Oxetane synthetase mutant and application thereof

Abstract

The invention belongs to the technical field of gene engineering, and provides an oxetane synthetase mutant and application thereof. Oxetane synthetase TOT is a key gene for catalyzing formation of an oxa-four-membered ring in a paclitaxel skeleton structure, however, the oxa-four-membered ring is generated by the oxa-four-membered ring generated by the oxa-four-membered ring generated by an oxidation substrate, so that the paclitaxel has the problems of low synthesis efficiency, difficulty in separation and purification and the like in the biosynthesis process of the paclitaxel. According to the invention, through homologous modeling and molecular dynamics simulation, key residues of TOT control product path and proportion are found, and through rational design, the efficiency of TOT in synthesis of an oxetane structure is successfully improved. The TOT mutant provided by the invention is helpful for improving the biosynthesis efficiency of paclitaxel, and provides a better catalytic tool for realizing industrial preparation of taxane drugs by means of enzyme catalysis and synthetic biology.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering, and in particular relates to an oxetane synthase mutant and application thereof. Background Art

[0002] Paclitaxel is the world's top-selling plant-based anticancer drug. In clinical practice, paclitaxel is a first-line drug for the treatment of breast cancer, lung cancer, and ovarian cancer. It is also one of the most effective anti-tumor drugs for the treatment of a variety of advanced and refractory cancers. It has a huge demand in the international pharmaceutical market and has saved countless lives around the world. In the late 1990s and early 21st century, paclitaxel had annual sales of more than $1.5 billion, and at its peak in 2001, annual sales reached $2 billion.

[0003] As an anticancer drug, the molecular structure of paclitaxel is very complex, with a highly oxidized, complex bridged ring system and 11 stereocenters. It is recognized by the chemical community as one of the most difficult natural product molecules to synthesize organically. By 1992, more than 30 research groups had participated in the synthesis of paclitaxel, which is rare in the history of organic synthesis. Even in the shortest chemical synthesis route to date, the yield of paclitaxel is only 0.118%. Therefore, the efficient and green synthesis of paclitaxel drugs through synthetic biology has attracted the attention of many chemists.

[0004] In order to achieve efficient synthesis of paclitaxel through synthetic biology methods, the analysis of the paclitaxel biosynthetic pathway is a key breakthrough. In previous studies, we successfully found the key enzymes T9H and TOT missing in the paclitaxel biosynthetic pathway, which catalyze the hydroxylation reaction at position 9 of taxane and the formation of an oxygen-containing tetracyclic ring, respectively. By co-injecting the two newly found enzymes with seven known enzymes in the paclitaxel biosynthetic pathway (TXS, T5αH, T13αH, T2αH, T7βH, TAT, TBT) into tobacco, we achieved the heterologous synthesis of baccatin III, a key intermediate in paclitaxel biosynthesis, in tobacco (B. Jiang, et al. Science, 2024, 383,622), laying the foundation for the future large-scale green preparation of paclitaxel through metabolic engineering strategies. However, the efficiency of heterologous synthesis is extremely low. One of the reasons is that the key enzyme TOT in the biosynthesis of paclitaxel is functionally promiscuous. In addition to the desired oxygen-containing four-membered ring product, it can also generate epoxide as a byproduct. Therefore, the development of TOT enzyme mutants with higher catalytic efficiency and better selectivity is very important for the heterologous synthesis of paclitaxel. Summary of the invention

[0005] The purpose of the present invention is to provide an oxetane synthase mutant and application thereof.

[0006] In order to achieve the purpose of the present invention, in a first aspect, the present invention provides an oxetane synthase mutant, wherein the mutant comprises a mutation of the 382nd amino acid of the oxetane synthase from V to I, F or Q; or, The mutant is a homologous protein of oxetane synthase whose 382nd amino acid is I, F or Q; Among them, oxetane synthase (taxane C4-C20 oxetane forming enzyme TOT) is: (a) a protein consisting of the amino acid sequence shown in SEQ ID NO: 1; (b) A protein derived from (a) with equivalent functions, wherein one or more amino acids are substituted, deleted or added to the sequence shown in SEQ ID NO: 1.

[0007] The oxetane synthase involved in the present invention is derived from Taxus chinensis var. mairei ( Taxus chinensis var. mairei ).

[0008] Preferably, the mutant comprises a mutation of amino acid 382 of oxetane synthase from V to I; or, The mutant is a homologous protein of oxetane synthase whose 382nd amino acid is 1.

