Application of OsIAA9 gene in regulating deep root ratio of crops

Abstract

The invention provides application of an OsIAA9 gene in regulation and control of the deep root ratio of crops. The nucleotide sequence of the OsIAA9 gene is shown as SEQ ID NO: 1. According to the invention, a CRIPSR / Cas9 gene editing method is utilized to edit the OsIAA9 gene in rice, and the deep root ratio of the obtained rice mutant is obviously increased. The rice OsIAA9 gene disclosed by the invention has a negative regulation function on the deep root ratio, and the method for carrying out gene editing on the OsIAA9 provided by the invention can be applied to drought-resistant breeding of rice, improvement of root configuration and improvement of stress resistance of rice.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering, relates to a gene related to crop root growth, and specifically relates to an application of an OsIAA9 gene in regulating the deep root ratio of crops. Background Art

[0002] Natural disasters such as drought and water shortage occur frequently, seriously affecting global food production. Drought stress seriously affects crop growth and development, and even causes crop death, which is one of the main environmental factors causing food production reduction. As one of the important staple foods, rice consumes a huge amount of water. According to statistics, the water demand for rice in my country accounts for about 65% of agricultural irrigation water. Using modern biological technology to clone important rice drought-resistant genes, using transgenic or gene editing technology to genetically modify rice drought-resistant genes, and cultivating new water-saving and drought-resistant rice varieties are effective ways to alleviate the food production pressure caused by global drought, water shortage and population growth.

[0003] Rice drought resistance can be divided into drought tolerance, drought avoidance, and recovery drought resistance. Drought avoidance refers to the fact that rice maintains water potential in the rice body by reducing leaf water loss or promoting root absorption of soil moisture to avoid damage caused by drought stress. Studies have shown that rice varieties with strong drought resistance often have more deep roots, which can absorb moisture from deep soil when drought occurs, thus having stronger drought avoidance. In the study of grass crops, the ratio of the number of roots growing downward (angle of 50-90° to the horizontal) to the number of roots growing sideways (angle of 0-50° to the horizontal) is called the deep root ratio. Generally, the larger the deep root ratio, the stronger the ability of plants to absorb deep water, and therefore the stronger the drought resistance.

[0004] At present, the genes that control the deep root ratio of rice have been genetically located and candidate genes have been mined, and a small number of genes that control the deep root ratio of rice, such as DRO1, have been identified. Studies have shown that high expression of DRO1 can increase the root growth angle and make its growth direction more vertical, thus giving rice a higher deep root ratio and higher yield under drought stress conditions. At present, more genes that regulate the deep root ratio of rice need to be identified for application in the cultivation of water-saving and drought-resistant rice.

[0005] Auxin is one of the main hormones that regulate the growth and development of plant roots. Auxin can induce the expression of a series of early auxin response genes, including Aux / IAA, GH3 and SAUR. Among them, the Aux / IAA gene family is a typical representative of auxin response genes. It mainly acts as a transcriptional repressor by interacting with ARF proteins to regulate the expression of downstream genes in the auxin signaling pathway. There are 31 members in the rice Aux / IAA gene family. At present, the biological functions of a few members have been identified, such as OsIAA1\OsIAA3\OsIAA6\OsIAA11, etc. Studies have shown that these genes are related to rice traits such as plant height, tillering, and sensitivity to auxin. In the previous genetic positioning study, our laboratory discovered a gene OsIAA8 that controls the deep root ratio of rice. The OsIAA8 gene is induced by osmotic stress, abscisic acid and auxin. Overexpression of OsIAA8 can increase the deep root ratio of rice and thus enhance the drought resistance of rice, which is related to the stress resistance of rice. However, other rice Aux / IAA gene family members have not been reported to regulate rice deep rooting ratio. Summary of the invention

[0006] In view of the deficiencies in the prior art, the object of the present invention is to provide an application of an OsIAA9 gene in regulating the deep root ratio of crops.

