Candida Zeoprini as well as application thereof in inhibition of botrytis cinerea and application thereof in wine brewing

Abstract

The invention provides a Candida Zeoprini strain and application thereof in inhibition of Botrytis cinerea and wine brewing, the number of the Candida Zeoprini strain is SIVE8902, the Candida Zeoprini strain is preserved in China Center for Type Culture Collection on July 22, 2024, the preservation number is CCTCC NO: M 20241637, the Latin name is Starmeria bacilli, the preservation number is CCTCC NO: M 20241637, the preservation number is CCTCC NO: M 20241637, and the preservation number is CCTCC NO: M 20241637. The bacterium has a relatively strong inhibition effect on botrytis cinerea in fresh grapes and vineyards, and can relieve the growth and reproduction of the botrytis cinerea in berries; meanwhile, compared with independent fermentation of the saccharomyces cerevisiae and sequential fermentation of the candida zerberi and the saccharomyces cerevisiae, p-vinylcresol and 4-ethyl-2-methoxyphenol are added, spice flavor and honey flavor are added to the wine, meanwhile, the total amount of volatile phenolic compounds in the wine is greatly increased, and the quality of the wine is improved.

Description

Technical Field

[0001] The invention relates to the technical field of microorganisms and winemaking, and in particular to a strain of Candida zeppelinii and its application in inhibiting gray mold and in winemaking. Background Art

[0002] Non-brew yeast is a type of microorganism with simple nutritional requirements, strong colonization ability and good genetic stability. After the grapes are harvested, non-brew yeast, as part of the microbial flora, produces a variety of volatile compounds such as esters, terpenes, alcohols, etc. during the wine fermentation process, which can enrich the composition of wine and is of great significance to the aroma and quality of wine.

[0003] Botrytis cinerea is a pathogen that causes gray mold disease in grapes under temperate climatic conditions. An outbreak of gray mold disease will affect the growth of grapes and cause a reduction in yield. The invasion of pathogens will affect the aroma and quality of the fruit, causing the brewed wine to have a musty smell and reduce the quality of the wine.

[0004] Botrytis cinerea mainly occurs during the growth, harvesting, storage and transportation stages of grapes. Currently, in order to prevent the outbreak of botrytis cinerea, chemical fungicides are usually used to prevent botrytis cinerea before and after grape picking to avoid the harm of botrytis cinerea. However, the long-term use of chemical fungicides will bring some disadvantages, such as environmental pollution, fungal resistance, etc., and chemical fungicide residues will have adverse effects on human health. Therefore, it is increasingly important to develop a method for preventing botrytis cinerea that is friendly to the ecological environment, safe to use, and sustainable for the prevention and control of botrytis cinerea in grapes.

[0005] Different types of non-brewery yeast have certain biocontrol and aroma-enhancing effects, but there are currently no studies on both the inhibition and aroma-enhancing effects on Botrytis cinerea. Therefore, it is of great significance to screen a non-brewery yeast that has the ability to inhibit Botrytis cinerea and improve the aroma quality of wine. Summary of the invention

[0006] In view of this, the present invention provides a strain of Candida zepplinii and its application in inhibiting Botrytis cinerea and its application in wine brewing. The Candida zepplinii is numbered SIVE8902 and has been deposited in the China Center for Type Culture Collection, abbreviated as CCTCC, on July 22, 2024; address: Wuhan University, Bayi Road, Wuchang District, Wuhan City, Hubei Province; postal code: 430072, the deposit number is CCTCC NO: M 20241637, the Latin name is Starmerella bacillarisThe strain SIVE8902 is Candida zeppelinii; it has a strong inhibitory effect on Botrytis cinerea in fresh grapes and in vineyards, and can reduce the growth and reproduction of Botrytis cinerea in berries; at the same time, compared with the fermentation of Saccharomyces cerevisiae alone, the sequential fermentation of Candida zeppelinii and Saccharomyces cerevisiae adds p-vinyl phenol and 4-ethyl-2-methoxyphenol, adding spicy and honey flavors to the wine, while greatly increasing the total amount of volatile phenolic compounds in the wine, thereby improving the quality of the wine.

[0007] The technical solution of the present invention is as follows: A strain of Candida zepplinii, numbered SIVE8902, was deposited in the China Center for Type Culture Collection, abbreviated as CCTCC, on July 22, 2024; address: Bayi Road, Wuchang District, Wuhan City, Hubei Province, Wuhan University; Postal Code: 430072, the deposit number is CCTCC NO: M 20241637, the Latin name Starmerella bacillaris ; The strain SIVE8902 can inhibit the growth and reproduction of gray mold; in addition, the strain SIVE8902 is fermented sequentially with brewer's yeast, and the resulting wine adds p-vinyl phenol and 4-ethyl-2-methoxyphenol, which adds spicy and honey flavors to the wine. At the same time, it greatly increases the total amount of volatile phenolic compounds in the wine and improves the quality of the wine.