[0009] In a second aspect, the present invention provides a gene encoding the mutant, the nucleotide sequence of which is: i) the nucleotide sequence shown in SEQ ID NO: 2; ii) a nucleotide sequence in which one or more nucleotides are substituted, deleted and / or added to the nucleotide sequence shown in SEQ ID NO: 2 and the nucleotide sequence expresses a protein with the same function; iii) a nucleotide sequence that hybridizes with the sequence shown in SEQ ID NO:2 under stringent conditions and expresses a protein with the same function, wherein the stringent conditions are hybridization in a 0.1×SSPE solution containing 0.1% SDS or a 0.1×SSC solution containing 0.1% SDS at 65°C and the membrane is washed with the solution; or iv) a nucleotide sequence that has more than 90% homology with the nucleotide sequence of i), ii) or iii) and expresses a protein with the same function.

[0010] In a third aspect, the present invention provides biological materials containing the gene, wherein the biological materials include but are not limited to recombinant DNA, expression cassettes, transposons, plasmid vectors, viral vectors, engineered bacteria or transgenic cell lines.

[0011] In a fourth aspect, the present invention provides the use of the mutant, or a gene encoding the mutant or a biological material containing the gene in the synthesis of oxygen-containing heterocyclic compounds.

[0012] In the present invention, the oxygen-containing heterocyclic compound includes a taxane compound having an oxetane ring group and an epoxy group.

[0013] Preferably, the taxane compound includes at least one of paclitaxel and its derivatives, docetaxel and its derivatives, and cabazitaxel and its derivatives.

[0014] In a fifth aspect, the present invention provides a method for synthesizing oxygen-containing heterocyclic compounds in vivo or in vitro, using a taxane compound containing 5α-acetoxy-4,20-alkenyl as a substrate (such as taxadiene-hexaol-hexaacetate), and synthesizing the oxygen-containing heterocyclic compound under the catalytic action of the mutant.

[0015] Furthermore, the in vivo includes inside a microorganism, inside a plant cell and / or inside an animal cell.

[0016] By means of the above technical solution, the present invention has at least the following advantages and beneficial effects: The present invention discovered for the first time the key sites that affect the ratio of TOT products, and constructed a TOT-V382I mutant with better selectivity by site-directed mutagenesis, which has potential application value in the heterologous synthesis of paclitaxel drugs. In addition, the TOT-V382F and TOT-V382Q mutants have better selectivity for epoxide products and have potential application value in the heterologous synthesis of taxane epoxide compounds. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 In a preferred embodiment of the present invention, TOT enzyme oxidizes the C4-C20 double bond of compound 1 to generate an oxygen-containing four-membered ring product 1-dehydroxybaccatin IV (compound 2) and an epoxy compound baccatin I (compound 3).

[0018] Figure 2 In a preferred embodiment of the present invention, the TOT structure modeled using AlphaFold2 is used.

[0019] Fig. 9 In the preferred embodiment of the present invention, TOT V382A Density functional theory (DFT) calculations of the enzyme-free model of mutant-mediated oxidation reactions.

[0020] Fig.10 Schematic representation of the distance between the 382 amino acid residue and the C5 acetyl carbonyl group in a preferred embodiment of the present invention.

[0021] Fig.11The ratio of the oxetane product 2 and the epoxide product 3 generated by different V382 mutants expressed in tobacco in a preferred embodiment of the present invention. DETAILED DESCRIPTION

[0022] The present invention provides an oxidative reaction enzyme derived from Taxus chinensis, which is modified to improve the efficiency of synthesizing oxetane products using taxane substrates, and provides theoretical support for improving the selectivity of homologous proteins through rational modification.

[0023] The present invention adopts the following technical solution: The present invention provides a mutant of an oxetane ring-forming enzyme and application thereof in catalyzing an oxidation reaction of a taxane compound to synthesize an oxetane-containing compound.

[0024] The present invention also provides a mutant of an oxetane ring-forming enzyme and its application in catalyzing the oxidation reaction of taxane compounds to generate compounds containing epoxy.

[0025] The present invention also provides a mutation site and method capable of improving the activity and selectivity of TOT and its homologous proteins.

[0026] The present invention also provides a mutant of the oxetane synthase TOT, wherein the mutant has the following mutation at position V382 in the amino acid sequence shown in SEQ ID NO: 1: 1) V382I; 2) V382F; 3) V382Q; The ratio of oxetane products catalyzed by the above mutant No. 1 is significantly higher than that of the wild-type TOT. The ratio of epoxide products catalyzed by the above mutants No. 2 and No. 3 is significantly higher than that of the wild-type, and higher than that of the V382A mutant disclosed in CN117070480A.

[0027] The coding gene of the above mutant belongs to the protection scope of the present invention.