[0007] The objective of the present invention is achieved through the following technical solutions:

[0008] In a first aspect, the present invention provides an application of an OsIAA9 gene in regulating the deep root ratio of crops, wherein the nucleotide sequence of the OsIAA9 gene is shown in SEQ ID NO:1.

[0009] As a preferred embodiment, the amino acid sequence encoded by the OsIAA9 gene is shown in SEQ ID NO:2.

[0010] As a preferred embodiment, the application is to use the OsIAA9 gene mutant obtained by site-directed editing of the nucleotide sequence of the OsIAA9 gene to improve the deep root ratio of crops.

[0011] As a preferred embodiment, the amino acid sequence encoded by the OsIAA9 gene mutant is shown in SEQ ID NO: 6 or SEQ ID NO: 7; and / or

[0012] The nucleotide sequence of the OsIAA9 gene mutant is shown in SEQ ID NO:4 or SEQ ID NO:5.

[0013] As a preferred embodiment, the crop is rice.

[0014] As a further preferred embodiment, the rice variety includes Nipponbare.

[0015] In a second aspect, the present invention provides an OsIAA9 gene mutant, wherein the amino acid sequence encoded by the OsIAA9 gene mutant is shown in SEQ ID NO: 6 or SEQ ID NO: 7; and / or

[0016] The nucleotide sequence of the OsIAA9 gene mutant is shown in SEQ ID NO:4 or SEQ ID NO:5.

[0017] In a third aspect, the present invention provides a gene editing recombinant vector of the OsIAA9 gene, wherein the gene editing recombinant vector of the OsIAA9 gene is obtained by recombining the target sequence of the OsIAA9 gene editing into the pCRISPR / Cas9 gene editing vector;

[0018] Wherein, the target sequence is shown as SEQ ID NO:3; the nucleotide sequence of the OsIAA9 gene is shown as SEQ ID NO:1.

[0019] In a fourth aspect, the present invention provides a method for constructing a gene editing recombinant vector of the OsIAA9 gene, comprising the following steps:

[0020] The target sequence for gene editing is designed according to the nucleotide sequence of the OsIAA9 gene, and then the primers are designed to amplify the DNA fragment of the target sequence, and then cloned into the pCRISPR / Cas9 gene editing vector;

[0021] Wherein, the target sequence is shown as SEQ ID NO:3; the nucleotide sequence of the OsIAA9 gene is shown as SEQ ID NO:1;

[0022] The primer sequences for amplifying the DNA fragment of the target sequence are shown in SEQ ID NO: 10 and SEQ ID NO: 12.

[0023] In a fifth aspect, the present invention provides an engineered bacterium, wherein the engineered bacterium comprises a gene-edited recombinant vector of the OsIAA9 gene as described above.

[0024] As a preferred embodiment, the engineered bacteria is Agrobacterium EHA105 containing a gene-edited recombinant vector of the OsIAA9 gene.

[0025] As a preferred embodiment, the engineered bacteria is obtained by transforming a gene-edited recombinant vector containing the OsIAA9 gene into Agrobacterium EHA105.

[0026] In a sixth aspect, the present invention provides a gene-edited recombinant vector based on the aforementioned OsIAA9 gene or a use of the aforementioned engineered bacteria in improving the deep root ratio of crops.

[0027] As a preferred embodiment, the crop is rice.

[0028] As a further preferred embodiment, the rice variety includes Nipponbare.

[0029] Compared with the prior art, the present invention has the following beneficial effects:

[0030] By using CRISPR / Cas9 technology to edit the target site of the OsIAA9 gene as shown in SEQ ID NO.2, a rice mutant with an improved deep root ratio of rice can be obtained, which may enhance the drought resistance of rice, which is related to the growth and development of rice and stress resistance. The rice OsIAA9 gene of the present invention negatively regulates the deep root ratio of rice, and gene editing thereof can be applied to plant drought resistance breeding, improve the root configuration, and improve the stress resistance of plants.

[0031] The invention can be used to study the molecular method of obtaining transgenic plants by genetic transformation using the gene.

