Application of taap01 protein or its encoding gene in regulating wheat phenotype and yield

Abstract

The present application relates to the technical field of plant molecular biology, and particularly relates to application of TaAPO1 protein or a coding gene thereof in regulating wheat phenotype and yield. TaAPO1 The present application provides a new idea for improving wheat yield, widens molecular regulation technical means of wheat development, and has wide market application prospect.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of plant molecular biology, and particularly relates to application of TaAPO1 protein or a coding gene thereof in regulating wheat phenotype and yield. BACKGROUND

[0002] Wheat is the second largest food crop after rice, and is the staple food of 35% to 40% of the world's population, so it is crucial to analyze the genetic and molecular mechanisms of regulating wheat yield formation. The three elements of wheat yield are the number of spikes per unit area, the number of grains per spike, and the grain weight, wherein the number of grains per spike and the grain weight are mainly controlled by the development of spike type, and are the final embodiment of floret differentiation, development and fruiting, so the research on wheat spike and grain development is of great significance. However, due to the allohexaploid characteristics of wheat, and the homologous gene duplication, functional redundancy and differentiation, expression silencing and the like generated in the process of polyploidization, the research on wheat spike development is relatively lagging behind.

[0003] The F-box gene family is one of the largest and fastest evolving gene / protein families in the plant kingdom, and is a class of genes that play an important role in the growth and development of plants, and plays an important role in regulating the transition of plant growth and reproductive stages, flower organ and grain development and other development processes. At present, the structure and function of the F-box gene family in wheat are rarely analyzed and researched, and the biological function and molecular mechanism of the gene family in wheat are not clear. SUMMARY

[0004] The present application discloses a gene capable of regulating wheat phenotype and yield from the F-box gene family, which is TaAPO1 a gene, and based on this, the following technical scheme is proposed.

[0005] Firstly, the present application provides application of TaAPO1 protein or a fusion protein of TaAPO1 protein, or a coding gene thereof, or a biological material containing the coding gene thereof in regulating wheat phenotype; the amino acid sequence of the TaAPO1 protein is at least one of the following:

[0006] (a) the sequence represented by any one of SEQ ID No. 1 to SEQ ID No. 3;

[0007] (b) a sequence obtained by substitution, and / or deletion, and / or addition of one or more amino acid residues in the sequence represented by any one of SEQ ID No. 1 to SEQ ID No. 3 and having the function of regulating wheat phenotype.

[0008] In some embodiments, the fusion protein is an amino acid sequence obtained by connecting a tag, an enzyme cutting site and / or a connecting peptide sequence to the N-terminus and / or the C-terminus of the amino acid sequence represented by SEQ ID No. 1.

[0009] In the art, when a substitution is made with an amino acid having similar or similar performance, the function of the protein is usually not changed; adding one or several amino acids at the C-terminal and / or N-terminal usually does not change the function of the protein.

[0010] In the present application, the wheat phenotype includes at least one of the following aspects: plant height, ear length, number of spikelets per ear, grain length, grain width, thousand-grain weight, and number of grains per ear.

[0011] Meanwhile, the present application provides an application of the TaAPO1 protein or the fusion protein of the TaAPO1 protein, or a coding gene thereof, or a biological material containing the coding gene thereof in regulating the yield of wheat; the amino acid sequence of the TaAPO1 protein is at least one of the following:

[0012] (a) a sequence shown in any one of SEQ ID No. 1~ SEQ ID No. 3;

[0013] (b) a sequence obtained by substituting, and / or deleting, and / or adding one or several amino acid residues in the sequence shown in any one of SEQ ID No. 1~ SEQ ID No. 3 and having the function of regulating the yield of wheat.

[0014] The present application finds that, TaAPO1 The yield of wheat is regulated by regulating the plant height, ear length, number of spikelets per ear, grain length, grain width, thousand-grain weight, and number of grains per ear.