[0028] Furthermore, the biological material containing the encoding gene is an expression cassette, a plasmid, a vector, a microorganism, an insect cell, an animal cell, or a plant cell.

[0029] The present invention also provides the use of the mutant or its encoding gene or a biological material containing its encoding gene in a catalytic oxidation reaction.

[0030] The present invention also provides the use of the mutant or its encoding gene or biological material containing its encoding gene in synthesizing oxo-heterocyclobutane or epoxy products.

[0031] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the present invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art, and the raw materials used are all commercially available products.

[0032] The following examples relate to the mairei chinensis ( Taxus chinensis var. mairei ) from Fujian Province, China, and were cultured in a growth chamber at 22°C with a photoperiod of 16 h light / 8 h dark. Nicotiana tabacum ( Nicotiana benthamiana ) were grown in a greenhouse with a photoperiod of 16 h light / 8 h dark, 25 °C and 60% relative humidity.

[0033] The RNA extraction kit for Taxus chinensis was Plant RNA Kit (purchased from Omega), and cDNA was prepared using HiScript III 1stStrand cDNA Synthesis Kit (containing gDNA wiper, purchased from Vazyme). The full-length sequence of TOT was amplified from cDNA using primers (synthesized by Beijing Ruiboxing Biotechnology Co., Ltd.) and inserted into the pEAQ-HT vector (cut with NruI-HF and XhoI-HF). The plasmid carrying the candidate gene was transformed into Agrobacterium ( Agrobacterium tumafaciens ) GV3101 competent cells (purchased from Weidi). Substrate 1 (taxadiene-hexanol-hexaacetate) was synthesized according to the reference (Characterization and heterologous reconstitution of Taxus biosynthetic enzymes leading to baccatin III, Bin Jiang, Lei Gao, Haijun Wang, Yaping Sun, Xiaolin Zhang, Han Ke, Shengchao Liu, Pengchen Ma, Qinggang Liao, Yue Wang, Huan Wang, Yugeng Liu, Ran Du, Torben Rogge, Wei Li, Yi Shang, KN Houk, Xingyao Xiong, Daoxin Xie, Sanwen Huang, Xiaoguang Lei, Jianbin Yan, Science, 2024, 383, 622).

[0034] Example 1 Expression and Function Verification of TOT Gene 1. Extraction of total RNA from Taxus chinensis Take about 100 grams of yew leaves and put them in a mortar. Add liquid nitrogen and grind them into powder. Then extract RNA according to the instructions of the Plant RNA Kit of Omega Company.

[0035] 2. Preparation of Taxus cDNA The extracted total RNA was treated with DNAase at 37°C for half an hour, purified with an RNA purification kit, and the recovery concentration was determined with nanodrop. The cDNA was obtained by reverse transcription using HiScript III 1st Strand cDNA Synthesis Kit according to the instructions.

[0036] 3. Amplification of TOT gene The genome of Taxus chinensis var. mairei was analyzed to obtain the TOT sequence. The amino acid sequence and the reading frame nucleotide sequence of TOT are SEQ ID NO: 1 and SEQ ID NO: 2, respectively.

[0037] Based on the nucleotide sequence of TOT protein, primers were designed to amplify the target sequence from Taxus cDNA.

[0038] Upstream primer sequence pEAQ-TOT-F: GTATATTCTGCCCAAATTCGCGAATGGTTCATGTGTTGCAGG Downstream primer sequence pEAQ-TOT-R: ACCAGAGTTAAAGGCCTCGAGTTAGGATCTGGGAGTAGGTTTTATTGAAAATC PCR reaction system (50 μL): Template cDNA 1 μL 10 uM upstream primer 1.5 μL 10 uM downstream primer 1.5 μL 5×Transstart Fastpfu Buffer 10 μL Transstart fastpfu DNA polymerase 1 μL 10 mM dNTPs 4 μL ddH2O 31 μL PCR cycling conditions (50 μl system): 95°C for 2 min; 98°C for 30 s, 52°C for 30 s, 72°C for 1 min, for a total of 32 cycles; 72°C for 5 min.

[0039] The PCR product was recovered by gel excision and the product was recombined with the linear pEAQ-HT vector (see https: / / doi.org / 10.1111 / j.1467-7652.2009.00434.x) double-digested with RruI and XhoI using the ClonExpress one-step cloning kit (Novozymes) and named pEAQ-HT-TOT.