[0008] Preferably, the strain is selected from Cabernet Gernischt grapes from Penglai, Yantai.

[0009] Application of a strain of Candida zeppelinii in inhibiting Botrytis cinerea.

[0010] Preferably, the above application is specifically the application of the bacterial suspension of strain SIVE8902 and / or the volatile compounds produced by strain SIVE8902 in inhibiting Botrytis cinerea.

[0011] When the bacterial suspension of strain SIVE8902 was used to inhibit Botrytis cinerea, in the plate antagonism experiment, the bacterial suspension effectively inhibited the growth and reproduction of Botrytis cinerea, and the inhibition rate reached 85.60±1.25%; when the volatile compounds produced by SIVE8902 were used to inhibit Botrytis cinerea, in the plate experiment, the volatile compounds were able to effectively inhibit the growth and reproduction of Botrytis cinerea, and the inhibition rate reached 93.27±0.42%.

[0012] Preferably, in the above application, the concentration of the bacterial suspension of strain SIVE8902 is 1×10 8 cells / ml.

[0013] Preferably, the preparation process of the bacterial suspension of strain SIVE8902 is: The strain SIVE8902 was inoculated into YPD liquid medium and cultured at a constant temperature of 28°C and a speed of 200 r / min for 24 h. The precipitate was collected by centrifugation at 6000 r / min for 5 min, washed with sterile water, and then resuspended with sterile water. The yeast concentration was adjusted to 1×10 by hemocytometer. 8 cells / ml to obtain a bacterial suspension.

[0014] Preferably, the application is specifically the application in grape berries; the concentration is 1×10 8 The application of the bacterial suspension of strain SIVE8902 with a concentration of 1×10 cells / ml in grape berries can inhibit the growth and reproduction of gray mold in grape berries, with a disease index of 22.33±1.57%, a disease incidence of 25.20±5.25%, and a lesion diameter of 0.55±0.04 cm, significantly reducing the disease index, disease incidence, and lesion diameter, and greatly reducing the number of rotten fruits; the concentration of 1×10 8 The volatile compounds of strain SIVE8902 with a concentration of 1×10 cells / ml were applied to grape berries to inhibit the growth and reproduction of gray mold in grape berries, with a disease index of 18.55±5.48%, a disease incidence of 12.35±5.77%, and a lesion diameter of 0.47±0.15 cm, significantly reducing the disease index, disease incidence, and lesion diameter, and greatly reducing the number of rotten fruits; the concentration of 1×10 8 In field trials, a suspension of strain SIVE8902 with a concentration of cells / ml was able to inhibit the growth and reproduction of gray mold in vineyards, with a disease incidence rate of only 5.77%±1.01%, greatly reducing the number of rotten fruits in the field.

[0015] The invention discloses an application of Candida zeppelinii in wine brewing, specifically, sequentially fermenting strain SIVE8902 and Saccharomyces cerevisiae EC1118 in wine brewing.

[0016] Preferably, the above application process is as follows: (1) Pour the grape juice into a container, then add dimethyl dicarbonate, mix well, and leave at room temperature for 4-5 hours; (2) Inoculating strain SIVE8902, and fermenting at controlled temperature for 48 h to obtain fermented mash; (3) Inoculating the fermented mash with Saccharomyces cerevisiae EC1118, and continuing the temperature-controlled fermentation until the weight loss of carbon dioxide release is less than 0.1 g / 100 mL, thereby obtaining a wine sample; (4) After the wine sample is clarified and separated by siphon method, 120 mg / L potassium metabisulfite is added and stored at low temperature until testing.

[0017] After sequential fermentation with strain SIVE8902 and brewer's yeast EC1118, the resulting wine aroma substances added p-vinyl phenol and 4-ethyl-2-methoxyphenol, adding spicy and honey flavors to the wine, while significantly increasing the total amount of volatile phenolic compounds in the wine and improving the quality of the wine.

[0018] Preferably, the inoculum size of strain SIVE8902 is 1×10 7 cells / ml; the inoculum size of Saccharomyces cerevisiae EC1118 was 1×10 6 cells / ml; the temperature of the controlled fermentation was 20±1℃.

[0019] Compared with the prior art, the beneficial effects of the present invention are: 1. The present invention provides a strain of Candida zepulinensis, numbered SIVE8902, which was deposited in the China Center for Type Culture Collection, referred to as CCTCC, on July 22, 2024; address: Wuhan University, Bayi Road, Wuchang District, Wuhan City, Hubei Province; postal code: 430072, the deposit number is CCTCC NO: M 20241637, and the Latin name is Starmerella bacillaris .

