Programmable prokaryotic microorganism automatic lysis control system and application

Abstract

The application discloses a programmable prokaryotic microorganism automatic lysis control system and application. In the system, the promoter Tac-lysis is an extremely low penetration promoter before being turned on, the number of a transmission target basic component is variable, a transmission sgRNA promoter and an excitation sgRNA promoter can adopt various combinations with adjustable relative expression intensity, therefore, the time when the microorganism lysis starts can be controlled by changing the number of the transmission target basic component, and the target point editing efficiency and the downstream gene activation expression time can be accurately regulated by adjusting the promoter expression intensity ratio of the transmission sgRNA and the excitation sgRNA. The system has good robustness and programmability, can dynamically regulate gene expression according to the growth and fermentation process of the prokaryotic microorganism, and finally realizes automatic lysis of the microorganism after completing the set function.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of molecular biology and bioengineering technology, and specifically relates to a programmable prokaryotic microorganism automatic lysis control system and application. BACKGROUND

[0002] In current industrial production, the process of synthesizing natural products by microbial fermentation is becoming more and more common and mature. Compared with animals and plants, microorganisms grow and metabolize quickly, are easy to genetically manipulate, and have simple nutrient requirements. Using microorganisms as cell factories, natural products can be rapidly synthesized using relatively cheap and readily available raw materials, which can greatly shorten the synthesis cycle, save land and natural resources, and reduce the use of acid, alkali and organic solvents. On the basis of protecting the environment, the economic benefits can be greatly improved. However, in the current production process, there is no simple and spontaneous control scheme for the crushing and extraction of microorganisms after product synthesis. At the same time, before the crude enzyme solution extracted by microorganisms is used for biological chemical synthesis, additional steps are also needed to break the microorganisms after cultivation. This not only makes the process more complex, but also brings additional production costs. In addition, in recent years, more and more researches on using bacterial therapy to target treat diseases such as cancer (Harimoto, T., Hahn, J., et al. 2022, Nature Biotechnology, 40, 8, 1259-1269.) have been carried out. How to control the automatic lysis of bacteria after targeting to the disease site in the body is also an important research problem.

[0003] The gene expression process of normal living organisms is often regulated by intracellular multi-component systems, which is a relatively complex link. A large number of gene regulation tools have been used to control the expression of target genes, the most common way including the use of some induction systems that interact with transcription factors, such as IPTG, arabinose and tetracycline, etc. However, using such induction systems to control gene expression also requires human intervention with inducers, which can adversely affect the normal growth and metabolism of microbial cells, and also greatly increase production costs. SUMMARY

[0004] In view of the deficiencies of the prior art, the present application aims to provide a programmable prokaryotic microorganism automatic lysis control system and application. In the system, the promoter Tac-lysis is an extremely low-osmotic promoter before being turned on, the number of the conduction target basic components is variable, the conduction sgRNA promoter and the priming sgRNA promoter can adopt various combinations with adjustable relative expression intensity, thus, the time of starting microorganism lysis can be controlled by changing the number of the conduction target basic components, and the target editing efficiency and the downstream gene activation expression time can be precisely regulated by adjusting the promoter expression intensity ratio of the conduction sgRNA and the priming sgRNA. The system has good robustness and programmability.

[0005] In order to achieve the above-mentioned purpose, the present application adopts the following technical solutions:

[0006] In the first aspect of the present application, a gene timing expression regulatory element is disclosed, and the overall sequence representation is as follows:

[0007] 5'-CGTTATGCGAGCCGATGATGCTT-TATCAA-CTGACG-[AGCTAACTGCT GTCACT]x n-AGC-TGG-3', n = 1, 2, 3,...;

[0008] CGTTATG-CGAGCCGATGATGCTT-TATCAA is the nucleotide sequence of the Tac-lysis promoter, denoted as SEQ ID NO. 1; TGCTTTATCAACTGACGAGC is the nucleotide sequence of the priming target, denoted as SEQ ID NO. 2; AGCTAACTGCTGTCACT is the nucleotide sequence of the conduction target basic component, denoted as SEQ ID NO. 3; AGCTAACTGCTGTCACTAGCTGG is the nucleotide sequence of the initial conduction target, denoted as SEQ ID NO. 4;

[0009] The initial conduction target and the conduction target share an sgRNA, which is called a conduction sgRNA, and the nucleotide sequence of the conduction sgRNA is shown in SEQ ID NO. 5; the sgRNA used by the priming target is called a priming sgRNA, and the nucleotide sequence of the priming sgRNA is shown in SEQ ID NO. 6.

[0010] In some specific examples of the present application, the ratio of the expression intensity of the conduction sgRNA promoter to the priming sgRNA promoter is 1:1 to 1:0.33.

[0011] In some specific examples of the present application, the conduction sgRNA promoter is J23119, and the priming sgRNA promoter is J23110.

[0012] In some embodiments of the present application, the promoter of the conduct sgRNA is J23119, and the promoter of the priming sgRNA is J23119.

[0013] In a second aspect of the present application, a programmable prokaryotic microorganism timed lysis system is disclosed, comprising: a pCDF-BioAutolysis plasmid and a pACYC-ABE8e(dCas9) plasmid, wherein,

[0014] The pCDF-BioAutolysis plasmid is obtained by the following method: cloning the gene timed expression regulatory element described above into a pCDFDuet-1 plasmid to obtain a pCDF-Fuze-n plasmid; then cloning the ΦX174E gene and the conduct sgRNA described above into the pCDF-Fuze-n plasmid to obtain a pCDF-Fuze-n-ΦX174E plasmid; finally, cloning the human lysozyme gene LYZ and the exogenous target gene / gene cluster into the pCDF-Fuze-n-ΦX174E plasmid to obtain the pCDF-BioAutolysis plasmid.

[0015] The pACYC-ABE8e(dCas9) plasmid is obtained by the following method: cloning ABE8e(dCas9) and the priming sgRNA described above into a pACYCDuet-1 to obtain the pACYC-ABE8e(dCas9) plasmid.

[0016] In some embodiments of the present application, the conduct sgRNA is controlled by the J23119 promoter, the human lysozyme gene LYZ is controlled by the J23109 promoter, the ABE8e(dCas9) is controlled by the J23105 promoter, and the priming sgRNA is controlled by the J23119 promoter.

[0017] In some embodiments of the present application, the exogenous target gene / gene cluster comprises functional genes / gene clusters or regulatory factors of natural product synthesis metabolic pathways, antibiotic synthesis metabolic pathways, disease treatment related drug synthesis pathways, drug delivery medical bacterial sheath genes, or environmental pollutant degradation pathways.

