Molecular marker of rice cold-resistant gene and application of molecular marker

Abstract

The invention discloses a molecular marker of a rice cold-resistant gene and application thereof, and relates to the field of rice breeding. The molecular marker is located in a promoter region (-307-364) of a rice seedling stage cold-resistant gene LTSS9a (LOCOs09g21710). The invention provides a primer for detecting the molecular marker of the rice seedling stage cold-resistant gene and a kit comprising the primer. The invention also provides application of the molecular marker in identifying the cold resistance of the rice in the seedling stage and a method for identifying the cold resistance of the rice in the seedling stage. The molecular marker provided by the invention has high accuracy and genetic stability, is stable in performance under different generations and environmental conditions, and is not easy to mutate; the method is simple and convenient to operate and visual in result, and can be used for rapidly identifying the rice seedling-stage cold-resistant variety, so that a powerful tool is provided for research on rice cold resistance, and the problem of rice yield reduction caused by low-temperature cold damage is effectively solved.

Description

Technical Field

[0001] The invention relates to the field of rice breeding, and in particular to molecular markers of rice cold-resistance genes and applications. Background Art

[0002] Due to the intensification of global climate change, the frequency of cold damage in my country's rice production areas has increased in recent years, posing a serious threat to the high and stable yield of rice. Especially in my country's southern rice-growing areas, with the rapid promotion of simplified direct seeding technology, rice growth and development in the early stage is often affected by continuous low temperature and rainy weather, resulting in stunted development of rice seedlings, and in severe cases, rotten seedlings and dead seedlings, affecting rice yield. Therefore, it is urgent to select excellent cold-resistant rice varieties from rice seed resources to effectively reduce the impact of low temperature and cold damage on rice production. Using molecular markers closely linked to the target gene, plants containing the target gene can be accurately screened, and the transfer and polymerization of favorable genes can be quickly and efficiently achieved, accelerating the cold-resistant breeding process of rice, which is a problem that needs to be solved by technicians in this field. Summary of the invention

[0003] The present invention provides a molecular marker of a rice cold-resistance gene and its application. The molecular marker provided by the present invention can screen out cold-resistance rice varieties at the seedling stage, effectively solving the problem of reduced rice yield due to low temperature and chilling damage.

[0004] To achieve the above purpose, the technical solution adopted by the present invention to solve its technical problem is: providing a molecular marker of rice cold-tolerant gene, which is InDel molecular marker, located at (-307~-364) in the promoter region of rice seedling cold-tolerant gene LTSS9a, and the nucleotide sequence is shown in SEQ ID No: 1.

[0005] Furthermore, the identifier of the rice seedling cold-tolerance gene LTSS9a is LOC_Os09g21710.

[0006] A primer pair for detecting the molecular markers of the above rice cold-tolerant gene.

[0007] Furthermore, the forward primer and the reverse primer of the primer pair are shown as SEQ ID No: 2 and SEQ ID No: 3, respectively.

[0008] A kit comprises the above primer pair.

[0009] Application of the above molecular markers, primer pairs or kits in identifying cold tolerance of rice seedlings.

[0010] A method for identifying cold tolerance of rice at the seedling stage comprises the following steps:

[0011] S1. Extract genomic DNA of the sample to be tested;

[0012] S2, using the genomic DNA described in step S1 as a template, and performing PCR amplification using the primer pair described in claim 2 to obtain a PCR product;

[0013] S3. Performing agarose gel electrophoresis on the PCR product obtained in step S2, and determining the cold tolerance of the rice variety according to the electrophoresis result.

[0014] Furthermore, in step S2, the PCR amplification system includes 5 μL 2×PCR Mix, 0.5 μL forward primer, 0.5 μL reverse primer, 1 μL template DNA and 3 μL water.

[0015] Furthermore, in step S2, the PCR amplification program is preheating at 95°C for 3 min; 34 cycles: 95°C for 20 s, 55°C for 20 s, and 72°C for 20 s; and finally extension at 72°C for 5 min.

[0016] Further, in step S3, 5% agarose gel electrophoresis is performed at 350-380V for 15-20min.

[0017] Further, in step S3, if the obtained band is a lower band with a length of 58 bp, it is determined to be a cold-resistant rice variety; if the obtained band is an upper band with a length of 75 bp, it is determined to be a cold-sensitive rice variety.

[0018] Furthermore, the nucleotide sequence of the cold-tolerant rice variety is shown in SEQ ID NO.1, with a total length of 58 bp.

[0019] Furthermore, the nucleotide sequence of the cold-sensitive rice variety is shown in SEQ ID NO. 4, with a total length of 75 bp.

