Application and methods of GhDRP1 gene in negative regulation of cotton drought
By using genetic engineering to suppress or knock out the cotton GhDRP1 gene, the drought resistance of cotton can be enhanced, solving the problem of limited cotton growth under drought conditions and improving the drought resistance and survival rate of cotton.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- HENAN UNIVERSITY
- Filing Date
- 2025-03-25
- Publication Date
- 2026-05-26
AI Technical Summary
Cotton growth is restricted under drought conditions, leading to leaf drop, limited stem diameter growth, and reduced leaf area, which affects yield. Current technologies lack effective drought-resistant genetic engineering methods.
By using genetic engineering techniques, such as RNAi or gene editing, the expression of the GhDRP1 gene in cotton can be suppressed or knocked out. Gene interference vectors or CRISPR/Cas9 recombinant vectors can be constructed to alter the coding sequence of the GhDRP1 gene and enhance the drought resistance of cotton.
It significantly improves the drought resistance and survival rate of cotton, provides new drought-resistant genes and genetic material, and provides theoretical support for breeding drought-resistant cotton varieties.
Smart Images

Figure CN119931967B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of genetic engineering and relates to the function and application of cotton drought-resistant genes. Background Technology
[0002] Arid and semi-arid regions account for approximately 36% of the world's total land area and 43% of its arable land. Water scarcity has become a global environmental problem, severely impacting cotton growth. Cotton is highly dependent on water throughout its entire growth cycle, with varying water requirements at different stages. Water requirements are low from sowing to emergence, gradually increasing during the seedling stage, with the budding and boll-forming stages being critical periods for water demand, and decreasing again during boll opening. Water shortages during these critical growth stages significantly affect cotton growth, development, yield, and quality. Although cotton itself possesses some drought resistance, severe drought can lead to premature leaf drop, limited plant height and stem diameter growth, and decreased leaf area, ultimately resulting in reduced yield.
[0003] The ubiquitin-proteasome pathway is the most important and highly selective protein degradation pathway known in all eukaryotes. U-box proteins are novel E3 proteins in the ubiquitin system that determine substrate-specific recognition. The U-box domain consists of approximately 70 amino acid residues and is highly conserved in eukaryotes such as yeast, plants, and animals (Hatakeyama & Nakayama, 2003). Studies have shown that E3 ubiquitin ligases play important roles in plant responses to abiotic stresses (drought, salinity, cold, etc.) (Meng et al., 2024; Du et al., 2024; Wang et al., 2023). Modern biotechnology has provided new avenues for research on cotton drought resistance, such as cloning and studying the functions of drought-related genes through genetic engineering, providing theoretical support for breeding cotton varieties with stronger stress resistance.
[0004] Du C, Liu M, Yan Y, Guo X, Cao X, Jiao Y, Zheng J, Ma Y, Xie Y, Li H, Yang C, Gao C, Zhao Q, Zhang Z. The U-box E3 ubiquitin ligase PUB35 negativelyregulates ABA signaling through AFP1-mediated degradation of ABI5. PlantCell. 2024 Sep3;36(9):3277-3297.
[0005] Hatakeyama S, Nakayama KI. U-box proteins as a new family ofubiquitin ligases. BiochemBiophys Res Commun. 2003 Mar 21;302(4):635-45.
[0006] Meng Y, Lv Q, Li L, Wang B, Chen L, Yang W, Lei Y, Xie Y, Li X. E3ubiquitin ligaseTaSDIR1-4A activates membrane-bound transcription factorTaWRKY29 to positively regulate drought resistance. Plant Biotechnol J. 2024Apr;22(4):987-1000.
[0007] Wang X, Zhang X, Song CP, Gong Z, Yang S, Ding Y. PUB25 and PUB26 dynamically modulate ICE1 stability via differential ubiquitination during cold stress in Arabidopsis. Plant Cell. 2023 Sep 1;35(9):3585-3603. Summary of the Invention
[0008] This invention proposes an application and method for the gene GhDRP1 in negatively regulating cotton drought, which significantly enhances cotton drought resistance and improves cotton survival rate, and is of great significance for breeding new drought-resistant cotton varieties.
