amplification reaction system

[0016]

[0017] PCR amplification program: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 52°C for 30 s, extension at 72°C for 20 s, 35 cycles; extension at 72°C for 5 min; storage at 4°C.

[0018] (2) Agarose gel electrophoresis test of PCR products, and judging the crack resistance of peas according to the results:

[0019] If the PCR amplification product is a characteristic band with a length of 100 bp as shown in SEQ ID NO.4, the pea is a break-prone type; if the PCR amplification product is a characteristic band with a length of 80 bp as shown in SEQ ID NO.5, the pea is a break-resistant type.

[0020] In addition, a reagent containing the above molecular marker primer pair can be selected to make a kit, which can be used to identify the crack resistance of the pea material. Furthermore, the kit can be used to identify or assist in identifying the genotype of the pea. All of the above applications can be carried out according to conventional methods.

[0021] The present invention has the following advantages:

[0022] (1) The molecular markers in the present invention are closely related to the crack resistance trait of pea, and can be applied to molecular marker-assisted breeding of crack resistance trait of pea, to the screening of germplasm resources of crack-resistant pea, and to the genetic improvement of pea.

[0023] (2) The molecular markers of the present invention have the characteristics of convenient detection, stable amplification products and high specificity, and can be applied to the breeding practice of pea quickly and with high throughput. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 The whole genome association analysis result of the crack resistance trait of pea is a Manhattan diagram obtained based on the analysis of EMMAX software. The red sites shown are the InDel positions associated with the present invention.

[0025] Figure 2 Box plot of PSRI (pod crack resistance index) corresponding to different genotypes of the Vs_Chr1_244133225 locus in the genome-wide association analysis. 0 / 0 means that the genotype of the Vs_Chr1_244133225 locus is a crack-prone genotype, and 1 / 1 means that the genotype of the Vs_Chr1_244133225 locus is a crack-resistant genotype. The dots are extreme values ​​of the data, and the values ​​above are the P values ​​for testing differences.

[0026] Figure 3 The sequence differences between the 0 / 0 genotype and the 1 / 1 genotype within the molecular marker Vs_Chr1_244133225 region. Figure 4 This is the electrophoresis diagram of molecular markers amplified from some of the germplasm resources of Aglaonema ovata, and the concentration of agarose gel is 2%. In the figure, M represents DNA marker. DETAILED DESCRIPTION

[0027] The present invention will be described in detail below through specific embodiments. These embodiments are provided to enable a more thorough understanding of the present invention and to fully convey the scope of the present invention to those skilled in the art.

[0028] Unless otherwise specified, the technical means used in the examples are conventional means known to those skilled in the art. The test methods in the following examples are conventional methods unless otherwise specified. Unless otherwise specified, the reagents and materials used can all be purchased from the market.

[0029] Unless otherwise defined, all professional and scientific terms used herein have the same meanings as those familiar to those skilled in the art. In addition, any methods and materials similar or equivalent to those described herein may be applied to the present invention. The preferred implementation methods and materials described herein are for demonstration purposes only.

[0030] Example 1 Development of molecular markers related to crack resistance in pea

[0031] The present invention uses the intact pod rate after simulating the natural fall of the pea pods as the crack resistance index (PSRI) to evaluate the pod cracking trait of pea pods. The higher the value, the more resistant the pea pods are to cracking; the lower the value, the easier the pea pods are to crack. After measuring the PSRI of the pea pod population, an InDel site ( Figure 1 The red locus) is named Vs_Chr1_244133225. This locus is located at the 244133225th locus on chromosome 1 of the reference genome of the pea (download URL: http: / / dx.doi.org / 10.5524 / 100954). The first allele type of the inserted InDel is 0 / 0; the second allele type of the deleted InDel is 1 / 1. PSRI distribution box plot of different genotypes of the Vs_Chr1_244133225 locus of the pea population ( Figure 2 ), indicating that the crack resistance of the 1 / 1 genotype of the pea material is significantly higher than that of the 0 / 0 genotype. At the 244133225th site on chromosome 1 of the pea, the insertion / deletion fragment is TCACTTATTTAAATAACCAA (shown in SEQ ID NO.3) ( Figure 3 ), the 0 / 0 type has an insertion fragment of SEQ ID NO.3, and the 1 / 1 type has a deletion fragment of SEQ ID NO.3.