[0015] Further, the present application provides an application of the TaAPO1 protein or the fusion protein of the TaAPO1 protein, or a coding gene thereof, or a biological material containing the coding gene thereof in improving the wheat variety; the amino acid sequence of the TaAPO1 protein is at least one of the following:

[0016] (a) a sequence shown in any one of SEQ ID No. 1~ SEQ ID No. 3;

[0017] (b) a sequence obtained by substituting, and / or deleting, and / or adding one or several amino acid residues in the sequence shown in any one of SEQ ID No. 1~ SEQ ID No. 3 and having the function of regulating the phenotype or yield of wheat.

[0018] Preferably, the improvement of the wheat variety is carried out by means of transgenosis, hybridization, backcrossing, selfing, or vegetative propagation.

[0019] Preferably, the amino acid sequence of the TaAPO1 protein is any one of the sequences shown in SEQ ID No. 7, SEQ ID No. 8, SEQ ID No. 11, SEQ ID No. 12, SEQ ID No. 13.

[0020] Preferably, the coding gene of the TaAPO1 protein is at least one of the following:

[0021] (a) the sequence shown in any one of SEQ ID No. 4~6;

[0022] (b) a DNA molecule capable of affecting the phenotype or yield of wheat formed by one to several base substitutions and / or one to several base insertions and / or deletions or large fragment nucleotide sequence insertions / deletions / transpositions / inversions based on any one of SEQ ID No. 4~6.

[0023] More preferably, the coding gene of the TaAPO1 protein is any one of the sequences shown in SEQ ID No. 9, SEQ ID No. 10, SEQ ID No. 14, SEQ ID No. 15, SEQ ID No. 16.

[0024] In specific implementation, the biological material is recombinant DNA, expression cassette, transposon, plasmid vector, viral vector, engineered bacteria or non-renewable plant cells or tissues.

[0025] In specific implementation, the phenotype of wheat or the yield of wheat can be regulated by adjusting the expression amount or activity of the TaAPO1 protein or gene.

[0026] In specific implementation, the expression amount or activity of the TaAPO1 protein or gene can be adjusted by hybridization technology, transgenic technology or gene editing technology.

[0027] Compared with the prior art, the beneficial effects of the present application are:

[0028] The present application first discovers that TaAPO1 The gene regulates the yield of wheat by regulating the development of spikes and grains of wheat, and provides a new idea for improving the yield of wheat, broadens the molecular regulation technology means of wheat development, and has a broad market application prospect. BRIEF DESCRIPTION OF DRAWINGS

[0029] Figure 1 is TaAPO1 Target site design position map of the gene.

[0030] Figure 2 is the test result map of the plant height, spike length and number of spikelets per spike of wheat.

[0031] Figure 3 is a chart of test results of grain length, grain width, number of grains per spike and 1000-grain weight of wheat.

[0032] Figure 4 is TaAPO1 a chart of specific expression of the gene in each tissue of wheat.

[0033] Figure 5 is TaAPO1 expression of the gene in spike primordium. DETAILED DESCRIPTION

[0034] In order to make the objectives, technical solutions and advantages of the present application clearer, the technical solutions in the present application will be clearly and completely described below. Obviously, the described embodiments are some of the embodiments of the present application, rather than all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those of ordinary skill in the art without creative work fall within the protection scope of the present application.

[0035] The experimental methods used in the following examples are conventional methods unless otherwise specified. The materials, reagents, etc. used in the following examples can be obtained from commercial channels unless otherwise specified.

[0036] The present application relates to molecular biology experiments. Unless otherwise specified, reference can be made to the book Molecular Cloning (J. Sambrook, E.F. Fritsch, T. Maniatis, Science Press, 1994). The book and its subsequent published versions are the most commonly used and instructive reference books for those skilled in the art when performing experimental operations related to molecular biology. In addition, according to different experimental purposes, those skilled in the art can complete the corresponding experiments under the guidance of the operation manuals attached to various commercial kits (Kit) or entrust specialized companies to perform, such as gene sequencing.