[0009] The technical solution of this invention is implemented as follows:
[0010] The application of the gene GhDRP1 in negative regulation of cotton drought: The amino acid sequence of the protein encoded by the gene GhDRP1 is more than 90% similar to the amino acid sequence shown in SEQ ID No. 2. Those skilled in the art know that when the amino acid sequence is more than 90% similar, its function is also basically the same.
[0011] Preferably, the amino acid sequence of the protein encoded by the above-mentioned gene GhDRP1 is shown in SEQ ID No. 2.
[0012] The nucleotide sequence of the gene GhDRP1 is more than 75% similar to, or 80% similar to, or 85% similar to, or 90% similar to, the nucleotide sequence shown in SEQ ID No. 1.
[0013] The nucleotide sequence of the gene GhDRP1 is shown in SEQ ID No. 1.
[0014] The application of the gene GhDRP1 in negatively regulating drought in cotton is achieved by inhibiting or knocking out the gene GhDRP1 in plants through gene interference.
[0015] The aforementioned gene interference methods are RNAi technology or gene editing.
[0016] A method for cultivating drought-resistant cotton, wherein the above method involves inhibiting or knocking out the gene GhDRP1 in cotton plants, the nucleotide sequence of which is shown in SEQ ID No. 1.
[0017] The above inhibition was achieved by constructing a VIGS expression vector for the gene GhDRP1, then injecting it into the back of cotton cotyledons using Agrobacterium-mediated transformation, followed by 12 hours of light protection before normal light culture.
[0018] The area to be injected should exceed 95% of the area of the cotton cotyledons.
[0019] The above knockout was achieved by constructing a CRISPR / Cas9 recombinant vector for the GhDRP1 gene using gene editing technology, and then transferring it into the hypocotyl of cotton etiolated seedlings via Agrobacterium-mediated transformation to obtain gene-edited plants; drought-resistant cotton was obtained by altering the coding sequence of the GhDRP1 gene through CRISPR / Cas9 gene editing.
[0020] The present invention has the following beneficial effects:
[0021] 1. Using virus-mediated gene silencing (VIGS) technology, this gene was silenced in upland cotton. Natural drought treatment revealed enhanced drought resistance and increased survival rate in the affected plants. These results indicate a negative correlation between the expression of the GhDRP1 gene and cotton drought resistance. Furthermore, the gene-edited material ghdrp1 for GhDRP1 was obtained using CRISPR / Cas9 gene editing technology, thus serving as a candidate gene for genetically engineered breeding of drought-resistant cotton varieties.
[0022] 2. This application has cloned the GhDRP1 gene, which negatively regulates drought resistance in cotton, and improved cotton's drought resistance by reducing its expression. This not only provides new insights into the molecular regulatory mechanisms of cotton's resistance to drought stress, but also provides new candidate genes and genetic materials for cotton drought resistance. Attached Figure Description
[0023] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0024] Figure 1 The expression patterns of the GhDRP1 gene under drought treatment in two cotton varieties, ZY007 (drought-resistant) and ZY168 (sensitive); the black bars on the left represent normal leaves, and the gray bars on the right represent drought-affected leaves. ns: no significant difference; *: significant difference; **: extremely significant difference.
[0025] Figure 2 Figure (a) shows the DNA gel electrophoresis of TRV:GhDRP1 detected by Agrobacterium; Figure (b) shows the acid gel electrophoresis of RT-PCR for interference efficiency detection; and Figure (c) shows the bar chart of QRT-PCR results for interference efficiency detection (TRV:00: black bar on the left, TRV:GhDRP1: gray bar on the right, ***: extremely significant difference).
[0026] Figure 3 The drought resistance of TRV:GhDRP1 interference material was determined. Figure (a) shows the growth of control plants (TRV:00) and silent plants (TRV:GhDRP1) under conditions of sufficient water, 10 days of drought, and 12 hours of rehydration. Figure (b) shows the positive control, where TRV:CLA interference plants (CLA is a key enzyme in chlorophyll synthesis) showed chlorosis. Figure (c) is a bar chart showing the plant height and survival rate of control plants (TRV:00) and silent plants (TRV:GhDRP1). (TRV:00: black bar on the left; TRV:GhDRP1: gray bar on the right. ns: no significant difference; ***: extremely significant difference).