[0020] 2. The Candida zepuliensis provided by the present invention, its bacterial suspension and volatile compounds can respectively produce good inhibitory effects on the growth and reproduction of Botrytis cinerea, wherein the antibacterial rate of the bacterial suspension reaches 85.60±1.25%, and the antibacterial rate of the volatile compounds reaches 93.27±0.42%.

[0021] 3. The suspension of Candida zepulinensis and the volatile compounds provided by the present invention can inhibit the growth and reproduction of Botrytis cinerea in grape berries, effectively reduce the disease index, disease incidence and lesion diameter, and reduce the number of rotten fruits, thereby providing a biological control strategy for the inhibition of grape gray mold. Field trials of the Candida zepulinensis on grape gray mold showed that it had an inhibitory effect on gray mold in vineyards, reducing the disease incidence to only 5.77%±1.01%, greatly reducing the number of rotten fruits in the field.

[0022] 4. The sequential fermentation of the Candida zeppelinii and the Saccharomyces cerevisiae EC1118 provided by the present invention adds p-vinyl phenol and 4-ethyl-2-methoxyphenol to the obtained wine, which adds spicy and honey flavors to the wine, while greatly increasing the total amount of volatile phenolic compounds in the wine and improving the quality of the wine. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, for ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0024] Figure 1 The following is a photograph showing the inhibition of the bacterial suspension of Example 2 on Botrytis cinerea in a plate antagonism experiment.

[0025] Figure 2 This is a graph showing the inhibition results of the bacterial suspension and volatile compounds of Example 2 on Botrytis cinerea in a plate experiment.

[0026] Figure 3 This is a graph showing the results of an experiment in which the bacterial suspension in Example 3 inhibits Botrytis cinerea in grape berries.

[0027] Figure 4 This is a photograph of the experimental results of the inhibition of gray mold by volatile compounds in grape berries in Example 3.

[0028] Figure 5 This is a graph showing the results of an experimental experiment in Example 3 on the inhibition of gray mold by volatile compounds in grape berries.

[0029] Figure 6 This is a graph showing the diseased fruit rate in the field trial of Example 4.

[0030] Figure 7 This is a graph of the CO2 release rate during the fermentation process of Example 5. DETAILED DESCRIPTION

[0031] In order to enable those skilled in the art to better understand the technical solutions of the present invention, the technical solutions of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work should fall within the scope of protection of the present invention.

[0032] The culture medium components of the present invention are as follows: Potato dextrose agar medium (PDA): potato powder 6g / L; glucose 20g / L; agar 20g / L. Yeast nutrient medium (YPD): yeast extract powder 10g / L; peptone 20g / L; glucose 20g / L.

[0033] Example 1 Screening and identification of strain SIVE8902 (1) Strain isolation: Fresh Cabernet Gernischt grapes collected from Penglai, Yantai were crushed, 200 g were weighed and placed in a 500 mL triangular flask, the flask mouth was sealed with a breathable sealing film, and the flask was placed in a 28 °C biochemical incubator for enrichment for 3 days. After bubbles were generated, the fermentation liquid was taken out and diluted to 10 with sterile water. -4 , 100 μL of the dilution was evenly spread on WL solid medium, and cultured at 28°C for 48 h, and then the characteristics of the colonies were observed. Single colonies with different characteristics were selected for 2-3 times of plate streaking purification, and the obtained single colonies were inoculated into YPD liquid medium for culture. The strains were stored at -80°C for future use; (2) Strain identification: The genomic DNA of the pure strain was extracted using the kit extraction method, and the D1 / D2 region of 26S rDNA was amplified with primers NL1 (5'-GCATATCAATAAGCGGAGGAAAAG-3') and NL4 (5'-GGTCCGTGTTTCAAGACGG-3'). PCR amplification was performed using a 50 μL reaction system, and the reaction system was: Master mix (2X) 25 μL, NL1 1 μL, NL4 1 μL, Templap 4 μL, ddH2O 19 μL; amplification conditions: pre-denaturation at 95°C for 5 min, followed by denaturation at 95°C for 15 s, annealing at 53°C for 20 s, extension at 72°C for 1 min, for a total of 28 cycles, and finally full extension at 72°C for 5 min, and storage at 4°C; Detect the PCR product by agarose gel electrophoresis: load 2 μL of PCR product and 3 μL of Marker, separate them in 1.0% agarose gel electrophoresis; 120V, 20min, analyze with gel imager; The PCR product containing the target fragment was sent to a testing company for sequencing, and the results were compared by BLAST homologous sequence search on NCBI. After homologous sequence search and comparison, a total of 5 strains of Candida zepplinii were detected, among which the nucleotide sequence of the 26SrDNA D1 / D2 region of strain SIVE8902 is shown in SEQ ID NO: 1, as follows: GCTTAAGTTCAAGCGGGTAACCTTGCTTGATTGGAGGATGAAAAGTGTATAACTGCACAGAGTTAATTAACGTGTGCACTTCCATGATTTTAACTCCTAAAAGGAGCAAGACCTCATACCAAAAATGGTTGAGAGGAAGATTATCACTCCAACAAGCATGCTATTAGACAAACTAATAGCGCAATATGCGTTCAAAAATTCAATGACTCACG TCTGCAATTCGCATTACCTATCGCGCTTTGCTGCGTTCTTCATCGATACGAGAACCAAGAGATCCGTTGTTGAAAGTTTTAAATTTTCATTGTTTCAGAACAAATATAAAAGTTTTAAAGATTGGGCGCCTTTCGACACCCAAGCAATTGCAAAGACCGAAGTCTAAGCTGTTCACAGTGGTTTTGGCAAAAAGGCTTCACAAATGATCCT Primer NL1, as shown in SEQ ID NO: 2; SEQ ID NO: 2 5'-GCATATCAATAAGCGGAGGAAAAG-3'; Primer NL4, as shown in SEQ ID NO: 3; SEQ ID NO: 3 5′-GGTCCGTGTTTCAAGACGG-3′.