[0040] 4. TOT enzyme activity test The pEAQ-HT-TOT plasmid carrying the candidate gene was transformed into Agrobacterium tumefaciens GV3101 competent cells (Weidi) by freeze-thaw method. Agrobacterium containing the TOT gene was resuspended in MMA buffer (10 mM MES, pH 5.6, 10 mM magnesium chloride, 100 µM acetosyringaldehyde) to an optical density (OD 600 ) reaches 1.0, and then the tobacco is infiltrated.

[0041] On the fourth day after bacterial infiltration, 5 μg of substrate 1 (dissolved in an aqueous solution containing 0.02% DMSO) was infiltrated into the leaves. After 24 hours of incubation, the leaves were harvested, quickly frozen, and samples were extracted for LC-MS analysis. TOT can catalyze the production of oxetane product 2 and epoxide product 3 from taxadiene-hexanol-hexaacetate (substrate 1, i.e., compound 1) Figure 1 ).

[0042] LC-MS analysis of metabolites: Samples were analyzed by reverse phase liquid chromatography on an ACQUITY UPLC® I-Class system using a 1.8 μm, 2.1 mm × 55 mm ACQUITY UPLC® HSS T3 column. The mobile phases were water (A) containing 0.1% formic acid and methanol (B) containing 0.1% formic acid at a flow rate of 0.3 mL / min, with a gradient elution method of 11 minutes: 0-1 minute, 60% B; 1-9 minutes, 60%-92% B; 9-10 minutes, 92%-100% B; 10-10.2 minutes, 100%-60% B; 10.2-11 minutes, 60% B. The injection volume was 3 µL. For reverse phase analysis, mass spectrometry data were collected in positive ion mode (ESI+) using a coupled VionWaters® Vion IMS Q-TOF (parameters: mass range 50–1000 m / z; capillary voltage 2.5 kV; drying gas temperature 280 °C, flow rate 800 L / h; shield gas flow 50 L / h; ion source temperature 120 °C; acquisition time per spectrum 500 ms). For tandem mass spectrometry (MS / MS) analysis, collision energies of 5, 15, 25, and 35 V were used. Data were collected and analyzed using UNIFI software (version 1.9.4.053).

[0043] Example 2 Analysis of TOT mechanism based on computational chemistry Example 3 TOT mutation and functional verification Although the present invention has been described in detail above with general descriptions and specific embodiments, it is obvious to those skilled in the art that some modifications or improvements can be made based on the present invention. Therefore, these modifications or improvements made without departing from the spirit of the present invention all fall within the scope of protection claimed by the present invention.

Claims

1. An oxetane synthase mutant, characterized in that: The mutant comprises a mutation of the 382nd amino acid of the oxetane synthase from V to I, F or Q; or, The mutant is a homologous protein of oxetane synthase whose 382nd amino acid is I, F or Q; Among them, the oxetane synthase is: (a) a protein consisting of the amino acid sequence shown in SEQ ID NO: 1; (b) A protein derived from (a) with equivalent functions, wherein one or more amino acids are substituted, deleted or added to the sequence shown in SEQ ID NO:

1.

2. The mutant according to claim 1, characterized in that The mutant comprises a mutation of the 382nd amino acid of the oxetane synthase from V to I; or, The mutant is a homologous protein of oxetane synthase whose 382nd amino acid is 1.

3. A gene encoding the mutant according to claim 1 or 2.

4. The biological material containing the gene according to claim 3, characterized in that: The biological material is recombinant DNA, expression cassette, transposon, plasmid vector, virus vector, engineering bacteria or transgenic cell line.

5. Use of the mutant according to claim 1 or 2, or the gene according to claim 3, or the biomaterial according to claim 4 in synthesizing oxygen-containing heterocyclic compounds; The oxygen-containing heterocyclic compound includes a taxane compound having an oxetane ring group and an epoxy group.

6. The use according to claim 5, characterized in that: The taxane compound includes at least one of paclitaxel and its derivatives, docetaxel and its derivatives, and cabazitaxel and its derivatives.

7. A method for synthesizing an oxygen-containing heterocyclic compound in vivo or in vitro, characterized in that: The oxygen-containing heterocyclic compound is synthesized by using a taxane compound containing 5α-acetoxy-4,20-alkenyl as a substrate under the catalytic action of the mutant described in claim 1 or 2.

8. The method according to claim 7, characterized in that The oxygen-containing heterocyclic compound includes a taxane compound having an oxetane ring group and an epoxy group; The taxane compound includes at least one of paclitaxel and its derivatives, docetaxel and its derivatives, and cabazitaxel and its derivatives.

9. The method according to claim 7, characterized in that: The substrate includes taxadiene-hexaol-hexaacetate.

10. The method according to any one of claims 7 to 9, characterized in that: The in vivo includes in microorganisms, in plant cells and / or in animal cells.

Images