[0027] Figure 4 The drought resistance of the ghdrp1 mutant material was tested; Figure (a) shows the growth of wild-type plant WT and gene-edited plant ghdrp1 under conditions of sufficient water, 10 days of drought, and 12 hours of rehydration; Figure (b) is a bar chart showing the statistical results of plant height and survival rate of wild-type plant WT and gene-edited plant ghdrp1. (WT: black bar on the left, gray bar on the right for ghdrp1. ns: no significant difference; ***: extremely significant difference). Detailed Implementation
[0028] The technical solution of the present invention will be clearly and completely described below with reference to the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative effort are within the scope of protection of the present invention.
[0029] Unless otherwise specified, the experimental methods used in the following experimental examples are conventional methods; the materials and reagents used are commercially available unless otherwise specified.
[0030] Example 1: Obtaining candidate genes
[0031] This invention utilizes two cotton varieties, ZY007 (drought-resistant) and ZY168 (sensitive), to screen for the downregulated gene GhDRP1 under drought treatment conditions. Figure 1 The cDNA sequence of the GhDRP1 gene is shown in SEQ ID No. 1. GhDRP1 (U-box protein) belongs to the E3 ubiquitin ligase family and is involved in the drought resistance response of cotton. Reducing the expression of this gene can effectively enhance the drought resistance of cotton. Using virus-mediated gene silencing technology (VIGS), this gene was silenced in upland cotton (TM-1). Natural drought treatment revealed that the drought resistance of the affected plants was enhanced and the survival rate was increased. These results indicate that the expression of the GhDRP1 gene is negatively correlated with the drought resistance of cotton. The gene-edited material ghdrp1 for GhDRP1 was obtained using CRISPR / Cas9 gene editing technology, and therefore can be used as a candidate gene for breeding drought-resistant cotton varieties through genetic engineering.
[0032] Example 2: Construction of TRV:GhDRP1 viral interference vector and VIGS-mediated transformation
[0033] The VIGS expression vector was constructed using primers designed based on the nucleotide sequence of GhDRP1. The primer sequences are shown below:
[0034] Forward primer GhDRP1-VIGS-F (5'-CTGGTCAGACATATGACAGACCC-3');
[0035] Reverse primer GhDRP1-VIGS-R (5'-CATCTTTCCTGGAGATCAGGGTG-3').
[0036] First, the GhDRP1 gene was cloned from a cotton cDNA library.
[0037] (Reaction system: 2×Phanta Max Buffer 10 μL, dNTP (10 mM) 0.4 μL, GhDRP1-VIGS-F 30 mM, GhDRP1-VIGS-R 30 mM, template (cDNA) 5 μL, Phanta Max Super-Fidelity DNA Polymerase (5 U / μL) 0.1 μL, ddH2O to bring the total to 20 μL;
[0038] Amplification program: (95℃, 5 min; 95℃, 30 s; 58℃, 15 s; 72℃, 10 s; 38 cycles; 12℃, 10 min for cloning TRV:GhDRP1 gene fragment). The pTRV2 plasmid was double-digested with restriction endonucleases BamH1 and Kpn1 (purchased from NEB, China) (reaction system: 10×Cutsmart Buffer 5 μL, BamH1 1 μL, Kpn1 1 μL, pTRV2 plasmid 2 μg, ddH2O to bring the total to 50 μL; reaction program: 37℃ 3 h).
[0039] The cloned PCR product was ligated with the enzyme-digested and recovered pTRV2 plasmid fragment using a one-step cloning method:
[0040] (Reaction system: 5×CE II Buffer 2 μL, TRV: GhDRP1 gene fragment 100 ng, pTRV2 plasmid digestion product 50 ng, Exnase II 1 μL, ddH2O to 10 μL; Reaction program: 37℃ 30 min);
[0041] The ligation product is the viral silencing vector TRV:GhDRP1. The vector was heat-shocked and transformed into *E. coli* DH5α (purchased from Tiangen Biotech Co., Ltd.). A subset of single clones were selected for positive detection using primers GhDRP1-VIGS-F and GhDRP1-VIGS-R. The positive clones were then sent to the company for sequencing. After correct sequence alignment, the positive clones were amplified, plasmids were extracted, and then transformed into *Agrobacterium* GV3101 (purchased from Tiangen Biotech Co., Ltd.). The positive bacterial culture was stored at -80℃ for later use.