[0034] The strain was identified as Candida genus; the Zepplin Candida was numbered SIVE8902 and deposited in China Center for Type Culture Collection (CCTCC) on July 22, 2024; address: Wuhan University, Bayi Road, Wuchang District, Wuhan City, Hubei Province; postal code: 430072, the deposit number is CCTCC NO: M 20241637, the Latin name Starmerella bacillaris .

[0035] Example 2 Inhibition experiment of strain SIVE8902 on Botrytis cinerea on plates In this example, five strains of Candida zepulinensis were used, numbered as T1-1, AM1-1, SIVE8902, JDCG1-25, and SIVE8910; The above five strains were all selected from Cabernet Gernischt grapes in Yantai, Shandong; strain SIVE8902 was the strain preserved in Example 1; Experiment 1: Antagonism experiment of Zeppelin Candida suspension (1) Preparation of bacterial suspension: Yeast suspension: The strain was cultured in YPD liquid medium with constant temperature shaking for 24 hours at the following conditions: temperature 28°C, rotation speed 200r / min, to obtain fermentation liquid; The fermentation broth was centrifuged at 6000 r / min for 5 min, and the precipitate was collected. The precipitate was washed twice with sterile water and then resuspended with sterile water. The yeast concentration was adjusted to 1×10 by hemocytometer. 8 cells / ml to obtain bacterial suspension; The five bacterial strains were used to prepare five different bacterial suspensions using the above method, which were named T1-1 bacterial suspension, AM1-1 bacterial suspension, SIVE8902 bacterial suspension, JDCG1-25 bacterial suspension, and SIVE8910 bacterial suspension. (2) Cultivation: Treatment Group: Use PDA agar plates and drop 20 μL of the bacterial suspension from step (1) onto each plate. Divide the 20 μL bacterial suspension into 4 portions and distribute them around the plate. The tablets are recorded as T1-1 tablet, AM1-1 tablet, SIVE8902 tablet, JDCG1-25 tablet, and SIVE8910 tablet; Place a Botrytis cinerea mycelium disk (5 mm in diameter) in the center of each of the above plates, with three replicates for each treatment; Control group (CK): Only the Botrytis cinerea mycelium disk was placed in the center, and three replicates were set up for each treatment; The experimental group and the control group were cultured at 25°C for 9 days to calculate the inhibition rate. Figure 1 The results of the antibacterial rate are shown in Figure 2 ; Combination Figure 1 It can be seen that all treatment groups have a certain inhibitory effect on Botrytis cinerea. However, compared with the CK group and the other strain groups, the strain SIVE8902 provided by the present invention has a more significant inhibitory effect on the growth and reproduction of Botrytis cinerea. That is to say, the strain SIVE8902 provided by the present invention has the highest antibacterial activity.