[0032] According to the InDel variation and its upstream and downstream sequences, the following primers were designed using primer 5.0 software:

[0033] Vs_Chr1_244133225-F: CACTCCAACTCTCTCATCA (shown in SEQ ID NO. 1);

[0034] Vs_Chr1_244133225-R: CGACAGCAATGGGTTATT (shown in SEQ ID NO. 2).

[0035] Then, the primers were used to perform PCR amplification on the samples to be tested. The results showed that the PCR product of the pea sample with easy-to-break arrows had a characteristic band of 100 bp, while the PCR product of the pea sample with resistant-to-break arrows had only a characteristic band of 80 bp.

[0036] Example 2 Verification of the Accuracy of the Molecular Markers Described in the Present Invention

[0037] 222 germplasms were identified, and the specific germplasm materials used are shown in Table 2:

[0038] Table 2 Pod dehiscence of 222 pea germplasm materials and the genotype corresponding to the Vs_Chr1_244133225 locus

[0039]

[0040]

[0041]

[0042]

[0043]

[0044]

[0045]

[0046] Note: In the table, genotype . / . represents missing genotype.

[0047] 1) using the genomic DNA of the pea to be identified as a template, performing PCR amplification using the primer pair to obtain a PCR product;

[0048] The reaction system of PCR amplification is as follows: template DNA 10-100ng, 10μM forward primer 1μL, 10μM reverse primer 1μL, 2×Taq PCR Master Mix 15μL, deionized water to 30μL; the reaction program of PCR amplification is preferably: 95℃ pre-denaturation for 5min; 95℃ denaturation for 30s, 52℃ annealing for 30s, 72℃ extension for 20s, 35 cycles; 72℃ extension for 10min; 4℃ storage. 2% agarose gel electrophoresis separation, after spotting, electrophoresis at 5V / cm DC voltage for 2h, and then read the PCR band pattern of each sample.

[0049] 2) Determine the genotype of the pea genotype according to the size of the PCR product: when the fragment shown in SEQ ID NO.3 is inserted into the PCR product of the pea genotype to be identified, the pea genotype to be identified is 0 / 0 type; when the fragment shown in SEQ ID NO.3 is missing from the PCR product of the pea genotype to be identified, the pea genotype to be identified is 1 / 1 type;

[0050] Specifically, when the fragment shown in SEQ ID NO.3 is inserted into the PCR product of the to-be-identified pea, the band length of the PCR product is 100 bp (SEQ ID NO.4), then the to-be-identified pea is of 0 / 0 type.

[0051] The sequence of SEQ ID NO.4 is as follows:

[0052]

[0053]

[0054] When the fragment shown in SEQ ID NO.3 is missing from the PCR product of the to-be-identified pea, the band length of the PCR product is 80 bp (SEQ ID NO.5), and the to-be-identified pea is of type 1 / 1.

[0055] The sequence of SEQ ID NO.5 is as follows:

[0056]

[0057] The 222 pea materials in Table 2 were analyzed. Except for 4 materials with missing genotypes, 194 pea materials had a genotype of 0 / 0 at the Vs_Chr1_244133225 locus, with an average PSRI of 0.4734, belonging to the easy-to-break pea; 24 pea materials had a genotype of 1 / 1 at the Vs_Chr1_244133225 locus, with an average PSRI of 0.7826, belonging to the anti-break pea. The variance analysis showed that the PSRI between the easy-to-break pea and the anti-break pea was significantly different (P<0.001).