[0018] In a third aspect of the present application, the present application further discloses a method for timed automatic lysis of prokaryotic microorganisms, comprising: constructing the pCDF-BioAutolysis plasmid and the pACYC-ABE8e(dCas9) plasmid in the prokaryotic microorganism timed lysis system described above, then co-transforming the two into a recipient cell, and inoculating the transformed cell into a corresponding culture environment to regulate the automatic expression of the lysis gene ΦX174E at a preset time, so that the cell is automatically lysed at the preset time and releases human lysozyme, which, through a chain reaction, lysates all prokaryotic microorganisms and releases the exogenous target gene / gene cluster.

[0019] In a fourth aspect of the present application, the present application further discloses the application of the gene timed expression regulatory element, especially in industrial production fermentation, environmental pollutant treatment and medical bacterial targeted drug delivery.

[0020] In a fifth aspect of the present application, the present application further discloses the application of the programmable prokaryotic microorganism timed lysis system, especially in industrial production fermentation, environmental pollutant treatment and medical bacterial targeted drug delivery.

[0021] Compared with the prior art, the present application has the following beneficial technical effects:

[0022] The present application provides a brand-new gene timed expression regulatory element, wherein the promoter Tac-lysis is an extremely low-osmotic promoter before being turned on, has almost no leakage to the downstream gene expression in the prokaryotic microorganism, and restores activity after the ABE8e is modified to activate the target point; the number of the basic components of the conduction target point is variable, and the conduction sgRNA promoter and the trigger sgRNA promoter can adopt various combinations with adjustable relative expression intensity. Therefore, the prokaryotic microorganism timed lysis system based on the gene timed expression regulatory element can control the time of starting lysis of the prokaryotic microorganism cell by changing the number (or the sequence length of the element) of the basic components of the conduction target point, and can also regulate the target point editing efficiency and the activation expression time of the downstream gene by adjusting the ratio of the expression intensity of the conduction sgRNA and the trigger sgRNA. The system has good robustness and programmability.

[0023] The gene timed expression regulatory element / prokaryotic microorganism timed lysis system is applied to industrial production fermentation, without any manual intervention or additional inducers, can dynamically regulate gene expression according to the growth and fermentation process of the prokaryotic microorganism cell, can automatically lyse the cell at a preset time after the fermentation is completed, and release the contents, thereby simplifying the process flow, reducing the production cost, and having good economic benefits.

[0024] The gene timed expression regulatory element / prokaryotic microorganism timed lysis system is applied to environmental pollutant treatment, so that the engineering bacteria can be lysed at a preset time after the pollutants are degraded by the engineering bacteria, thereby avoiding interference of the engineering bacteria on the ecological environment, and improving safety of the environmental pollutant treatment process of the engineering bacteria.

[0025] The gene timed expression regulatory element / prokaryotic microorganism timed lysis system is applied to medical bacterial targeted drug delivery, so that the bacteria can be automatically lysed at a time after the medical bacteria are targeted to a disease site, and intracellular effective drug components are released, which improves drug utilization efficiency to a certain extent, reduces potential bacterial infection risk, and does not need any additional inducers, and has more superior safety and targeting than other synthetic organic carriers and inorganic particle carriers. BRIEF DESCRIPTION OF DRAWINGS

[0026] Figure 1 It is a pCDF-BioAutolysis plasmid map.

[0027] Figure 2 It is a pACYC-J23105-ABE8e(dCas9) plasmid map.

[0028] Figure 3 It is a pCDF-Fuze9-mCherry plasmid map.

[0029] Figure 4A Various combinations of PsgRNA and SsgRNA with different relative expression intensities of promoters are listed. Figure 4B It is given Figure 4A Target editing efficiency of various combinations of BioAutolysis systems is listed.

[0030] Figure 5 It is a BioAutolysis system carrying a conductive target with different lengths over time lysis efficiency diagram.

[0031] Figure 6 It is a BioAutolysis system carrying two conductive targets at different times of each target editing efficiency heat map.

[0032] Figure 7 It is a BioAutolysis system carrying three conductive targets at different times of each target editing efficiency heat map.

[0033] Figure 8 It is a scanning electron microscope diagram of cell morphological changes of different BioAutolysis systems under 10Kx resolution.

[0034] Figure 9Scanning electron microscope images of cell morphology changes of different BioAutolysis systems under 2Kx resolution.

[0035] Figure 10 Bacterial growth curves of BioAutolysis systems with different lengths of conductive target points and control systems.

[0036] Figure 11A Comparison chart of average fluorescence values of Tac-lysis-OFF and Tac-lysis-ON.

[0037] Figure 11B Comparison chart of mCherry gene transcription levels of Tac-lysis-OFF and Tac-lysis-ON.

[0038] Figure 12 BioAutolysis target sequence order editing principle diagram.

[0039] Figure 13 BioAutolysis system working principle diagram. DETAILED DESCRIPTION

[0040] The embodiments of the present application will be described in detail below with reference to the accompanying drawings and specific examples. In the following examples, mCherry is selected as the target protein expressed and released by lysis in the model organism Escherichia coli of prokaryotic microorganisms to illustrate the lysis and release. It should be noted that these examples are only used to illustrate the present application and should not be considered as limiting the scope of application of the present application.

[0041] I. Materials and reagents

[0042] Escherichia coli DH5a competent cells were purchased from TOLOBIO company, Escherichia coli BL21(DE3) competent cells were purchased from TransGen company, plasmid extraction kit was purchased from AXYGEN company, PCR product nucleic acid purification kit was purchased from Promega company, DNA polymerase Gloria Nova HS2x Master Mix(RK20717) for amplifying fragments was purchased from Abclonal company, cloning kit 2x MultiF Seamless Assembly Mix(RK21020) was purchased from ABclonal company. pCDFDuet-1 plasmid and pACYCDuet-1 plasmid were purchased from Novagen company. pCMV-ABE8e plasmid was used as a fragment template for ABE8e, which can be purchased from addgene. The formula of LB liquid medium is: tryptone 10 g, yeast extract 5 g, NaCl 10 g, deionized water 1 L. LB solid medium(LB medium plate) is additionally added with 15 g agar based on the formula of LB liquid medium. Tryptone, sodium chloride, yeast extract were purchased from OXOID company. The concentration of antibiotics used in the process of Escherichia coli culture is as follows: streptomycin 40 μg / ml, chloramphenicol 34 μg / ml, both purchased from Sangon Biotech company.