[0036] Experiment 2: Antagonism experiment of volatile compounds of Candida zeppelin Conidia suspension of Botrytis cinerea: Botrytis cinerea was inoculated on PDA medium and cultured at 25°C for 5 days. To collect conidia, Botrytis cinerea spores were cultured at 22°C for 7 days under light conditions. 5 mL of sterile water was added to the PDA plate, and the conidia were washed by stirring back and forth. The conidia were then centrifuged at 8000 r / min for 5 min and resuspended in sterile water. The spore concentration was adjusted to 1×10 by hemocytometer.6 conidia / ml; Plate A: Take 100 μL of the yeast suspension prepared in step (1) of Experiment 1 and inoculate it in the center of the PDA plate and spread it evenly; Plate B: Take 10 μL of the conidia suspension of Botrytis cinerea and inoculate it in the center of another PDA plate; Plate C: a plate not inoculated with yeast suspension as a control (CK); Experimental Group: Align the open edge of plate A with the open edge of plate B (i.e., place plate A and plate B face to face), seal with a sealing film to prevent air leakage, and obtain an experimental group, with three parallels for each treatment; Control group (CK): Align the open edge of plate C with the open edge of plate B (i.e., place plate C and plate B face to face), seal with a sealing film to prevent air leakage, and obtain a control group. Set up three parallels for each treatment; The experimental group and the control group were cultured at 25°C for 9 days, and the inhibition rate was calculated. Figure 2 ; The calculation formula of the inhibition rate of Experiment 1 and Experiment 2 was: inhibition rate (%) = (control colony diameter - treatment colony diameter) / (control colony diameter - bacterial cake diameter) × 100; Figure 2 The results show the inhibitory effects of the bacterial suspension of Experiment 1 and the volatile compounds of Experiment 2 on Botrytis cinerea. Combination Figure 2 It can be seen that when the bacterial suspension is used for the antibacterial experiment, the bacterial suspension of the strain SIVE8902 provided by the present invention has the highest antibacterial rate, which is 85.60±1.25%; when the volatile compound is used for the antibacterial experiment, the volatile compound produced by the strain SIVE8902 provided by the present invention has the highest antibacterial rate, which is 93.27±0.42%; It can be seen that the strain SIVE8902, the bacterial suspension and the volatile compounds provided by the present invention all have significant effects of inhibiting the growth and reproduction of Botrytis cinerea. Therefore, the strain SIVE8902 can be used as an antibacterial product.

[0037] Example 3 Experiment on the inhibition of gray mold by strain SIVE8902 in grape berries Healthy grapes purchased from the local market were randomly selected and assigned to different treatment groups; washed with purified water and disinfected by soaking in 1% sodium hypochlorite for 1 min, then washed again with purified water and dried at room temperature; Botrytis cinerea-infected grapes: four wounds were made in the equatorial region of the berries using a sterile needle, and then 20 μL of the conidia suspension of Botrytis cinerea prepared in Experiment 2 of Example 2 was inoculated into each wound, and the mixture was air-dried at room temperature to obtain Botrytis cinerea-infected grapes (infected grapes); Experiment 3: Inhibition of Botrytis cinerea by suspension of Candida zeppelin in grape berries Experimental group: 5 groups in total, 10 grapes with bacteria in each group; 20 μL of T1-1 bacterial suspension, AM1-1 bacterial suspension, SIVE8902 bacterial suspension, JDCG1-25 bacterial suspension, and SIVE8910 bacterial suspension in Experiment 1 of Example 2 were inoculated into the grapes with gray mold respectively; Control group: 20 μL of distilled water was inoculated into the grapes with gray mold (the difference from the experimental group was that distilled water was used to replace the yeast suspension); Each group was repeated three times. After culturing for 7 days at 25℃ and relative humidity of 80%-90%, the disease status of the grapes was observed: Grade 0, all fruits were disease-free; Grade 1, 1%-25% of the fruits were rotten, Grade 2, 26%-50% of the fruits were rotten, Grade 3, 51%-75% of the fruits were rotten, and Grade 4, more than 75% of the fruits were rotten. The disease index (DS), disease incidence (DI), and lesion diameter (LD) were calculated; Disease index (DS) = Σ (disease level × number of fruits of the disease level) / (maximum disease level × total number of fruits) × 100. The grading standard for grape gray mold is: Grade 0, all fruits are disease-free; Grade 1, 1%-25% of the fruits are rotten, Grade 2, 26%-50% of the fruits are rotten, Grade 3, 51%-75% of the fruits are rotten, and Grade 4, more than 75% of the fruits are rotten; Disease incidence (DI) = number of diseased fruits / total number; LD = infection diameter of treated grapes / diameter of control group. The results are shown in Figure 3 ; Combination Figure 3 It can be seen that the strain SIVE8902 provided by the present invention can effectively reduce the growth and reproduction of gray mold in grape berries; SIVE8902 can reduce the disease index, disease incidence and lesion diameter of grape gray mold to only 37.33±1.57%, 22.33±1.57%, 25.20±5.25% and 0.55±0.04 cm, and at the same time reduce the number of rotten fruits; Experiment 4: Inhibition of Botrytis cinerea by volatile compounds of Candida zeppelinii in grape berries Prepare a sterilized sealed container and put 10 germ-carrying grapes into it for later use; Plate C: Take 100 μL of the bacterial suspension prepared in Experiment 1 of Example 2 and inoculate it into the center of the PDA plate and spread it evenly. Spread 6 plates with each bacterial suspension and set aside. Plate D: Replace bacterial suspension with distilled water; add distilled water to the center of 6 PDA plates and spread evenly; Experimental Group: Place 6 plates C coated with the same bacterial suspension into the same sealed container of grapes with bacteria; the 5 bacterial suspensions in Experiment 1 of Example 2 were placed separately in the above manner; each treatment was repeated three times; Control group (CK): Transfer plate C coated with distilled water to a sealed container containing infected grapes, and repeat three times; After the experimental group and the control group were cultured at 25℃ and relative humidity of 80%-90% for 7 days, the state of the grapes was observed. Figure 4 ; Calculate the disease index (DS), disease incidence (DI), and lesion diameter (LD). The results are shown in Figure 5 ; Combination Figure 4 , 5 It can be seen that the volatile compounds produced by the strain SIVE8902 provided by the present invention have a stronger inhibitory effect on Botrytis cinerea, and can reduce the disease index, disease incidence and lesion diameter to only 18.55±5.48%, 12.35±5.77% and 0.47±0.15 cm, respectively, providing a biological control strategy for the inhibition of Botrytis cinerea in grape berries.