[0058] Twenty-four accessions of 222 accessions of V. argentea (accessions numbered 109, 143, 164, 172, 202, 208, 235, 409, 429, 436, 447, 461, 470, 17, 62, 79, 113, 200, 270, 302, 303, 382, ​​430, and 458) were selected for verification. Figure 4 It can be seen that 13 parts of the pea materials amplified a characteristic band of 100bp, which was 0 / 0 type. After statistical analysis, the average PSRI of these 13 pea materials was 0.3527; 11 parts of the pea materials amplified a characteristic band of 80bp, which was 1 / 1 type. After statistical analysis, the average PSRI of these 11 1 / 1 type pea materials was 0.8345, which was higher than the PSRI average of 13 0 / 0 type pea materials. Variance analysis showed that the PSRI difference between 0 / 0 type and 1 / 1 type was significant (P<0.01). The 1 / 1 type pea material for genotyping by PCR detection results was expected to be a crack-resistant material, and the actual situation was consistent with expectations. Therefore, the InDel molecular marker of the present invention can effectively identify the crack-resistant trait of pea, and can be used for the prediction and screening of crack-resistant pea varieties.

[0059] The embodiments described above are only preferred embodiments of the present invention and are only used to explain the present invention, not to limit the scope of implementation of the present invention. For those skilled in the art, other implementation methods can certainly be easily made by replacement or modification based on the technical contents disclosed in this specification. Therefore, all changes and improvements made on the principles of the present invention should be included in the scope of the patent application of the present invention.

Claims

1. A molecular marker Vs_Chr1_244133225 located on chromosome 1 and associated with the crack resistance trait of arrow pea, characterized in that: The molecular marker is an insertion / deletion fragment TCACTTATTTAAATAACCAA on chromosome 1 of the reference genome of Pisum sativum, and the corresponding primer pair sequence is: Vs_Chr1_244133225-F: CACTCCAACTCTCTCATCA; Vs_Chr1_244133225-R:CGACAGCAATGGGTTATT.

2. Use of the molecular marker described in claim 1 in molecular marker-assisted breeding of pea.

3. The use according to claim 2, characterized in that: The molecular marker is used for identifying or assisting in identifying the crack resistance trait of pea.

4. A method for identifying crack resistance of peas, characterized in that: The method comprises the following steps: (1) extracting genomic DNA of the pea to be tested; (2) using the genomic DNA extracted in step (1) as a template, performing PCR amplification using the primer pair of the molecular marker described in claim 1, and performing electrophoresis detection and / or sequencing on the PCR amplification product; (3) Determination is made based on the electrophoresis bands and / or sequencing results of step (2), and the specific criteria are: PCR amplification was performed using primer pairs Vs_Chr1_244133225-F and Vs_Chr1_244133225-R. If the PCR amplification product was a characteristic band with a length of 100 bp as shown in SEQ ID NO.4, the pea was an easy-to-break type; if the PCR amplification product was a characteristic band with a length of 80 bp as shown in SEQ ID NO.5, the pea was an resistant-to-break type.

5. A kit for identifying crack resistance of peas, characterized in that: Comprising the primer pair described in claim 1.

6. Use of the kit according to claim 5 in identifying crack-resistance genotypes of pea.

7. The use according to claim 5, characterized in that: The method for identifying the crack resistance genotype of pea using the kit is as follows: (1) extracting genomic DNA of the pea to be tested; (2) using the genomic DNA extracted in step (1) as a template, performing PCR amplification using the primer pair of the molecular marker described in claim 1, and performing electrophoresis detection and / or sequencing on the PCR amplification product; (3) The PCR amplification product is subjected to electrophoresis detection and / or sequencing. If the PCR amplification product is a characteristic band with a length of 100 bp as shown in SEQ ID NO.4, the pea is a crack-prone genotype; if the PCR amplification product is a characteristic band with a length of 80 bp as shown in SEQ ID NO.5, the pea is a crack-resistant genotype.

Images