[0043] II. Synthesis of gene sequence

[0044] The following gene fragments were synthesized by Beijing Qikexing Biotechnology Co., Ltd.: conductive sgRNA fragment, excitation sgRNA fragment, bacterial lysis gene ΦX174E, human lysozyme gene, mCherry gene, Fuze2-lysis gene fragment, Fuze3-lysis gene fragment, Fuze 9-mCherry gene fragment.

[0045] The nucleotide sequence of the conductive sgRNA fragment is shown in SEQ ID NO. 5, which contains a conductive sgRNA and a sequence with low homology to other components to facilitate recombination.

[0046] The nucleotide sequence of the excitation sgRNA fragment is shown in SEQ ID NO. 6. The fragment contains an excitation sgRNA and a sequence with low homology to other components to facilitate recombination.

[0047] The bacterial lysis gene ΦX174E is shown in SEQ ID NO. 7, which includes a sequence with low homology to other components at the 3' end to facilitate recombination.

[0048] The human lysozyme gene is shown as SEQ ID NO. 8, which contains a J23109 promoter framework at its 5' end and a sequence with low homology to other components at its 3' end for facilitating recombination.

[0049] The mCherry gene is shown as SEQ ID NO. 9, which contains a J23105 promoter framework at its 5' end and a sequence with low homology to other components at its 3' end for facilitating recombination.

[0050] The nucleotide sequences of the Fuze2-lysis, Fuze3-lysis and Fuze9-mCherry gene fragments are shown as SEQ ID NO. 10, SEQ ID NO. 11 and SEQ ID NO. 12, respectively, which contain a sequence with low homology to other components at their upstream and downstream for facilitating recombination.

[0051] The ABE8e fragment is shown as SEQ ID NO. 13, which contains a J23105 promoter framework at its 5' end and a sequence with low homology to other components at its 3' end for facilitating recombination.

[0052] In addition, the primers are shown as follows, which are synthesized by Beijing Genesee Biotechnology Co., Ltd.:

[0053] The nucleotide sequence of the first primer X174E-F is shown as SEQ ID NO. 19, and the nucleotide sequence of the second primer X174E-R is shown as SEQ ID NO. 20.

[0054] The nucleotide sequence of the third primer Fuze-F is shown as SEQ ID NO. 21, and the nucleotide sequence of the fourth primer Fuze-R is shown as SEQ ID NO. 22.

[0055] The nucleotide sequence of the fifth primer pCDF-Fuze-F is shown as SEQ ID NO. 23, and the nucleotide sequence of the sixth primer pCDF-Fuze-R is shown as SEQ ID NO. 24.

[0056] The nucleotide sequence of the seventh primer Psg-F is shown as SEQ ID NO. 25, and the nucleotide sequence of the eighth primer Psg-R is shown as SEQ ID NO. 26.

[0057] The nucleotide sequence of the ninth primer pCDF-psg-F is shown as SEQ ID NO. 27, and the nucleotide sequence of the tenth primer pCDF-psg-R is shown as SEQ ID NO. 28.

[0058] The nucleotide sequence of the eleventh primer Lyz-F is shown in SEQ ID NO. 29, and the nucleotide sequence of the twelfth primer Lyz-R is shown in SEQ ID NO. 30;

[0059] The nucleotide sequence of the thirteenth primer pCDF-lyz-F is shown in SEQ ID NO. 31, and the nucleotide sequence of the fourteenth primer pCDF-lyz-R is shown in SEQ ID NO. 32;

[0060] The nucleotide sequence of the fifteenth primer mCherry-F is shown in SEQ ID NO. 33, and the nucleotide sequence of the sixteenth primer mCherry-R is shown in SEQ ID NO. 34;

[0061] The nucleotide sequence of the seventeenth primer pCDF-mCherry-F is shown in SEQ ID NO. 35, and the nucleotide sequence of the eighteenth primer pCDF-mCherry-R is shown in SEQ ID NO. 36;

[0062] The nucleotide sequence of the nineteenth primer ABE8e-F is shown in SEQ ID NO. 37, and the nucleotide sequence of the twentieth primer ABE8e-R is shown in SEQ ID NO. 38;

[0063] The nucleotide sequence of the twenty-first primer pACYC-ABE-F is shown in SEQ ID NO. 39, and the nucleotide sequence of the primer pACYC-ABE-R is shown in SEQ ID NO. 40;

[0064] The nucleotide sequence of the twenty-third primer Ssg-F is shown in SEQ ID NO. 41, and the nucleotide sequence of the twenty-fourth primer Ssg-R is shown in SEQ ID NO. 42;

[0065] The nucleotide sequence of the twenty-fifth primer pACYC-ssg-F is shown in SEQ ID NO. 43, and the nucleotide sequence of the twenty-sixth primer pACYC-ssg-R is shown in SEQ ID NO. 44.

[0066] The nucleotide sequence of the twenty-seventh primer Fuze9-F is shown in SEQ ID NO. 45, and the nucleotide sequence of the twenty-eighth primer Fuze9-R is shown in SEQ ID NO. 46;

[0067] The nucleotide sequence of the twenty-ninth primer pCDF-Fuze9-mCherry-F is shown in SEQ ID NO. 47, and the nucleotide sequence of the thirtieth primer pCDF-Fuze9-mCherry-R is shown in SEQ ID NO. 48.

[0068] The nucleotide sequence of the thirty-third primer pCDF-Tac-lysis-ON-F is shown as SEQ ID NO. 51, and the nucleotide sequence of the thirty-fourth primer pCDF-Tac-lysis-ON-R is shown as SEQ ID NO. 52.

[0069] The nucleotide sequence of the thirty-third primer pCDF-Tac-lysis-ON-F is shown as SEQ ID NO. 51, and the nucleotide sequence of the thirty-fourth primer pCDF-Tac-lysis-ON-R is shown as SEQ ID NO. 52.

[0070] Three, system-related plasmid construction

[0071] 3.1 pCDF-BioAutolysis plasmid construction

[0072] ΦX174E gene was amplified using X174E-F and X174E-R primers, Fuze n-lysis fragment (Fuze2-lysis or Fuze3-lysis) was amplified using Fuze-F and Fuze-R primers, and pCDFDuet1-1 plasmid fragment was amplified using pCDF-Fuze-F and pCDF-Fuze-R primers.