[0037] Example 1 Construction and detection of gene editing strain

[0038] The wheat of the present embodiment TaAPO1 The construction method of the gene editing strain is as follows:

[0039] 1. sgRNA target site selection: Select appropriate sgRNA on the CRISPR design website (http: / / www.e crisp.org / E CRISP / CRISP / ), wherein the nucleotide sequence of the sgRNA action site is target 1: 5'-CTCCCGACGCCGTCCTTCCTCCGCGCCCGCG-3' and target 2: 5'-CGTTCCTCTCCGACGCGTCCGGCCACAAGACGCT-3', and the efficiency and specificity are considered for screening. The sgRNA is aligned with the sequence of the wheat genome by using the BLAST function in Ensembl Plants, and a specific fragment is selected.

[0040] 2. Design primers for connecting vectors according to sgRNA, use APO1-411-CRISPR-F, APO1-411-CRISPR-R, APO1-411-CRISPR-F0, APO1-411-CRISPR-R0 to amplify the sequence with the target site, the concentration of F / R primers is 10 μM, F0 / R0 is diluted 20 times, and the primers are mixed with the intermediate vector. Primer sequences are as follows:

[0041] APO1-411-CRISPR-F: (SEQ ID No. 17)

[0042] AATAATGGTCTCTGGCGACCTGCAACTCCAACTCACAGG

[0043] APO1-411-CRISPR-F0: (SEQ ID No. 18) GACCTGCAACTCCAACTCACAGGGTTTTAGAGCTAGAAATAGC

[0044] APO1-411-CRISPR-R0: (SEQ ID No. 19) GCTTGAGGGATGCATCTATTTGGCGCTTCTTGGTGCC

[0045] APO1-411-CRISPR-R: (SEQ ID No. 20)

[0046] ATTATTGGTCTCTAAACCCAAATAGATGCATCCCTCAAGC

[0047] 3. Use the connection system as shown in Table 1.

[0048] Table 1

[0049]

[0050] 4. Add 5 μL of product to 50 μL of competent cells for transformation, and detect using F / R primers.

[0051] TaAPO1 Gene target site design location, such as Figure 1 As shown. According to TaAPO1 Primers TaAPO1-AF / TaAPO1-AR, TaAPO1-BF / TaAPO1-BR, and TaAPO1-DF / TaAPO1-DR were designed based on the gene target site sequence, as shown in SEQ ID Nos. 21-26, respectively. The PCR system used is shown in Table 2. 10 μL of the product was subjected to 1.2% agarose gel electrophoresis, and the remaining product was sequenced.

[0052] Table 2

[0053]

[0054] The wheat in this embodiment TaAPO1 The results of gene-edited strain identification are shown in Table 3.

[0055] Table 3

[0056]

[0057] The amino acid sequence of the wild-type TaAPO1-A protein is shown in SEQ ID No. 1, and the gene sequence is shown in SEQ ID No. 4; the amino acid sequence of the wild-type TaAPO1-B protein is shown in SEQ ID No. 2, and the gene sequence is shown in SEQ ID No. 5; the amino acid sequence of the wild-type TaAPO1-D protein is shown in SEQ ID No. 3, and the gene sequence is shown in SEQ ID No. 6. The amino acid sequence of TaAPO1-A protein of strain one is shown in SEQ ID No. 7, and the gene sequence is shown in SEQ ID No. 9; the amino acid sequence of TaAPO1-B protein of strain one is shown in SEQ ID No. 8, and the gene sequence is shown in SEQ ID No. 10; the amino acid sequence of TaAPO1-A protein of strain two is shown in SEQ ID No. 11, and the gene sequence is shown in SEQ ID No. 14; the amino acid sequence of TaAPO1-B protein of strain two is shown in SEQ ID No. 12, and the gene sequence is shown in SEQ ID No. 15; the amino acid sequence of TaAPO1-D protein of strain two is shown in SEQ ID No. 13, and the gene sequence is shown in SEQ ID No. 16.

[0058] Example 2: Phenotypic Statistics of Gene-Edited Lines

[0059] Select wild type wheat plants and gene editing lines of Example 1, each type 2 single plants, the phenotype statistics and photograph record of plant height, ear length, number of spikelets per ear, grain length, grain width, number of grains per ear and thousand grain weight, grain phenotype is counted by Wanshen SC-G automatic seed analysis and thousand grain weight system software, the obtained data is analyzed by Graphpad Prism Version software.