[0020] The method for identifying cold tolerance of rice at the seedling stage is used in screening or auxiliary screening of cold-tolerant rice varieties.

[0021] A molecular marker breeding method for screening cold-resistant rice comprises the following steps: using the above-mentioned cold-resistant rice variety as a parent for breeding, using the above-mentioned method for identifying cold resistance of rice seedlings to identify the cold resistance of hybrids obtained by breeding, and screening hybrids with cold resistance.

[0022] The present invention has the following beneficial effects:

[0023] 1. The InDel molecular marker developed by the present invention designs specific primers based on the insertion / deletion (InDel) sites in the genome and detects them by PCR amplification. The marker has the characteristics of high accuracy, excellent stability and high resolution, can accurately identify the target gene fragment, and ensure reliable results; it performs consistently in different samples, with a low genetic variation rate; it can effectively distinguish subtle differences, and has excellent resolution. In addition, the experimental cost is more economical, suitable for large-scale applications, and the requirements for the quality of the DNA template are relatively loose, and it has stronger adaptability. Compared with SSR (simple sequence repeat) markers, InDel markers are more widely distributed and denser in the genome; compared with SNP (single nucleotide polymorphism) markers, InDel marker detection is simpler and faster, and typing can be completed only by electrophoresis, with low requirements for instruments and techniques, and is suitable for routine laboratory operations.

[0024] 2. The present invention developed the InDel9a molecular marker for the promoter region (-307 to -364 sites) of the rice cold-tolerant gene LTSS9a, and designed corresponding specific primers for identifying the cold tolerance of rice seedlings. The experimental results showed that the PCR product of the cold-tolerant variety showed a lower band with a size of 58 bp, while the PCR product of the cold-sensitive variety showed an upper band with a size of 75 bp. This shows that the primers designed by the present invention can specifically amplify the fragment of the LTSS9a gene, and clearly distinguish the cold tolerance of rice germplasm resources through electrophoresis analysis, thereby providing a powerful tool for the study of rice cold tolerance.

[0025] 3. In practical applications, the molecular markers provided by the present invention perform well, have high accuracy and genetic stability, are stable under different generations and environmental conditions, and are not prone to mutation; the operation is simple, the results are intuitive, and they are suitable for rapid identification; the amplified product has clear banding patterns, which are easy to analyze, and are particularly suitable for the breeding of cold-resistant rice varieties. In summary, the molecular markers provided by the present invention not only have excellent accuracy and stability, but also can play an important role in the breeding of cold-resistant rice varieties. It is an efficient, simple and reliable molecular marker technology, and its unique performance makes it have broad application prospects and important scientific value in the field of agricultural biotechnology. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 This is the electrophoresis result of PCR amplification products;

[0027] Figure 2 This is the electrophoresis result of PCR amplification products;

[0028] Figure 3 This is the cold tolerance phenotype of the rice germplasm to be tested at the seedling stage. DETAILED DESCRIPTION

[0029] The principles and features of the present invention are described below, and the examples are only used to explain the present invention and are not used to limit the scope of the present invention. If no specific conditions are specified in the embodiments, they are carried out according to normal conditions or conditions recommended by the manufacturer. If the manufacturer of the reagents or instruments is not specified, they are all conventional products that can be purchased commercially.

[0030] Example 1 Development of Molecular Markers and Primers for Identifying the Cold Tolerance Gene LTSS9a in Rice Seedlings

[0031] The genome sequences of the cold-tolerant gene LTSS9a in the cold-tolerant common wild rice in Dongxiang, Jiangxi and the cold-sensitive Guichao No. 2 were amplified and sequenced by Sanger sequencing. The sequencing results were spliced ​​and compared. It was found that compared with Guichao No. 2, the common wild rice in Dongxiang, Jiangxi had a deletion in the promoter (-307 to 364) of the cold-tolerant gene LTSS9a, and the length of the deleted sequence was 17 bp. Therefore, primers were designed according to the sequence (forward primer: 5'-GACTCACTCACATATGCTGC-3' (SEQ ID NO.2); reverse primer: 5'-GAGACCGAGTCGGATTTGG-3' (SEQ ID NO.3)). The amplified product of the common wild rice in Dongxiang, Jiangxi was 58 bp, and the amplified product of Guichao No. 2 was 75 bp. The PCR products were subjected to 5% agarose gel electrophoresis, and the results are as follows: Figure 1 shown. Figure 1 In the figure, “i” represents the insertion of 17 bp, and “d” represents the deletion of 17 bp. GC2: cold-sensitive indica rice variety Guichao 2, DXCWR: cold-tolerant common wild rice from Dongxiang, Jiangxi.