[0073] The above amplification used Gloria Nova HS2x Master Mix from ABclonal. The amplification system included: Gloria Nova HS2x Master Mix 25 μL, 1 μL of each of the upstream and downstream primers, 1 μL of template, and 22 μL of deionized water. The PCR program was as follows: (1) 98°C, 5 min; (2) 98°C, 15 s; (3) 60°C, 30 s; (3) 72°C, 2 min 30 s; steps (2) to (4) were repeated for 35 cycles; (5) 72°C, 10 min.

[0074] The three PCR products amplified above were cloned in one step using 2x MultiF Seamless Assembly Mix reagent from ABclonal: the amplified fragments were mixed in equal molar ratio, with a total volume of 10 μL, and 10 μL of 2x MultiF Seamless Assembly Mix was added. After 30 min of ligation in a 50°C water bath, 10 μL of the reaction solution was added to TOLOBIO's E. coli DH5α competent cells, which were then incubated in an ice bath for 30 min, heat shocked at 42°C for 90 s, and then incubated in 400 μL of liquid LB medium at 37°C for 2 h. The cells were then plated on LB medium containing streptomycin (40 μg / ml) and incubated at 37°C for 24 h. The colonies were then picked and sequenced. After sequencing and alignment, the p1 plasmid was constructed, and the p1 plasmid was obtained.

[0075] Then, the sgRNA fragment was amplified using Psg-F and Psg-R primers, and the p1 plasmid fragment was amplified using pCDF-psg-F and pCDF-psg-R primers. The amplification method was exactly the same as that used in the p1 plasmid construction, and each PCR product was cloned in one step using the same method as that used in the p1 plasmid construction. After sequencing and alignment, the p2 plasmid was constructed, and the p2 plasmid was obtained.

[0076] Next, the human lysozyme gene fragment was amplified using Lyz-F and Lyz-R primers, and the p2 plasmid fragment was amplified using pCDF-lyz-F and pCDF-lyz-R primers. The amplification method was exactly the same as that used in the p1 plasmid construction, and each PCR product was cloned in one step using the same method as that used in the p1 plasmid construction. After sequencing and alignment, the p3 plasmid was constructed, and the p3 plasmid was obtained.

[0077] Finally, the mCherry fragment was amplified using mCherry-F and mCherry-R primers, and the p3 plasmid fragment was amplified using pCDF-mCherry-F and pCDF-mCherry-R primers. The amplification method was exactly the same as that used in the p1 plasmid construction, and each PCR product was cloned in one step using the same method as that used in the p1 plasmid construction. After sequencing and alignment, the plasmid was constructed, and the pCDF-BioAutolysis plasmid was obtained. The plasmid map is shown in Figure 1 .

[0078] 3.2 pACYC-J23105-ABE8e (dCas9) plasmid construction

[0079] ABE8e-F and ABE8e-R primers, and the pACYC-ABE-F and pACYC-ABE-R primers, respectively.

[0080] The above amplification uses Gloria Nova HS2x Master Mix from ABclonal. The amplification system includes: Gloria Nova HS2x Master Mix 25 μL, 1 μL of each of the upstream and downstream primers, 1 μL of template, 22 μL of deionized water. The PCR program is as follows: (1) 98°C, 5 min; (2) 98°C, 15 s; (3) 60°C, 30 s; (3) 72°C, 2 min 30 s; repeat steps (2) to (4) for 35 cycles; (5) 72°C, 10 min.

[0081] The two PCR products amplified above are subjected to one-step cloning using 2x MultiF Seamless Assembly Mix reagent from ABclonal: mix the amplified fragments in equal molar ratio, the total volume is 10 μL, then add 10 μL of 2x MultiF Seamless Assembly Mix, connect in a 50°C water bath for 30 min, then take 10 μL of the reacted solution and add it to TOLOBIO's E. coli DH5α competent cells, ice bath for 30 min, heat shock at 42°C water bath for 90 s, add 400 μL of liquid LB medium, incubate at 37°C on a shaker at 220 rpm for 2 h, spread on LB medium plates containing chloramphenicol (34 μg / ml), incubate at 37°C for 24 h, then pick bacteria for sequencing. After correct sequencing alignment, the p4 plasmid construction is completed, and the p4 plasmid is obtained.

[0082] ABE8e-F and ABE8e-R primers, and the pACYC-ABE-F and pACYC-ABE-R primers, respectively. Figure 2

[0083] 3.3 pCDF-Fuze9-mCherry plasmid construction

[0084] ​The Fuze9-mCherry fragment is amplified using Fuze9-F and Fuze9-R primers, the pCDFDuet1-1 fragment is amplified using pCDF-Fuze9-mCherry-F and pCDF-Fuze9-mCherry-R primers, the amplification method is exactly the same as that used in the p1 plasmid construction, and each PCR product is cloned by the method exactly the same as that used in the p1 plasmid construction, and the p5 plasmid construction is completed after sequencing and comparison, and the p5 plasmid is obtained.

[0085] The sgRNA fragment is amplified using Psg-F and Psg-R primers, and the p5 plasmid fragment is amplified using pCDF-psg-F and pCDF-psg-R primers. The amplification method is exactly the same as that used in the p1 plasmid construction, and each PCR product is cloned by the method exactly the same as that used in the p1 plasmid construction, and the pCDF-Fuze9-mCherry plasmid construction is completed after sequencing and comparison, as shown in Figure 3 .

[0086] 3.4 pCDF-Tac-lysis-OFF and pCDF-Tac-lysis-ON plasmid construction

[0087] The p5 plasmid is amplified using pCDF-Tac-lysis-OFF-F and pCDF-Tac-lysis-OFF-R primer pairs, and the p5 plasmid is amplified using pCDF-Tac-lysis-ON-F / pCDF-Tac-lysis-ON-F primer pairs. The amplification method is exactly the same as that used in the p1 plasmid construction, and linearized fragments pCDF-Tac-lysis-OFF-h and pCDF-Tac-lysis-ON-h are obtained, respectively.