[0060] The test results of plant height, ear length and number of spikelets per ear are shown in Figure 2 Compared with wild type wheat plants, the plant height, ear length and number of spikelets per ear of gene editing lines are significantly reduced or shortened.

[0061] The test results of grain length, grain width, number of grains per ear and thousand grain weight are shown in Figure 3 Compared with wild type wheat plants, the grain length, grain width, number of grains per ear and thousand grain weight of gene editing lines are significantly reduced or decreased.

[0062] Example 3 in situ hybridization detection TaAPO1 Expression in young ear

[0063] I. Material fixation and embedding:

[0064] Prepare materials: freshly prepared plant tissue fixing solution, 180℃ high temperature sterilized scissors, tweezers, wax cup, wax bowl and RNase-free centrifuge tube, etc. Prepare medicines (all are special for RNA experiments, without RNase): DEPC water, glacial acetic acid, ethanol, formaldehyde, xylene, chloroform, wax block.

[0065] Material fixation: select fresh wheat plants, use high temperature sterilized scissors and tweezers and other tools to remove the leaves wrapped around the young ear of the plant, leaving only a few tender leaves to protect the young ear, and then put it into the freshly prepared formalin-acetic acid-ethanol fixing solution, then slowly release the gas after vacuum pumping for 15 minutes, repeat 2-3 times until the material sinks to the bottom, replace the fresh fixing solution, and store in 4℃ refrigerator overnight. Fixing solution formula (50% FAA): 100% anhydrous ethanol 50 mL (final concentration 50%), 100% glacial acetic acid 5 mL (final concentration 5%), 37% formaldehyde 10 mL (final concentration 3.7%) and DEPC water 35 mL.

[0066] Dehydration, transparency: Place sample in freshly prepared ethanol of different concentration gradient, 50%, 70%, 80%, 90%, 95%, 100%, 100%, 100%, 30 minutes each. Move sample to different gradient of xylene solution, 25% xylene / 75% ethanol, 40 minutes, 50% xylene / 50% ethanol, 40 minutes, 75% xylene / 25% ethanol, 40 minutes, 100% xylene, 1 hour, 100% xylene, 1 hour, 100% xylene, 1 hour. Finally, move sample to 10% chloroform / 90% xylene solution, add about 20 pieces of wax sheet, and place in fume hood overnight.

[0067] Wax immersion: Place sample in a 42°C incubator to melt the wax block, then add new wax block, melt completely at 42°C, add a small amount of wax sheet several times until the wax sheet no longer melts. Pour out the wax liquid in the container, pour into the pre-melted 60°C new wax liquid, and place in a 60°C incubator overnight. After 2-3 days: repeat the wax replacement. Replace the new wax liquid every 12 hours or so.

[0068] Embedding: Pour fresh wax liquid into the stacked paper box, place the material neatly, and then place in cold water to promote coagulation after the surface of the wax liquid coagulates. After the wax block is completely coagulated, dry and store at 4°C.

[0069] II. Sectioning

[0070] Trim the wax block into a columnar shape with a blade, and stick the trimmed wax block to the anvil. Set the thickness of the microtome to 8 pm. Place the cut wax tape in 42°C DEPC water, and then place it on a glass slide after the wax tape is flat. Use a water-absorbing paper to absorb the residual water, and then place the glass slide in a baking machine to dry. Then transfer to a 42°C incubator for continuous drying for 2-3 days.