[0038] Example 4 Field test evaluation of strain SIVE8902 against grape gray mold The strain SVE8910 and the strain SIVE8902 preserved in Example 1 were selected to evaluate the control effect of grape gray mold in a vineyard in Yantai, Shandong.

[0039] The bacterial suspension was prepared in the manner of Example 2, specifically: the strain SVE8910 and the strain SIVE8902 were cultured in YPD liquid medium at a constant temperature for 24 h, respectively, under the following culture conditions: temperature 28 ° C, rotation speed 200 r / min, to obtain fermentation broth; the fermentation broth was centrifuged at 6000 r / min for 5 min, and the precipitate was collected; the precipitate was washed twice with sterile water, and then resuspended with sterile water, and the yeast concentration was adjusted to 1×10 by hemocytometer. 8 cells / ml to obtain bacterial suspension; Ten Marselan grape vines were used as the test area, and the bacterial suspension was sprayed on the Marselan grape bunches with a handheld sprayer until runoff; 10 untreated Marselan grape vines in the adjacent rows were used as controls, and 3 parallels were made for each treatment.

[0040] The bacterial suspension was sprayed once on May 16, June 5, July 18, August 2, and September 3, and samples were taken for later use; Grapes were harvested on September 18 and the clusters were evaluated for gray mold. The disease incidence was calculated as follows: Disease incidence (%) = (number of diseased clusters / total number of clusters) × 100. A cluster was considered diseased when ≥ 5% of the berries on the cluster were diseased. Disease incidence results are shown in Figure 6 ; Combination Figure 6 It can be seen that the number of Marselan grapes infected with gray mold decreased after spraying strain SIVE8902, and the disease incidence rate was only 5.77%±1.01%, which greatly reduced the number of rotten fruits in the field.

[0041] Example 5 Effect of strain SIVE8902 on alcohol fermentation In order to further explore the effect of the strain SIVE8902 on the quality of wine, the present invention detected and analyzed the alcohol fermentation rate, wine physicochemical indicators and aroma compounds of the sequential fermentation of the strain SIVE8902 and Saccharomyces cerevisiae EC1118 (purchased from Lallemand, France).

[0042] The strain SIVE8902 and Saccharomyces cerevisiae EC1118 were fermented sequentially in winemaking, and the process was as follows: (1) Using Chardonnay grapes as raw materials, the grape juice is collected after destemming, crushing and pressing; (2) Pour 400 mL of grape juice into a 500 mL volumetric flask, then add 80 μL / L of dimethyl dicarbonate and place at room temperature for 4 h; (3) Fermentation: Experiment ①: Inoculate brewer's yeast EC1118 and ferment at 20℃. The weight loss of carbon dioxide release is less than 0.1g / 100mL, and the fermentation ends, which serves as the control group. Experiment ②: inoculating the strain SIVE8902 preserved in Example 1, and fermenting at 20°C for 48 hours to obtain fermented mash A; inoculating brewer's yeast EC1118 into fermented mash A, and continuing to ferment at controlled temperature until the weight loss of carbon dioxide release is less than 0.1 g / 100 mL, to obtain a wine sample; After the wine sample is clarified and separated by siphon method, 120 mg / L of potassium metabisulfite is added and stored at low temperature for testing; In experiments ① and ②, the inoculation amount of Saccharomyces cerevisiae EC1118 was 1×10 6 cells / ml, and the inoculum size of strain SIVE8902 was 1×10 7 cells / ml; fermentation temperature was 20°C, repeated three times; During the fermentation process, the weight loss of carbon dioxide released in the bottle is monitored. When the daily weight loss is less than 0.1g / 100mL, the alcoholic fermentation is considered to be over and various indicators of the wine are measured.