[0032] The rice gene of the present invention can be applied to plant stress resistance breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Other features, objects and advantages of the present invention will become more apparent from the detailed description of non-limiting embodiments made with reference to the following drawings:

[0034] Figure 1 For the identification of OsIAA9 gene knockout mutants, from top to bottom, they are a schematic diagram of the mutation site of OsIAA9 at the mutant endpoint, the nucleic acid sequence near the CISPR / Cas9 target site, and the gene sequencing peak map; NIP: wild-type rice (Nipponbare), iaa9-1 and iaa9-2: OsIAA9 gene knockout rice mutants.

[0035] Figure 2 The deep root ratio of the OsIAA9 gene knockout rice mutant of the present invention is compared with that of the wild-type rice, wherein: Figure 2 A is a photo of root growth; Figure 2 B is the deep root ratio result; Figure 2 C is the result of the number of shallow roots; Figure 2 D is the result of deep root number; NIP: wild-type rice (Nipponbare), iaa9-1 and iaa9-2: OsIAA9 gene knockout rice mutants. DETAILED DESCRIPTION

[0036] In order to facilitate the understanding of the present invention, the present invention will be described more fully with reference to the embodiments below, and preferred embodiments of the present invention are given below. However, the present invention can be implemented in many different forms and is not limited to the embodiments described herein. The purpose of providing these embodiments is to make the understanding of the disclosure of the present invention more thorough and comprehensive. It should be understood that the experimental methods in the following embodiments that do not specify specific conditions are usually carried out according to conventional conditions, such as the conditions described in Sambrook et al. Molecular Cloning: Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conditions recommended by the manufacturer. The various commonly used reagents used in the embodiments are all commercially available products.

[0037] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those generally understood by those skilled in the art of the present invention. The terms used in the specification of the present invention are only for the purpose of describing specific embodiments and are not intended to limit the present invention. The term "and / or" used herein includes any and all combinations of one or more related listed items.

[0038] Based on the previous research results, the present invention further knocks out multiple homologous genes of OsIAA8 and identifies the deep root ratio, and only finds that OsIAA9 is involved in regulating the deep root ratio of rice. Therefore, the present invention provides a method for improving the deep root ratio of rice by knocking out OsIAA9.

[0039] The present invention is described in detail below by way of embodiments:

[0040] Example 1 Cloning of Rice OsIAA9 Gene

[0041] 1. Seedling cultivation

[0042] Rice (Nipponbare) seeds were germinated at 30°C for 48 hours and then sown in a greenhouse. When the rice had 3-5 leaves, DNA or RNA was extracted.

[0043] 2. RNA Isolation:

[0044] RNA extraction: The sample leaves were frozen in liquid nitrogen in a mortar and ground into powder, added to a 2mL EP tube containing 1mL TRNzol-A+ reagent (Tiangen Biochemical Technology Co., Ltd.), and placed at room temperature for 5 minutes after sufficient shaking. Then 0.2mL chloroform was added, and after vigorous shaking for 15 seconds, it was placed at room temperature for 3 minutes; after centrifugation at 4°C and 12000rpm for 10 minutes, the supernatant was transferred to a new 2mL EP tube, and an equal volume of isopropanol was added to precipitate RNA, and 100μL RNase-free ddH2O was added to dissolve it. The quality of total RNA was identified by electrophoresis, and then the RNA content was determined on a spectrophotometer.

[0045] 3. Reverse Transcription Reaction

[0046] Synthesize the first-strand cDNA according to the instructions of the reverse transcription kit (EasyScript one-step gDNA Removal and cDNA Synthesis Super Mix) and prepare the following mixed solution reaction system (20 μL):

[0047]

[0048] The above reaction system was subjected to denaturation annealing reaction on a PCR instrument:

[0049] 42℃15min

[0050] 85℃5sec

[0051] Reverse transcription to synthesize first-strand cDNA

[0052] The prepared cDNA can be used immediately or stored at -20°C for later use.