[0071] III. Probe preparation

[0072] The gene-specific fragments are ligated to the pGEMT-easy (Promega, USA) vector, according to the gene sequence and the enzyme cutting site on the vector, the sense probe and the antisense probe are respectively T7 reverse transcriptase, and the plasmid is cut. After extracting the plasmid, the corresponding enzyme is used for enzyme cutting, and agarose gel electrophoresis is used to detect whether the enzyme cutting is complete. After enzyme cutting, equal volume of chloroform is added for extraction, centrifuged at 12000 rpm for 5 minutes, and the supernatant is taken to the centrifugal tube. Equal volume of chloroform is added for extraction again, centrifuged at 12000 rpm for 5 minutes at 4°C, and the supernatant is taken to the centrifugal tube. Repeat the chloroform extraction once, and take the supernatant. Add 3 M sodium acetate solution to the above water phase to make the final concentration 0.3 M, and then add 2 times volume of pre-cooled anhydrous ethanol, and place at -20°C overnight. After taking out the sample, centrifuge at 12000 rpm for 10 minutes at 4°C, and discard the supernatant. Add 500 microliters of 70% ethanol solution, centrifuge at 12000 rpm for 5 minutes at 4°C, and discard the supernatant; repeat once. After removing the residual liquid with a gun head, air dry and dissolve in an appropriate amount of DEPC water. The primer sequences used in the preparation of the probe are shown in SEQ ID No. 27~30, which are YW-APO1-F, YW-APO1-R, YW-APO1-F-T7 and YW-APO1-R-T7.

[0073] IV. In vitro transcription

[0074] In vitro transcription refers to the Roche DIG RNA Labeling Kit (Roche, Switzerland) instructions and according to the experiment slightly modified, all materials and drugs are RNase-free. The steps are as follows: add the following system to the RNase-free centrifuge tube: DNA 1 microgram and add DEPC water to 13 microliters. Then add the following reagents to the system: 10x NTP Labeling mixture 2 microliters, 10x transcription buffer 2 microliters, RNase inhibitor 1 microliter, RNA polymerase 2 microliters, mix gently and centrifuge, incubate at 37°C for 2 hours. Then add 2 microliters of DNase I, RNase-free, incubate at 37°C for 15 minutes, and add 2 microliters of 0.2 M EDTA (pH 8.0) to terminate the reaction. Then add 2.5 microliters of 4M LiCl and 75 microliters of pre-cooled anhydrous ethanol, mix well, and incubate at -20°C overnight. After centrifugation at 4°C, 12000 rpm for 20 minutes, discard the supernatant, add 500 microliters of 70% ethanol, centrifuge at 4°C, 12000 rpm for 5 minutes, discard the supernatant, and dry the residual liquid with a gun head. Finally, add DEPC water, detect the quality of the probe by gel electrophoresis, aliquot, and store at -80°C.

[0075] V. In situ hybridization

[0076] 1. Processing the section

[0077] 1) De-waxing and rehydrating. The sections were de-waxed in a gradient of xylene, 10 minutes in 100% xylene, 10 minutes in 100% xylene, 20 minutes in 75% xylene / 25% ethanol, and 10 minutes in 25% xylene / 75% ethanol.

[0078] The sections were rehydrated in a gradient of ethanol, 2 minutes in 100% ethanol, 2 minutes in 95% ethanol, 2 minutes in 80% ethanol, 2 minutes in 60% ethanol, and 2 minutes in 30% ethanol. Finally, the sections were placed in DEPC water for 2 minutes.

[0079] 2) The sections were treated in 0.25 M hydrochloric acid for 20 minutes.

[0080] 3) The sections were treated in DEPC water for 5 minutes.

[0081] 4) The sections were treated in 2x SSC solution for 20 minutes.

[0082] 5) The sections were treated in DEPC water for 5 minutes.

[0083] 6) The sections were moved to a 4 microgram / microliter solution of proteinase K, and incubated at 37°C for 30 minutes. Note that the proteinase K buffer should be pre-warmed, and the proteinase K added to the sections just prior to use.

[0084] 7) The sections were treated in lx PBS solution for 2 minutes.

[0085] 8) The sections were treated in 0.2% glycine (dissolved in lx PBS, made fresh) for 2 minutes.

[0086] 9) The sections were treated in lx PBS solution twice, for 2 minutes each time.

[0087] 10) The sections were treated in 4% formaldehyde solution (prepared in lx PBS) for 10 minutes.

[0088] 11) The sections were treated in lx PBS solution twice, for 5 minutes each time.

[0089] 12) To each 40 mL of lx PBS solution, 536 microliters of triethanolamine, 160 microliters of concentrated hydrochloric acid, and 200 microliters of acetic anhydride were added, and the sections were placed in the solution for 5 minutes.