[0088] The amplified linearized fragment pCDF-Tac-lysis-OFF-h (or pCDF-Tac-lysis-ON-h) was cloned in one step using 2x MultiF Seamless Assembly Mix reagent from ABclonal: 5 μL of the amplified fragment was taken, 5 μL of 2x MultiF Seamless Assembly Mix was added, mixed, and then connected in a 50°C water bath for 30 min. Then, 10 μL of the reacted solution was taken and added to TOLOBIO's E. coli DH5α competent cells, which were then incubated in an ice bath for 30 min, heated in a 42°C water bath for 90 s, and then added to 400 μL of LB liquid medium. The mixture was incubated in a 37°C shaker at 220 rpm for 2 h, then spread on LB medium plates containing streptomycin (40 μg / ml), and then incubated at 37°C for 24 h. After that, the bacteria were picked and sequenced. After the correct sequence was obtained, the plasmid construction was completed, and pCDF-Tac-lysis-OFF plasmid (or pCDF-Tac-lysis-ON plasmid) was obtained.

[0089] Four, co-transformation of plasmids into E. coli

[0090] The 200 nanograms of pCDF-Fuze9-mCherry plasmid and 250 nanograms of pACYC-J23105-ABE8e (dCas9) plasmid were added to Transgen's E. coli BL21 (DE3) competent cells, which were then incubated in an ice bath for 30 min, heated in a 42°C water bath for 90 s, and then incubated in an ice bath for 5 min. Then, 400 μL of LB liquid medium was added, and the mixture was incubated in a 37°C shaker at 220 rpm for 2 h. Then, 200 μL of the bacterial solution was taken and spread on LB solid medium containing both chloramphenicol and streptomycin (chloramphenicol 34 μg / ml, streptomycin 40 μg / ml), and then incubated at 37°C for 12 h. After that, a single colony was picked and inoculated in 10 mL of LB liquid medium, which was then incubated at 37°C and 220 rpm. The culture was subcultured every 24 h at a volume ratio of 1:1000. At the same time, samples were taken every 24 h and sent to GenScript for sequencing to detect the editing efficiency of the target.

[0091] Here, several different combinations of PsgRNA (PsgRNA) promoters and SsgRNA (SsgRNA) promoters were used, as shown in Table 1. Figure 4A , which are specifically listed as follows:

[0092] The PsgRNA promoter is J23119, the SsgRNA promoter is J23119, the ratio of the expression strength of PsgRNA to SsgRNA is 1:1, and the sample name of the last sample is PS119.

[0093] The PsgRNA promoter is J23119, the SsgRNA promoter is J23101, the ratio of the expression intensity of the promoters of PsgRNA and SsgRNA is 1:0.7, and the sample name of the last sampling is PS101.

[0094] The PsgRNA promoter is J23119*2, the SsgRNA promoter is J23119, the ratio of the expression intensity of the promoters of PsgRNA and SsgRNA is 2:1, and the sample name of the last sampling is P2S119.

[0095] The PsgRNA promoter is J23119, the SsgRNA promoter is None, the ratio of the expression intensity of the promoters of PsgRNA and SsgRNA is 1:0, and the sample name of the last sampling is PS0.

[0096] The PsgRNA promoter is J23119*2, the SsgRNA promoter is None, the ratio of the expression intensity of the promoters of PsgRNA and SsgRNA is 2:0, and the sample name of the last sampling is P2S0.

[0097] The PsgRNA promoter is J23119, the SsgRNA promoter is J23110, the ratio of the expression intensity of the promoters of PsgRNA and SsgRNA is 1:0.33, and the sample name of the last sampling is PS110.

[0098] The sequence of J23119 is shown in SEQ ID NO. 14, the sequence of J23110 is shown in SEQ ID NO. 15, the sequence of J23101 is shown in SEQ ID NO. 16, the sequence of J23109 is shown in SEQ ID NO. 17, and the sequence of J23105 is shown in SEQ ID NO. 18.

[0099] The results of the target point editing efficiency obtained by sequencing the samples are as follows Figure 4BAs shown, it was found that the ratio of the expression intensity of PsgRNA to SsgRNA promoter could largely affect the editing efficiency of BioAutolysis system elements, wherein the higher the value of PsgRNA promoter intensity / SsgRNA promoter intensity, the higher the editing efficiency of each target point in the system, which means the shorter the time for downstream gene activation expression. When the PsgRNA promoter is J23119 and the SsgRNA promoter is J23110, the entire system can achieve the highest propulsion rate; when the PsgRNA promoter and the SsgRNA promoter are both J23119, the editing efficiency of the entire system is the lowest, which means that the action time of the entire system can be prolonged. This provides us with a new strategy (adjusting the expression intensity ratio of PsgRNA and SsgRNA promoters) to effectively control the target editing efficiency and working time of the entire system, enhancing the robustness and programmability of the system.

[0100] V. Timed cell lysis

[0101] Experimental group: 200 nanograms of pCDF-BioAutolysis plasmid and 250 nanograms of pACYC-J23105-ABE8e (dCas9) plasmid were added to the Transgen company's E. coli BL21 (DE3) competent cells, ice bath for 30 minutes, 42°C heat shock in water bath for 90 seconds, ice bath for 5 minutes, add 400 microliters of LB liquid medium, cultivate in 37°C shaking table 220 rpm for two hours, then take 200 microliters of bacteria liquid to inoculate in LB liquid medium (500 mL) containing chloramphenicol and streptomycin double-antibiotic (chloramphenicol 34 μg / ml, streptomycin 40 μg / ml), 37°C, 220 rpm continuous fermentation culture.

[0102] Control group: 200 nanograms of pCDF-BioAutolysis plasmid and 250 nanograms of p5 plasmid were added to the Transgen company's E. coli BL21 (DE3) competent cells, ice bath for 30 minutes, 42°C heat shock in water bath for 90 seconds, ice bath for 5 minutes, add 400 microliters of LB liquid medium, cultivate in 37°C shaking table 220 rpm for two hours, then take 200 microliters of bacteria liquid to inoculate in LB liquid medium (500 mL) containing chloramphenicol and streptomycin double-antibiotic (chloramphenicol 34 μg / ml, streptomycin 40 μg / ml), 37°C, 220 rpm continuous fermentation culture.

[0103] In the pCDF-BioAutolysis plasmid construction, the promoters of the sgRNA and the sgRNA trigger are both J23119. In the experimental group, the Fuze-lysis fragment is respectively Fuze2-lysis containing two transmission targets and Fuze3-lysis containing three transmission targets, which are respectively marked as Fuze2 group and Fuze3 group. In the control group, the Fuze-lysis fragment is Fuze2-lysis containing two transmission targets. In addition, the control group does not use the BioAutolysis system, and the p5 plasmid used does not contain sgRNA, so the promoter cannot be modified to activate the expression of the ΦX174E lysis gene. Therefore, the control group does not contain the expression trigger device for controlling the ΦX174E lysis gene.