[0053] 4. Amplification of Rice OsIAA9 Gene

[0054] By searching the rice genome and full-length gene database, it was speculated that the OsIAA9 gene might be related to the deep root ratio, and the predicted coding region cDNA sequence of the candidate gene LOC_Os02g56120 in the rice deep root ratio QTL interval was obtained. Upstream and downstream primers were designed based on the predicted information:

[0055] IAA9f (5'TCACAACTACTAGAAATCCAGCCA 3', SEQ ID NO:8) and IAA9r (5'AGCTCTTCTCTCGTCCTAACA3', SEQ ID NO:9),

[0056] The OsIAA9 gene was directly cloned from cDNA, recovered from gel, connected to the pEASY-Blunt vector, sequenced after identification, and the sequencing results were confirmed by BLAST comparison. The results showed that the length of the rice OsIAA9 coding region cDNA in the present invention was 549 bp, the detailed nucleotide sequence is shown in SEQ ID NO: 1, and the amino acid sequence is shown in SEQ ID NO: 2.

[0057] Example 2: Obtaining a Rice Mutant by Knocking Out the OsIAA9 Gene with CRISPR / Cas9

[0058] 1. Construction of CRISPR / Cas9 knockout vector for OsIAA9 gene

[0059] According to the CDS sequence of the OsIAA9 gene, the target site for gene editing was selected, and the selected gRNA target site was determined to be GGATTCAGGGAGGCGTTCC, as shown in SEQ ID NO: 3. Based on this target site, primers for synthesizing the OsU6a-target site and the gRNA target site were designed:

[0060] Primer F: GGAACGCCTCCCTGAATCC CGGCAGCCAAGCCAGCA (SEQ ID NO: 10)

[0061] R:GGATTCAGGGAGGCGTTCC GTTTTAGAGCTAGAAAT(SEQ IDNO:11)

[0062] The reaction system used is as follows:

[0063]

[0064]

[0065] Using pYLgRNA-OsU6a / LacZ plasmid as template, F and gR-R

[0066] (CGGAGGAAAATTCCATCCAC, SEQ ID NO:12), UF(

[0067] CTCCGTTTTACCTGTGGAATCG, SEQ ID NO: 13) and R were used as primers, and OsU6a-target fragment and gRNA-target fragment were amplified in the above two reaction systems, respectively. KOD plus polymerase was used for PCR reaction, and 25 cycles were performed: 94°C for 10s, 58°C for 15s, and 68°C for 20s. PCR products were detected by electrophoresis.

[0068] Take 1 μL of each of the two PCR products from the first round as templates and use primers U-GAL

[0069] (ACCGGTAAGGCGCGCCGTAGTGCTCGACTAGTATGGAATCGGCAGCAAAGG, SEQ ID NO: 14) and Pgs-GAR (TAGCTCGAGAGGCGCGCCAATGATACCGACGCGTA TCCATCCACTCCAAGCTCTTG, SEQ ID NO: 15) were used for the second round of PCR. The PCR reaction used KOD plus polymerase, and 30 cycles were performed: 94°C for 10s, 58°C for 15s, and 68°C for 20s. Gel electrophoresis was performed, and the gel was cut and recovered. This product was the gRNA expression cassette.

[0070] The reaction system used in the second round of PCR is as follows:

[0071]

[0072] Recombination of gRNA expression cassette and pYLCRISPR / Cas9:

[0073] Linearization of pYLCRISPR / Cas9 vector: Digest ~2μg pYLCRISPR / Cas9 vector with 20U Bsa I in a 50μl reaction for about 30 minutes. Take 2μL (~80ng) for electrophoresis and confirm the ccdB band that was cut out. Prepare the recombination reaction system according to the table below for recombination reaction:

[0074]

[0075] The reaction was carried out at 37°C for 30 min, and transformation was carried out directly after the reaction. LB plates containing kanamycin were spread to screen positive clones. The next day, positive clones were picked and shaken, and PCR detection and sequencing analysis were performed using 1300F / 1300R primers. The identified positive clones were selected for plasmid extraction, and the obtained plant expression vector plasmid DNA was used for rice genetic transformation.