[0032] Depend on Figure 1 It can be seen that the cold-tolerant Jiangxi Dongxiang common wild rice is the lower band with a 17bp deletion, and the cold-sensitive Guichao No. 2 is the upper band with a 17bp insertion. The amplified product was sequenced by Sanger, and it was found that the cold-tolerant Jiangxi Dongxiang common wild rice has the nucleotide sequence (58bp) shown in SEQ ID NO.1, and the cold-sensitive Guichao No. 2 has the nucleotide sequence (75bp) shown in SEQ ID NO.4. The specific bands of the cold-tolerant gene can be distinguished by electrophoresis.

[0033] SEQ ID NO.1:

[0034] GACTCACTCACATATGCTGCCTTCGACCCCCAAACACCCCCAAATCCGACTCGGTCTC

[0035] SEQ ID NO.4:

[0036] GACTCACTCACATATGCTGCCTTGAGTGCCTTCGACGGTTCGACCCCCAAACACCCCCAAATCCGACTCGGTCTC

[0037] The primer sequences developed for the above molecular markers are as follows:

[0038] Forward primer: 5'-GACTCACTCACATATGCTGC-3' (SEQ ID NO. 2);

[0039] Reverse primer: 5'-GAGACCGAGTCGGATTTGG-3' (SEQ ID NO. 3)

[0040] Therefore, the rice germplasm genome is amplified according to the above primer set, and the band pattern is detected by electrophoresis to determine the cold tolerance of rice.

[0041] Example 2 Identification of cold tolerance of rice seedlings using the above molecular markers

[0042] 1. Extraction of rice genomic DNA

[0043] The leaves of rice germplasm were taken and their genomic DNA was extracted using the CTAB method.

[0044] 2. PCR Amplification

[0045] Using the rice genomic DNA to be tested as a template, PCR amplification was performed using the following primer pairs to obtain the amplified product.

[0046] The primer sequences are as follows:

[0047] Forward primer: 5'-GACTCACTCACATATGCTGC-3' (SEQ ID NO. 2);

[0048] Reverse primer: 5'-GAGACCGAGTCGGATTTGG-3' (SEQ ID NO. 3)

[0049] The PCR amplification system was: 2×PCR Mix 5 μL, F primer 0.5 μL, R primer 0.5 μL, template DNA 1 μL, water 3 μL;

[0050] The PCR amplification program was as follows: preheating at 95°C for 3 min; 34 cycles: 95°C for 20 s, 55°C for 20 s, and 72°C for 20 s; and finally extension at 72°C for 5 min.

[0051] 3. Electrophoresis Identification

[0052] The PCR product obtained by the above amplification was subjected to electrophoresis using 5% agarose gel and the results were detected using a gel imaging system. The electrophoresis results were as follows: Figure 2 shown. Figure 2 In the figure, “i” represents insertion of 17 bp, “d” represents deletion of 17 bp, and X78, X1, etc. are the numbers of the rice germplasms to be tested.

[0053] Now we select some test results from the test results of various samples to be tested for illustration. The electrophoresis test results are shown in Figure 2 The sample description corresponding to the electrophoresis result is shown in Table 1.

[0054] Table 1 Material information

[0055]

[0056]

[0057] Depend on Figure 2 As shown in Table 1, the lower band (denoted as "d") of the electrophoresis bands of rice varieties X1, X69, X102, X101, X180, X208, X117, X131, X116, X9, X24, X242, X133, X136, X139, X141, X106, X228, X109, X309, X97 and X285 lacks a 17 bp sequence, so these varieties should be cold-tolerant rice varieties. The upper band (denoted as "i") of the electrophoresis bands of rice varieties X78, X270, X25, X144, X12, X77, X3, X83, X81, X96, X170, X352, X353 and X354 has an insertion of a 17 bp sequence, so these varieties should be cold-sensitive rice varieties.

[0058] Example 3 Verification

[0059] In order to verify the accuracy of the identification results in Example 2, the above-mentioned rice varieties to be tested, X78, X1, X69, X102, X270, X101, X25, X180, X208, X117, X131, X116, X9, X24, X242, X133, X136, X139, X141, X106, X228, X144, X109, X309, X12, X77, X97, X285, X3, X83, X81, X96, X170, X352, X353 and X354, were subjected to cold tolerance treatment at the seedling stage, as follows:

[0060] Rice varieties from 18 different countries were treated with cold tolerance at the seedling stage. The selected healthy and plump seeds were placed in a 42°C oven for 2 days to break dormancy, and the seeds were disinfected in a 20% sodium hypochlorite solution for 20 minutes. The disinfected seeds were rinsed with water 3-4 times, and the seeds were placed in a 37°C incubator for 2 days, with the water changed once a day. The white seeds were placed in a 96-well black PCR plate with the bottom removed, with the white facing up, and cultured in a 28°C artificial climate chamber (14 hours of light and 10 hours of darkness) with deionized water, and the deionized water was changed every 2 days. When the plants grew to the 1-leaf 1-heart stage, they were replaced with a 1 / 3 concentration of nutrient solution (the volume ratio of nutrient solution: water = 1:2). When the plants grew to the 2-leaf 1-heart stage, they were replaced with full nutrient solution and placed in a low-temperature incubator for a certain period of time (treatment conditions for japonica rice: 4°C for 5 days, 28°C for 7 days of recovery; treatment conditions for indica rice: 10°C for 10 days, 28°C for 7 days of recovery), and the phenotypes were counted (survival seedling rate % = number of surviving seedlings after recovery / total number of treated seedlings × 100%). The results of phenotypic identification are shown in Tables 2 and Figure 3 shown. Figure 3 In the figure, from top to bottom are the phenotype of japonica rice before treatment, the phenotype of japonica rice after treatment at 4℃ for 5 days and recovery at 28℃ for 7 days, the phenotype of indica rice before treatment, and the phenotype of indica rice after treatment at 10℃ for 10 days and recovery at 28℃ for 7 days. The scale is 5 cm.

[0061] Table 2 Genotypes and cold-tolerant phenotypes of materials

[0062]

[0063]

[0064] As shown in Table 2, the survival rates of rice varieties X1, X69, X102, X101, X180, X208, X117, X131, X116, X9, X24, X242, X133, X136, X139, X141, X106, X228, X109, X309, X97 and X285 after cold treatment were all above 60%, and they were cold-tolerant rice varieties. However, the survival rates of rice varieties X78, X270, X25, X144, X12, X77, X3, X83, X81, X96, X170, X352, X353 and X354 after cold treatment were all below 35%, and they were cold-sensitive rice varieties. This result is consistent with the result of identification using molecular markers in Example 2, indicating that the molecular markers, primers and identification method provided by the present invention can specifically identify the cold tolerance of rice seedlings, providing practical value for cold tolerance breeding of rice.

[0065] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims

1. A molecular marker for a cold-tolerant gene in rice, characterized in that: The molecular marker of the rice cold-tolerant gene is an InDel molecular marker, which is located at (-307 to -364) of the promoter region of the rice seedling cold-tolerant gene LTSS9a, and the nucleotide sequence is shown in SEQ ID No:

1.

2. A primer pair for detecting the molecular marker of the rice cold-tolerant gene according to claim 1.

3. The primer pair according to claim 2, characterized in that The forward primer and the reverse primer of the primer pair are shown as SEQ ID No: 2 and SEQ ID No: 3 respectively.

4. A kit, characterized in that: Comprising the primer pair described in claim 2 or 3.

5. Use of the molecular marker according to claim 1, the primer pair according to any one of claims 2 to 3, or the kit according to claim 4 in identifying cold tolerance of rice seedlings.

6. A method for identifying cold tolerance of rice seedlings, characterized in that: The following steps are involved: S1. Extract genomic DNA of the sample to be tested; S2, using the genomic DNA described in step S1 as a template, and performing PCR amplification using the primer pair described in claim 2 to obtain a PCR product; S3. Performing agarose gel electrophoresis on the PCR product obtained in step S2, and determining the cold tolerance of the rice variety according to the electrophoresis result.

7. The method for identifying cold tolerance of rice seedlings according to claim 6, characterized in that: In step S2, the PCR amplification system includes 5 μL 2×PCR Mix, 0.5 μL forward primer, 0.5 μL reverse primer, 1 μL template DNA and 3 μL water; The PCR amplification program was as follows: preheating at 95°C for 3 min; 34 cycles: 95°C for 20 s, 55°C for 20 s, and 72°C for 20 s; and finally extension at 72°C for 5 min.

8. The method for identifying cold tolerance of rice seedlings according to claim 6, characterized in that: In step S3, 5% agarose gel electrophoresis was performed at 350-380 V for 15-20 min.

9. The method for identifying cold tolerance of rice seedlings according to claim 6, characterized in that: In step S3, if the obtained band is a lower band with a length of 58 bp, it is determined to be a cold-resistant rice variety; if the obtained band is an upper band with a length of 75 bp, it is determined to be a cold-sensitive rice variety.

10. Use of the method for identifying cold tolerance of rice at the seedling stage according to any one of claims 6 to 9 in screening or assisting in screening of cold-tolerant rice varieties.

Images