[0104] During the fermentation culture of each bacterium described above, a portion of the sample was taken every 12 hours. After centrifugation of the sampled portion at 12000 rpm, the supernatant was taken, and the mCherry fluorescence value of 200 microliters of the supernatant and 200 microliters of the uncentrifuged sampled bacterial liquid was detected using an enzyme marker (absorption light 587 nm, excitation light 610 nm). At the same time, the editing of the related target was detected using the sequencing service of GenScript Biotech Corporation. A portion of the sample was taken every 24 hours, and after being fixed at 4°C using 2.5% glutaraldehyde for 12 hours and freeze-drying, the bacterial outer wall morphology was detected using a scanning electron microscope (SEM). The sample was taken every 4 hours, and the growth curve of the bacteria was detected using a spectrophotometer.

[0105] The mCherry fluorescence release rate was used as the lysis rate, and the detection results obtained by the Fuze2 group (marked as Fuze2-lysis) of the experimental group, the Fuze3 group (marked as Fuze3-lysis) of the experimental group, and the control group (marked as CK) were compared, as shown in Figure 5 As can be seen, in the two experimental groups using the BioAutolysis system, the lysis of E. coli has been optimized. Among them, the Fuze2 group using Fuze2-lysis containing two transmission targets can start lysis after 24 hours and reach a lysis rate higher than 90% after 72 hours. The Fuze3 group using Fuze3-lysis containing three transmission targets is slightly delayed and reaches a lysis rate of about 50% after 72 hours. The strain in the control group without using the BioAutolysis system is difficult to lyse, and the mCherry fluorescence release rate is less than 10%.

[0106] Further, the target editing sequencing results of the sampling samples at different times (12h, 24h, 36h, 48h, 60h, 72h) in the Fuze2 group of the experimental group are as follows: Figure 6As shown in Table 1, it can be seen that the editing efficiency of each conduct target (Push-site) and activation target (Switch-site) of the Fuze2 group sample (Fuze2-lysis) gradually increases over time, and the editing efficiency of the activation target reaches 31.9% at 24 h, effectively starting the expression of the downstream ΦX174E gene and prompting the cell to start lysis. Correspondingly, the scanning electron micrographs of the sampling samples at different times (24 h, 48 h, and 72 h) in the Fuze2 group of the experimental group are shown in FIGS. 2A, 2B, and 2C, respectively. Figure 8 and Figure 9 As shown in Table 1, it can be seen that the editing efficiency of each conduct target (Push-site) and activation target (Switch-site) of the Fuze2 group sample (Fuze2-lysis) gradually increases over time, and the editing efficiency of the activation target reaches 31.9% at 24 h, effectively starting the expression of the downstream ΦX174E gene and prompting the cell to start lysis. Correspondingly, the scanning electron micrographs of the sampling samples at different times (24 h, 48 h, and 72 h) in the Fuze2 group of the experimental group are shown in FIGS. 2A, 2B, and 2C, respectively.

[0107] Similarly, the target editing sequencing results of the sampling samples at different times (12 h, 24 h, 36 h, 48 h, 60 h, and 72 h) in the Fuze3 group of the experimental group are shown in Table 2. Figure 7 As shown in Table 2, it can be seen that the editing efficiency of each conduct target and activation target of the Fuze3 group sample (Fuze3-lysis) also gradually increases over time, but the overall editing efficiency is more lagging than that of the Fuze2-lysis. The editing efficiency of the activation target is only 5% at 24 h, which does not effectively start the expression of the downstream gene, and the editing efficiency reaches 23.5% at 72 h, effectively starting the expression of the downstream ΦX174E gene and prompting the cell to start lysis. Correspondingly, the scanning electron micrographs of the sampling samples at different times (24 h, 48 h, and 72 h) in the Fuze3 group of the experimental group are shown in FIGS. 3A, 3B, and 3C, respectively. Figure 8 and Figure 9 As shown in Table 2, it can be seen that the editing efficiency of each conduct target and activation target of the Fuze3 group sample (Fuze3-lysis) also gradually increases over time, but the overall editing efficiency is more lagging than that of the Fuze2-lysis. The editing efficiency of the activation target is only 5% at 24 h, which does not effectively start the expression of the downstream gene, and the editing efficiency reaches 23.5% at 72 h, effectively starting the expression of the downstream ΦX174E gene and prompting the cell to start lysis. Correspondingly, the scanning electron micrographs of the sampling samples at different times (24 h, 48 h, and 72 h) in the Fuze3 group of the experimental group are shown in FIGS. 3A, 3B, and 3C, respectively.

[0108] In Table 2, the scanning electron micrographs of the sampling samples at different times (24 h, 48 h, and 72 h) in the control group (CK) are also shown in FIGS. 4A, 4B, and 4C, respectively. It can be seen that at 24 h, 48 h, and 72 h, the cell morphology of the sample remains intact, indicating that the bacteria do not effectively lyse without activation of the lysis gene. Figure 8 and Figure 9 In Table 2, the scanning electron micrographs of the sampling samples at different times (24 h, 48 h, and 72 h) in the control group (CK) are also shown in FIGS. 4A, 4B, and 4C, respectively. It can be seen that at 24 h, 48 h, and 72 h, the cell morphology of the sample remains intact, indicating that the bacteria do not effectively lyse without activation of the lysis gene.

[0109] It can be found that the target point editing sequencing results and the scanning electron microscopy results are consistent with the above-mentioned lysis rate results, which means that the BioAutolysis system can control the lysis of bacteria, and the time required for bacterial lysis can be effectively controlled by pre-setting the number of conduction targets.

[0110] In addition, the growth curves of the bacteria in the Fuze2 group and the Fuze3 group of the experimental group and the control group are as shown in Figure 10 The results show that in the early stage of fermentation, the BioAutolysis system does not significantly inhibit the normal growth of the bacteria, and can ensure that the bacteria can grow normally in the early stage until the predetermined function is completed and the lysis is started. This reveals the great application potential of the system in the fields of industrial fermentation, environmental governance, drug release, etc.