[0043] Test 1: Determination of physical and chemical indicators of wine, ethanol, total acid, residual sugar and other indicators: refer to GB / T 15038-2006 "General Analysis Method for Grape and Fruit Wine"; glycerol content is determined by high performance liquid chromatography, the results are shown in Table 1, as follows: Table 1 Physical and chemical indicators of wine samples after alcohol fermentation

[0044] Combined with Table 1, it can be seen that after the alcohol fermentation, both treatment groups were able to complete the fermentation normally, the sugars were completely consumed, the total acid was 4.23~4.30g / L, the pH was 3.52~3.54, the ethanol was 11.26~11.38%, and the glycerol content was 4.96~7.21g / L; Glycerol is very important in wine, and its content is one of the important indicators for evaluating wine quality. Glycerol can make the wine smoother and sweeter. High concentration of glycerol has a positive effect on the taste and quality of wine. Combined with Table 1, it can be seen that the glycerol content after fermentation in experiment ② (sequential fermentation of strain SIVE8902 and brewer's yeast EC1118) was as high as 7.21±0.30g / L, which was 45.36% higher than that of EC1118 single-strain fermentation.

[0045] Test 2: Fermentation rate during alcohol fermentation The alcohol fermentation rate during the fermentation of Experiment ① (control group) and Experiment ② (sequential fermentation) was expressed as the release of carbon dioxide. The results are shown in Figure 7 ; Combination Figure 7 It can be seen that both inoculation methods completed alcohol fermentation normally; the sequential fermentation rate was slower than that of the control group. This was because in the sequential fermentation, the addition of Saccharomyces cerevisiae EC1118 would compete with the strain SIVE8902 and inhibit the strain SIVE8902, thereby reducing the alcohol fermentation rate; the added strain SIVE8902 mainly produced aroma in the early stage, and the esters, alcohols, phenols and other compounds it produced enriched the complexity of the wine and contributed to the aroma of the wine. As the alcohol content increased, the activity of the strain SIVE8902 decreased, and Saccharomyces cerevisiae took the dominant position, which increased the fermentation rate.

[0046] Test 3: Wine aroma Gas chromatography-mass spectrometry was used to analyze the volatile aroma compounds of Chardonnay wine, and the results are shown in Table 2 ; Table 2 Aroma compound content after alcohol fermentation (μg / L)

[0047] Combined with Table 2 , it can be seen that a total of 32 volatile aromatic compounds were identified in the wines obtained from experiment ② (sequential fermentation), including the following categories: alcohols (8), esters (13), terpenes (4), acids (3), and phenols (4); In the present invention, experiment ② (sequential fermentation) produced aroma substances that could not be produced in experiment ① (control group), wherein 2-undecanol added a light sweet waxy aroma to the wine, methyl decanoate added a fruity and sweet taste to the wine, ethyl palmitate added a waxy and creamy taste to the wine, isoamyl octanoate added a fruity and brandy aroma to the wine, p-vinyl hydroxybenzoate added a spice and clove flavor to the wine, and 4-ethyl-2-methoxyphenol added a honey flavor to the wine; it can be seen that after adding the strain SIVE8902 provided by the present invention and the brewer's yeast EC1118 for sequential fermentation, the types of aroma substances in the wine can be significantly increased, so that the aroma composition of the wine is more abundant and more three-dimensional in sensory evaluation; The content of higher alcohols is considered to have a positive contribution to the sensory characteristics of wine. Experiment ② (sequential fermentation) significantly increased the content of 2,3-butanediol and phenylethanol in wine compared to experiment ① (single-bacteria fermentation). Among them, the content of 2,3-butanediol increased by 291.67%, and the content of phenylethanol increased by 2149.98%, effectively improving the aroma of fruit wine. Ester compounds are mainly responsible for fruity and floral aromas. Compared with experiment 1, the total amount of fermented esters in experiment 2 increased by 67.70%, among which ethyl caprate and ethyl laurate increased by 160.94% and 214.29% respectively, bringing coconut and floral aromas to the wine. Terpenes contribute positively to the aroma of wine and are released by yeast from glycosylated precursors. Compared with experiment 1, the citronellol and nerolidol produced in experiment 2 increased by 83.33% and 66.00%, respectively, giving the wine lemon and orange blossom aromas. Compared with Experiment ①, Experiment ② produced volatile phenolic substances that increased by 453.95%, and new p-vinyl hydroxybenzoic acid and 4-ethyl-methoxyphenol were added, which added spicy and honey flavors to the wine and improved the quality of the wine.