[0090] 13) The sections were treated in lx PBS solution twice, for 5 minutes each time.

[0091] 2. Hybridization

[0092] 1) The hybridization solution and 50% formamide were pre-warmed at 80°C.

[0093] 2) Preparation of probe: 5 microliters of probe was added with 60 microliters of 50% formamide, and was denatured at 80°C water bath for 2 minutes, and was immediately placed on ice to prevent re-nature.

[0094] 3) 120 microliters of hybridization solution was added to the probe, and was mixed.

[0095] 4) The above solution was evenly coated on the corresponding glass slide, and was covered with sealing film, and was placed in a wet box.

[0096] 5) The wet box was placed in a 50°C constant temperature box overnight.

[0097] 3, washing of the slide

[0098] 1) The slide was placed in 0.2x SSC solution preheated at 50°C, and was incubated at 50°C for 1 hour, for two times.

[0099] 2) The slide was transferred to NTE solution preheated at 37°C, and was incubated at 37°C for 2 times, for 5 minutes each time.

[0100] 3) The slide was moved to 5 micrograms / microliter of RNase A solution (NTE preheated at 37°C), and was incubated at 37°C for 30 minutes.

[0101] 4) The slide was transferred to NTE solution preheated at 37°C, and was treated at 37°C for 2 times, for 5 minutes each time.

[0102] 5) The slide was placed in 0.2x SSC solution preheated at 50°C, and was incubated at 50°C for 1 hour.

[0103] 4, detection

[0104] 1) The slide was placed in 1x TBS solution, and was treated for 5 minutes.

[0105] 2) The slide was placed in 1% blocking solution, and was treated for 45 minutes.

[0106] 3) The slide was placed in BSA / Triton / TBS, and was treated for 45 minutes.

[0107] 4) 0.6 microliters of biotin antibody and 600 microliters of BSA / Triton / TBS solution were taken, and were evenly coated on each glass slide, and were covered with sealing film, and were placed in a wet box at room temperature, and were placed in the dark for 2 hours.

[0108] 5) The slide was treated in BSA / Triton / TBS solution for 15 minutes, for a total of 4 times.

[0109] 6) The slide was washed with TE H2O for 2 times, for 5 minutes each time.

[0110] 7) Add 2 μL NBT / BCIP and 100 μL TE H2O to each slide, cover with parafilm, and place in a humidified box at room temperature overnight in the dark.

[0111] 8) Observe and photograph under microscope.

[0112] Figure 4 For TaAPO1 Statistical graph of specific expression of genes in each tissue of wheat, Figure 5 For TaAPO1 Expression of genes in spike primordium.

[0113] Finally, it should be noted that the above examples are only used to illustrate the technical solutions of the present application, and are not limited thereto; although the present application has been described in detail with reference to the foregoing examples, those of ordinary skill in the art should understand that they can still modify the technical solutions recorded in the foregoing examples, or make equivalent replacements for some of the technical features; and these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present application.

Claims

1. TaAPO1 protein, or a gene encoding the same, or a biological material containing the gene encoding the same, for use in reducing the plant height of wheat; the amino acid sequence of the TaAPO1 protein is at least one of the following: (a) the sequence shown in SEQ ID No. 1; (b) the sequences shown in SEQ ID No. 1 and SEQ ID No. 3; the sequence shown in SEQ ID No. 1 is subjected to a frameshift mutation to reduce the plant height of wheat; the sequence shown in SEQ ID No. 3 is subjected to a premature termination to reduce the plant height of wheat. The gene encoding the TaAPO1 protein is at least one of the following: (a) the sequence shown in SEQ ID No. 4; (b) the sequences shown in SEQ ID No. 4 and SEQ ID No.

6. The biological material is a recombinant DNA, an expression cassette, a transposon, a plasmid vector, a viral vector, an engineered bacterium, or a non-regenerable plant cell or tissue. ​ ​ ​ ​ 2. Use according to claim 1, characterized in that, ​ ​ ​ 3. Use according to claim 1, characterized in that, ​

Images