[0111] VI. Promoter strength characterization

[0112] 200 nanograms of pCDF-Tac-lysis-OFF plasmid (or pCDF-Tac-lysis-ON plasmid) and 250 nanograms of pACYC-J23105-ABE8e (dCas9) plasmid were added to the E. coli BL21 (DE3) competent cells of Transgen Company, ice bath for 30 minutes, 42°C heat shock in water bath for 90 seconds, ice bath for 5 minutes, add 400 microliters of LB liquid medium, cultivate in 37°C shaker 220 rpm for two hours, then take 200 microliters of bacterial liquid and spread on LB medium plate containing chloramphenicol and streptomycin double-antibiotic (chloramphenicol 34 μg / ml, streptomycin 40 μg / ml), 37°C inverted culture for 12 hours, then pick single colony and inoculate in 10 mL LB liquid medium, 37°C, 220 rpm continuous fermentation culture. When the OD 600 of the bacterial liquid reaches about 1.0, take 1 mL of bacterial liquid and use fluorescent real-time quantitative PCR to detect the expression level difference of the mCherry gene. After 24 hours of shaking culture, take 200 microliters of bacterial liquid and use the enzyme marker (absorption light 587 nm, excitation light 610 nm) to detect the mCherry fluorescence value. The results show that the average fluorescence value of Tac-lysis-OFF detected by the enzyme marker is 18.98, which is almost the same as the mCherry fluorescence value of E. coli not carrying the mCherry fluorescence gene, while the average fluorescence value of Tac-lysis-ON is 441.83, which significantly increases the expression amount (as shown in Figure 11AThe mCherry gene transcription level of Tac-lysis-ON is about 101.5 times of that of Tac-lysis-OFF before turning on, which proves that Tac-lysis before turning on (OFF) has very low leakage in protein expression and transcription level of mCherry, while after turning on (ON) it can effectively start the expression of subsequent genes or gene clusters (such as Figure 11B

[0113] It can be seen that the above embodiment provides a BioAutolysis system for controlling the timed lysis of bacteria. The system has the following characteristics:

[0114] (1) The excitation target and the Tac-lysis promoter are connected by a variable number of conductive targets to form a gene timed expression regulatory element;

[0115] (2) A protein E gene (ΦX174E) of bacteriophage X174 is connected downstream of the element, and the protein expressed by the gene can degrade the cell wall from the inside to promote bacterial lysis;

[0116] (3) The constitutive expression of human lysozyme (lysozyme, LYZ) is controlled by the J23109 promoter, and the lysozyme can degrade the peptidoglycan of the outer wall of the bacteria to promote bacterial lysis;

[0117] (4) The constitutive expression of PsgRNA and SsgRNA is controlled by the J23119 promoter, and the constitutive expression of ABE8e protein is controlled by the J23105 promoter to realize the timed modification of the regulatory element described in (1);

[0118] (5) The constitutive expression of mCherry protein is controlled by J23105 to serve as a target protein for bacterial lysis release and detection.

[0119] In the above embodiment, the overall sequence of the gene timed expression regulatory element adopted is as follows: 5'-CGTTATGCGAGCCGATGATGCTT-TATCAA-CTGACG-[AGCTAACTGCTGTC ACT]x n-AGC-TGG-3';

[0120] ​The overall sequence of the gene timing expression regulatory element taken can also be written as: 5'-Tac-lysis promoter-priming target-conduction target basic component x n-AGC-TGG-3', wherein n is the number of conduction target basic components, n = 1, 2, 3…; the nucleotide sequence of Tac-lysis promoter is shown in SEQ ID NO. 1; the nucleotide sequence of priming target is shown in SEQ ID NO. 2; the nucleotide sequence of conduction target basic component is shown in SEQ ID NO. 3.

[0121] It can also be written as: 5'-Tac-lysis promoter-priming target-conduction target basic component x (n-1)-conduction target basic component-AGC-TGG-3', wherein {conduction target basic component-AGC-TGG} at the 3' end is regarded as the initial conduction target, and the sequence of the initial conduction target is shown in SEQ ID NO. 4.

[0122] Wherein, the initial conduction target and the conduction target share sgRNA, which is called conduction sgRNA (PsgRNA), and the nucleotide sequence of the conduction sgRNA is shown in SEQ ID NO. 5; the sgRNA used by the priming target is called priming sgRNA (SsgRNA), and the nucleotide sequence of the priming sgRNA is shown in SEQ ID NO. 6.

[0123] As shown in Figure 12 In the above gene timing expression regulatory element, only the initial conduction target can be recognized and edited by ABE8e in the initial state, then after the initial conduction target is modified by ABE8e, the modification makes the PAM of the conduction target activated due to the overlap of the 5' end of the initial conduction target and the 3' end of the conduction target, the conduction target is converted into the initial conduction target and is modified, and the next conduction target is activated, and so on, each target from 3' end to 5' end of the whole sequence will be activated in sequence, finally the adenine A in the -35 box editing frame of Tac-lysis promoter is modified to guanine G, so that the Tac-lysis promoter is activated, thereby achieving the purpose of regulating the expression of downstream genes.

[0124] As shown in Figure 13 The process of using BioAutolysis system to control the timing automatic lysis of bacteria is as follows:

[0125] Stage 1: ABE8e combined with PsgRNA forms ribonucleoprotein (RNP), which first edits the conduction target and sequentially opens downstream targets;

[0126] Stage 2: After a predetermined time, ABE8e targeting SsgRNA is targeted to the open activation target, modifying the Tac-lysis promoter and turning it on, starting the expression of ΦX174E and degrading the cell wall of the bacteria;

[0127] Stage 3: The degraded bacterial cells release intracellularly expressed human lysozyme to lyse surrounding bacteria, and further release more LYZ to act on more bacterial cells, forming a chain reaction to promote the lysis of the entire bacterial population;

[0128] Stage 4: After the chain reaction is completed, the bacteria in the entire solution will become cell debris, and the target protein mCherry carried in the cell will be released into the solution.

[0129] It can be seen that the present application provides a brand new gene timing expression regulatory element, which has an extremely low penetration promoter Tac-lysis, almost no leakage of downstream gene expression in the bacterial body, and restores activity after ABE8e modification to the activation target; has a variable number of transmission target basic components and can adjust the relative expression intensity of the transmission sgRNA promoter and the various combinations of the sgRNA promoter. Therefore, the BioFuze based Microbial Autolysis System (BioAutolysis for short) based on the gene timing expression regulatory element can control the time of microbial cell lysis by changing the number of transmission target basic components (or the sequence length of the element), and can also adjust the ratio of the expression intensity of the transmission sgRNA and the sgRNA promoter to regulate the target editing efficiency and the activation expression time of the downstream gene. The system has good robustness and programmability, and can dynamically regulate gene expression according to the growth and fermentation process of the bacterial body, and finally realize automatic timing lysis of the bacterial body after completing the set function. In addition, the exogenous target gene (cluster) and other elements can be pre-programmed according to the actual situation to achieve better application effect.