[0048] By comparing Experiment ① and Experiment ②, it can be seen that adding the strain SIVE8902 provided by the present invention and brewer's yeast for sequential fermentation can significantly increase the content of aroma substances, volatile substances, etc. in the wine. From the perspective of sensory evaluation, the color, aroma and taste of the wine can be improved, and the quality of the wine can be improved.

[0049] Although the present invention has been described in detail by reference to the preferred embodiments, the present invention is not limited thereto. Without departing from the spirit and essence of the present invention, a person of ordinary skill in the art may make various equivalent modifications or substitutions to the embodiments of the present invention, and these modifications or substitutions shall be within the scope of the present invention. Any person of ordinary skill in the art may easily think of changes or substitutions within the technical scope disclosed by the present invention, and these shall be within the scope of protection of the present invention. Therefore, the scope of protection of the present invention shall be subject to the scope of protection of the claims.

Claims

1. A strain of Candida zepplinii, characterized in that: The number is SIVE8902, and it was deposited in the China Center for Type Culture Collection, abbreviated as CCTCC, on July 22, 2024; address: Wuhan University, Bayi Road, Wuchang District, Wuhan City, Hubei Province; Postal Code: 430072, the deposit number is CCTCC NO: M 20241637, the Latin name Starmerella bacillaris .

2. The Candida zepplinii according to claim 1, characterized in that The strain was screened from Cabernet Gernischt grapes in Penglai, Yantai.

3. Use of the Candida zepulinensis according to claim 1 in inhibiting Botrytis cinerea.

4. The use according to claim 3, characterized in that Specifically, it is the application of the bacterial suspension of strain SIVE8902 and / or the volatile compounds produced by strain SIVE8902 in inhibiting gray mold.

5. The use according to claim 4, characterized in that When the bacterial suspension of strain SIVE8902 was used to inhibit Botrytis cinerea, the inhibition rate reached 85.60±1.25% in the plate antagonism experiment; when the volatile compounds produced by SIVE8902 were used to inhibit Botrytis cinerea, the inhibition rate reached 93.27±0.42% in the plate experiment.

6. The use according to claim 5, characterized in that The concentration of the bacterial suspension of strain SIVE8902 was 1×10 8 cells / ml.

7. The use according to claim 6, characterized in that The preparation process of the bacterial suspension of strain SIVE8902 is as follows: The strain SIVE8902 was inoculated into YPD liquid medium and cultured at a constant temperature of 28°C and a speed of 200 r / min for 24 h. The precipitate was collected by centrifugation at 6000 r / min for 5 min, washed with sterile water, and then resuspended with sterile water. The yeast concentration was adjusted to 1×10 by hemocytometer. 8 cells / ml to obtain a bacterial suspension.

8. The use according to claim 4, characterized in that The application is specifically the application in grape berries; the concentration is 1×10 8 The strain SIVE8902 suspension with cells / ml was applied to grape berries, with a disease index of 22.33±1.57%, a disease incidence of 25.20±5.25%, and a lesion diameter of 0.55±0.04cm; the concentration was 1×10 8 The volatile compounds of strain SIVE8902 with a concentration of 1×10 cells / mL were applied to grape berries, with a disease index of 18.55±5.48%, a disease incidence of 12.35±5.77%, and a lesion diameter of 0.47±0.15 cm; the concentration of 1×10 8 In field trials, the disease incidence rate of strain SIVE8902 suspension with a concentration of 1 cell / mL was 5.77%±1.01%.

9. The use of Candida zepplinii in winemaking according to claim 1, characterized in that: Specifically, strain SIVE8902 and Saccharomyces cerevisiae EC1118 are fermented sequentially in winemaking.

10. The use of Candida zepplinii in winemaking according to claim 9, characterized in that: The process is as follows: (1) Pour the grape juice into a container, then add dimethyl dicarbonate, mix well, and leave at room temperature for 4-5 hours; (2) Inoculating strain SIVE8902, and fermenting at controlled temperature for 48 h to obtain fermented mash; (3) Inoculating the fermented mash with Saccharomyces cerevisiae EC1118, and continuing the temperature-controlled fermentation until the weight loss of carbon dioxide release is less than 0.1 g / 100 mL, thereby obtaining a wine sample; (4) After the wine sample is clarified and separated by siphon method, 120 mg / L of potassium metabisulfite is added and stored at low temperature for testing; The inoculum size of strain SIVE8902 was 1×10 7 cells / ml; the inoculum size of Saccharomyces cerevisiae EC1118 was 1×10 6 cells / ml; the temperature of the controlled fermentation was 20±1℃.

Images