[0076] 2. Agrobacterium Transformation

[0077] (1) Preparation of Agrobacterium tumefaciens (EHA105) competent cells:

[0078] The Agrobacterium tumefaciens culture liquid was cultured at 28°C until OD600 = 0.5, and the cells were collected by centrifugation at 4°C, resuspended with 500 μL, 0.1 mol / L ice-cold CaCl2, and centrifuged after ice-bathing for 30 minutes. The supernatant was removed, and the cell was resuspended with 100 μL, 0.1 mol / L ice-cold CaCl2 and stored at 4°C.

[0079] (2) Agrobacterium transformation, freeze-thaw method:

[0080] Add 5 μL of plant expression vector plasmid DNA to Agrobacterium competent cells (100 μL), mix gently, place in an ice water bath for 30 minutes, and then quickly freeze in liquid nitrogen for 2 minutes; add 400-800 μL YEP culture medium (containing kanamycin, Kan); culture at 28°C, 200 r / min, and shake for 3-5 hours; centrifuge at room temperature (5000 r / min, 5 minutes), retain 100 μL of supernatant to resuspend the bacteria, spread on LB solid culture medium (containing Kan), and culture at 28°C inverted for 2 days until colonies of appropriate size grow, pick a single clone for PCR detection, and obtain a positive strain.

[0081] 3. Callus induction: Rinse the seeds of Nipponbare with sterile water for 15-20 minutes, disinfect with 75% ethanol for 1 minute, and then oscillate and disinfect with 1.5% effective concentration sodium hypochlorite solution for 20 minutes. Finally, rinse with sterile water for 5 times. Dry the washed seeds with absorbent paper and inoculate them in the callus induction medium, and culture them in the dark at 25℃ for 2 weeks.

[0082] Callus induction medium: Use the induction medium in Table 1, add 0.3 g proline, 0.6 g tyrosine hydrolyzate, 30 g sucrose and 2.5 mL 2,4-D (concentration 1 mg / mL) to make 1 L solution, adjust the pH to 5.9, add 7 g agar powder, and sterilize at high temperature and high pressure.

[0083] 4. Subculture: Cut off the embryonic callus, inoculate it into the subculture medium, and culture it in the dark at 25℃ for 2 weeks.

[0084] Subculture medium: Use the subculture medium in Table 1, add 0.5 g proline, 0.6 g tyrosinase, 30 g sucrose and 2 mL 2,4-D (concentration 1 mg / mL) to make 1 L solution, adjust the pH to 5.9, add 7 g agar powder, and sterilize at high temperature and high pressure.

[0085] 5. Agrobacterium infection and callus co-cultivation: After the transformation of Agrobacterium in step 2, pick the positive single colony and culture it in 1mL Agrobacterium culture solution (containing antibiotics) at 28°C overnight; take the above culture, add it to 50mL Agrobacterium culture solution (containing antibiotics), and culture it at 28°C until OD600 = 0.6-1.0. Centrifuge the obtained Agrobacterium culture, add the collected bacteria to the suspension culture solution, and shake and culture for 30 minutes until OD600 = 0.6-1.0. Then put the callus into the suspension culture solution containing Agrobacterium culture and shake and culture it for about 20 minutes. Dry the callus after shaking culture on sterile filter paper, transfer it to the co-cultivation medium, and culture it in the dark at 25°C for 5 days.

[0086] Suspension culture medium: Use the suspension culture medium in Table 1, add 0.08g tyrosinase, 2g sucrose and 0.2mL 2,4-D (concentration 1mg / mL), prepare 100mL solution, adjust pH to 5.4, divide into two bottles (50mL each), and sterilize by high temperature and high pressure. Add 1mL 50% glucose and 100μL AS (100mM) before use.

[0087] Co-culture medium: Use the co-culture medium in Table 1, add 0.8g of tyrosinase, 20g of sucrose and 3.0mL of 2,4-D (concentration 1mg / mL), prepare 1L solution, adjust pH to 5.6, add 7g of agar powder, and sterilize by high temperature and high pressure. Add 20mL of 50% glucose and 1mL of AS (100mM) before use.