[0130] Therefore, the above-mentioned gene timing expression regulatory element / prokaryotic microbial timing lysis system can provide a safer and simpler solution for microbial industrial fermentation product extraction, microbial environmental pollution treatment, medical bacterial targeted drug delivery and other application links.

[0131] For example, the gene timed expression regulatory element / prokaryotic microorganism timed lysis system is applied to industrial production fermentation, without any manual intervention or external inducer, the cells can be automatically lysed at a predetermined time after fermentation, and the contents, including but not limited to terpenes, flavonoids, alkaloids, vitamins, proteins, etc., are released, thereby simplifying the process flow, reducing production cost, and having good economic benefits.

[0132] For another example, the gene timed expression regulatory element / prokaryotic microorganism timed lysis system is applied to environmental pollutant treatment, and the engineering bacteria can be lysed at a predetermined time after degrading the pollutants, thereby avoiding interference with the ecological environment and improving the safety of the environmental pollutant treatment process of the engineering bacteria.

[0133] For another example, the gene timed expression regulatory element / prokaryotic microorganism timed lysis system is applied to medical bacterial targeted drug delivery, and the bacteria can be automatically lysed at a predetermined time after targeting the disease site, and the intracellular effective drug components, including but not limited to paclitaxel, sea squirt, doxorubicin, bisabolene, mitomycin, vinblastine or tyrosine kinase inhibitors, etc., are released. In this way, the drug utilization efficiency is improved to a certain extent, the potential risk of bacterial infection is reduced, and any external inducer is not needed, and compared with other synthetic organic carriers and inorganic particle carriers, the safety and targeting are more superior.

[0134] In addition, the above-mentioned is only one embodiment of the present application, and is not used to limit the present application. Any adjustment, improvement, equivalent replacement, etc. within the design spirit and principles of the present application should be included in the protection scope of the present application.

Claims

1. A gene timed expression control system, characterized in that: include: A gene timing expression regulatory element and sgRNA, wherein the overall sequence of the gene timing expression regulatory element is as follows: 5'-CGTTATGCGAGCCGATGATGCTT-TATCAA-CTGACG-[AGCTAACTGCTGTCACT] ×n-AGC-TGG-3', n=1, 2, 3...; Among them, CGTTATG-CGAGCCGATGATGCTT-TATCAA is the nucleotide sequence of the Tac-lysis promoter, recorded as SEQ ID NO.1; TGCTTTATCAACTGACGAGC is the nucleotide sequence of the excitation target, recorded as SEQ ID NO.2; AGCTAACTGCTGTCACT is the nucleotide sequence of the basic component of the transduction target, recorded as SEQ ID NO.3; AGCTAACTGCTGTCACTAGCTGG is the nucleotide sequence of the initial transduction target, recorded as SEQ ID NO.4; The initial transduction target and the transduction target share the same sgRNA, which is called the transduction sgRNA. The nucleotide sequence of the transduction sgRNA is shown in SEQ ID NO.5; the sgRNA used by the excitation target is called the excitation sgRNA. The nucleotide sequence of the excitation sgRNA is shown in SEQ ID NO.

6.

2. The gene timing expression control system according to claim 1, wherein: The ratio of the expression intensity of the promoter of the conductive sgRNA to the promoter of the stimulating sgRNA is 1:1 to 1:0.

3.

3. The gene timing expression control system according to claim 1, wherein: The promoter of the conductive sgRNA is J23119, and the promoter of the stimulating sgRNA is J23110.

4. The gene timing expression control system according to claim 1, wherein: The promoter of the conductive sgRNA is J23119, and the promoter of the stimulating sgRNA is J23119.

5. A programmable prokaryotic microbial timed lysis system comprising: pCDF-BioAutolysis plasmid and pACYC-ABE8e (dCas9) plasmid, among which, The pCDF-BioAutolysis plasmid is obtained by the following method: cloning the gene timing expression control element in the gene timing expression control system according to any one of claims 1 to 4 into the pCDFDuet-1 plasmid to obtain the pCDF-Fuze-n plasmid; and then ΦX174E The gene and the conductive sgRNA in the gene timing expression control system according to any one of claims 1 to 4 are cloned into the pCDF-Fuze-n plasmid to obtain pCDF-Fuze-n- ΦX174E Finally, the human lysozyme gene LYZ and the exogenous target gene / gene cluster were cloned into the pCDF-Fuze-n- ΦX174E Plasmid, finally obtaining pCDF-BioAutolysis plasmid; The pACYC-ABE8e (dCas9) plasmid is obtained by the following method: ABE8e (dCas9) and the stimulating sgRNA in the gene timed expression control system according to any one of claims 1 to 4 are cloned into pACYCDuet-1 to obtain the pACYC-ABE8e (dCas9) plasmid.

6. The programmable prokaryotic microorganism timed lysis system according to claim 5, characterized in that: The conduction sgRNA is controlled by the J23119 promoter, the human lysozyme gene LYZ is controlled by the J23109 promoter, the ABE8e (dCas9) is controlled by the J23105 promoter, and the stimulation sgRNA is controlled by the J23119 promoter.

7. The programmable prokaryotic microorganism timed lysis system according to claim 5 or 6, characterized in that: The exogenous target genes / gene clusters include functional genes / gene clusters or regulatory factors in natural product synthesis metabolic pathways, antibiotic synthesis metabolic pathways, disease treatment-related drug synthesis pathways, drug delivery medical bacterial coat genes or environmental pollutant degradation pathways.

8. A method for the timed automatic lysis of prokaryotic microorganisms, comprising: Construct the pCDF-BioAutolysis plasmid and the pACYC-ABE8e (dCas9) plasmid in the prokaryotic microorganism timed lysis system as described in any one of claims 5 to 7, then co-transform the two into recipient cells, and inoculate the transformed cells into the corresponding culture environment. After a preset time, the cells automatically lyse, releasing human lysozyme, and all prokaryotic microorganisms are lysed through a chain reaction, releasing the exogenous target gene / gene cluster.

9. The use of the gene timed expression control system according to any one of claims 1 to 4 is in industrial fermentation, environmental pollutant treatment, and preparation of medical bacterial targeted drug delivery systems.

10. The application of the programmable prokaryotic microbial timed lysis system according to any one of claims 5 to 7 is in industrial production fermentation, environmental pollutant treatment and preparation of medical bacterial targeted drug delivery systems.

Images