[0088] 6. Screening culture: After 3 days of co-culture, select good callus tissue, transfer to screening medium, culture in the dark at 25°C for 2 weeks, and screen twice.

[0089] Screening medium: Use the screening medium in Table 2, add 0.6g of hydrolyzed casein, 30g of sucrose and 2.5mL of 2,4-D (concentration 1mg / mL), prepare 1L of solution, adjust pH to 6.0, add 7g of agar powder, and sterilize at high temperature and high pressure. Add 1mL of Hn and 1mL of Cn (100ppm) before use.

[0090] 7. Differentiation culture: Select embryonic callus and inoculate it into differentiation medium. Culture it at 24℃ with 16h / 8h light and dark to induce differentiation buds (4-6 weeks).

[0091] Differentiation medium: Use the differentiation medium in Table 2, add 2.0 mg / L 6-BA, 2.0 mg / L KT, 0.2 mg / L NAA, 0.2 mg / L IAA, 1.0 g tyrosinase and 30 g sucrose to make 1 L solution, adjust the pH to 6.0, add 7 g agar powder, and sterilize at high temperature and high pressure.

[0092] 8. Rooting culture: When the buds grow to about 2 cm, cut off the young buds and insert them into the rooting medium. Culture them at about 25°C with 16h / 8h light and dark to induce rooting.

[0093] Rooting medium: Use the rooting medium in Table 2, add 30 g sucrose to make 1 L solution, adjust the pH to 5.8, add 7 g agar powder, and sterilize at high temperature and high pressure.

[0094] 9. Transformed plant culture: After the root system is well developed, open the test tube, add sterile water to harden the seedlings for 2-3 days, take out the plants, wash the attached solid culture medium with sterile water, and move them into the soil. At the beginning, provide shade and shelter from the wind. After the plants are strong, carry out conventional field or greenhouse management and culture to obtain transgenic plants.

[0095] Table 1 Basic medium components 1

[0096]

[0097] Table 2 Basic medium components 2

[0098]

[0099] 10. Positive detection of transgenic rice with CRISPR / Cas9 knockout vector

[0100] (1) Genomic DNA extraction (crude extraction method): According to the instructions of the Plant Genomic DNA Rapid Extraction Kit (Beijing Quanshijin Biotechnology Co., Ltd.), take leaves, cut them into pieces, add 20 μL of extraction solution P1, incubate at 95°C for 5 min, briefly centrifuge, add 20 μL of neutralization solution P2, and briefly centrifuge.

[0101] (2) Primers (HptF: CGTTATGTTTATCGGCACTTTG, SEQ ID NO: 16; HptR: TTGGCGACCTCGTATTGG, SEQ ID NO: 17) were designed based on the vector screening marker HptII, and PCR was performed using the crude DNA as a template to detect whether the transgenic plants were positive. The expected PCR products were amplified from the DNA of most transgenic plants, indicating that they were positive plants.

[0102] 11. Identification of knockout targets in CRISPR / Cas9 knockout IAA9 transgenic rice

[0103] Primers IAA9CF: TCAGATCATCGGCATGGAGC (SEQ ID NO: 18) and IAA9CR: TAGCTACTGACCTTGGTGGT (SEQ ID NO: 19) were designed according to the knockout target, PCR was performed using crude DNA as a template, the PCR product was sequenced, and the sequence was compared with the gene sequence in the wild type (NIP). Figure 1 It was shown that the target sites of some strains (iaa9-1 and iaa9-2) had different numbers of base deletions, indicating that OsIAA9 knockout mutants were obtained. The nucleotide sequence of the target gene of the iaa9-1 mutant is shown in SEQ ID NO:4, and the encoded amino acid sequence is shown in SEQ ID NO:6 (due to the mutation causing the extraction termination of translation). The nucleotide sequence of the target gene of the iaa9-2 mutant is shown in SEQ ID NO:5, and the encoded amino acid sequence is shown in SEQ ID NO:7 (due to the mutation causing the extraction termination of translation).

[0104] Example 3 Determination of deep root ratio of transgenic rice (basket method)

[0105] The seeds of the mutants (iaa9-1 and iaa9-2) with knockout OsIAA9 gene and the wild type (NIP) were dehulled and disinfected (treated with 75% alcohol for 1 min, 1.5% NaClO for 20 min, and washed with sterile water 5 times), and sown on 1 / 2MS medium without hygromycin. After 2-3 days of germination, the seeds with good germination and uniform growth were selected and transferred to baskets containing soil and placed in a pool for planting. After growing for about 1 month, the baskets were taken out of the field, and the number of roots extending from the bottom of the basket (deep roots) and the side (shallow roots) were counted, and the deep root ratio was calculated (deep root ratio = number of deep roots / (number of deep roots + number of shallow roots)*100).

[0106] The experimental results show that the number of deep roots of OsIAA9 knockout mutants increased to varying degrees, and its deep root ratio was significantly higher than that of wild-type plants ( Figure 2 ); The results showed that knocking out OsIAA9 increased the deep rooting ratio of rice.

[0107] The technical features of the above-described embodiments may be arbitrarily combined. To make the description concise, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0108] The above-mentioned embodiments only express several implementation methods of the present invention, and the description thereof is relatively specific and detailed, but it cannot be understood as limiting the scope of the patent of the present invention. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, which all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be subject to the attached claims.

Claims

1. An application of OsIAA9 gene in regulating the deep root ratio of crops, characterized in that: The nucleotide sequence of the OsIAA9 gene is shown in SEQ ID NO:

1.

2. The use according to claim 1, characterized in that: The amino acid sequence encoded by the OsIAA9 gene is shown in SEQ ID NO:

2.

3. The use according to claim 1 or 2, characterized in that: The application is to perform site-specific editing on the nucleotide sequence of the OsIAA9 gene, and obtain the OsIAA9 gene mutant to improve the deep root ratio of crops.

4. The use according to claim 3, characterized in that: The amino acid sequence encoded by the OsIAA9 gene mutant is shown in SEQ ID NO: 6 or SEQ ID NO: 7; and / or The nucleotide sequence of the OsIAA9 gene mutant is shown in SEQ ID NO:4 or SEQ ID NO:

5.

5. The use according to claim 1 or 2, characterized in that: The crop is rice.

6. An OsIAA9 gene mutant, characterized in that: The amino acid sequence encoded by the OsIAA9 gene mutant is shown in SEQ ID NO: 6 or SEQ ID NO: 7; and / or The nucleotide sequence of the OsIAA9 gene mutant is shown in SEQ ID NO:4 or SEQ ID NO:

5.

7. A gene editing recombinant vector of OsIAA9 gene, characterized in that: The gene editing recombinant vector of the OsIAA9 gene is obtained by recombining the target sequence of the OsIAA9 gene editing into the pCRISPR / Cas9 gene editing vector; Wherein, the target sequence is shown as SEQ ID NO:3; the nucleotide sequence of the OsIAA9 gene is shown as SEQ ID NO:

1.

8. A method for constructing a gene editing recombinant vector of the OsIAA9 gene, characterized in that: The following steps are involved: The target sequence for gene editing is designed according to the nucleotide sequence of the OsIAA9 gene, and then the primers are designed to amplify the DNA fragment of the target sequence, and then cloned into the pCRISPR / Cas9 gene editing vector; Wherein, the target sequence is shown as SEQ ID NO:3; the nucleotide sequence of the OsIAA9 gene is shown as SEQ ID NO:1; The primer sequences for amplifying the DNA fragment of the target sequence are shown in SEQ ID NO: 10 and SEQ ID NO:

12.

9. An engineered bacterium, characterized in that: The engineered bacteria comprises the gene-editing recombinant vector of the OsIAA9 gene as described in claim 7.

10. Use of a gene-edited recombinant vector of the OsIAA9 gene according to claim 7 or an engineered bacterium according to claim 9 in improving the deep root ratio of crops.

Images