[0042] The constructed TRV: GhDRP1 Agrobacterium GV3101 strain was inoculated into LB medium (1g peptone, 0.5g yeast extract, 0.5g NaCl to 100mL sterile water) at a ratio of 1:10 and activated at 180 rpm for about 10-12 hours. The OD of the bacterial culture was measured. 600When the bacterial culture reaches a concentration between 1.0 and 1.2, collect the bacterial culture into an EP tube, suspend the cells in resuspension solution (1 mL of 1M MES, 1 mL of 1M MgCl2, 200 μL of 0.1MAS to 100 mL of sterile water), and adjust to OD200. 600 Between 0.8 and 1.0. Take cotton plants with flat cotyledons after 16 h of light / 8 h of darkness and about one week of growth at 23℃. Mix pTRV2 bacterial solution, pTRV:GhDRP1 and pTRV1 bacterial solution at a ratio of 1:1 and inject them into the back of the cotton cotyledons, covering an area of more than 95%. After injection, protect the plants from light for 12 h and then culture them under normal light.
[0043] Example 3: TRV: GhDRP1 Interferometric Efficiency Detection
[0044] Primers for quantitative fluorescence detection were designed based on the gene sequence of the TRV:GhDRP1 vector:
[0045] GhDRP1-qRT-F:GGCTGAATGCGGGCAATAG
[0046] GhDRP1-qRT-R:AGGGTTCGGCAGTTCTATCC
[0047] Three biological replicates each of TRV:00 and TRV:GhDRP1 true leaves were collected approximately 14 days after interference. RNA extraction from cotton was performed according to the steps and reagents provided in the Total RNA Extraction Kit for Polysaccharides and Polyphenols from Tiangen Biotech Co., Ltd. (DP441). cDNA synthesis was performed using total RNA as a template via reverse transcription using the ReverTra Ace qPCR RT Kit (Toyobo, Japan). The specific steps were as follows: 1 μg total RNA was added to 1 μL of oligo dT, and the volume was brought to 13 μL with nuclease-free water. The mixture was incubated at 65°C for 2 min, and immediately placed on ice for 2 min. Then, 2 μL of 5× RT buffer, 2 μL of dNTPs, 0.5 μL of RT Enzyme, and 0.5 μL of PRI were added, for a total volume of 20 μL. The reaction was terminated by denaturation and inversion at 50°C for 60 min, followed by enzyme inactivation at 85°C for 5 min. The cDNA samples obtained after reverse transcription were diluted 50-fold for RT-PCR.
[0048] Reaction system: 10×Taq Buffer 2 μL, dNTP (10 mM) 0.4 μL, GhDRP1-qRT-F 30 μL, GhDRP1-qRT-R 30 mM, template (cDNA) 5 μL, Taq enzyme (5 U / μL) 0.1 μL, ddH2O to bring the total to 20 μL;
[0049] Amplification program: (95℃, 5 min; 95℃, 30 s; 58℃, 30 s; 72℃, 20 s; 28 cycles; 12℃, 10 min)
[0050] qRT-PCR amplification:
[0051] Reaction system: 2×Master Mix 5 μL, GhDRP1-qRT-F 20 mM, GhDRP1-qRT-R 20 mM, template (cDNA) 5 μL;
[0052] Amplification program: 95℃, 10 s; 60℃, 30 s; 40 cycles; 12℃, 10 min). The gene GhUBQ7 encoding ubiquitin protein was used as an internal control.
[0053] PCR amplification products were detected by 1.2% gel electrophoresis. Figure 2 a, b). qRT-PCR experiments were performed on a Roche LightCycler 96 real-time quantitative PCR system. GhUBQ7 was used as the reference gene, and each reaction was repeated in triplicate. −∆Ct Methods for calculating relative gene expression levels ( Figure 2 c), by Figure 2 c indicates that the expression level of the GhDRP1 gene in the leaves of the TRV:GhDRP1 interference plant was only 18% of the expression level of the GhDRP1 gene in the control TRV:00 plant.
[0054] Example 4: Determination of drought resistance of TRV:GhDRP1 interferometric material
[0055] When the TRV:00 and TRV:GhDRP1 interference plants reached the two-leaf-one-heart stage, there was no significant difference in plant height between the TRV:GhDRP1 interference plants and the control TRV:00 plants. Water shortage treatment was initiated at 80% soil moisture content, and after 10 days of continuous water shortage, the leaves of the control TRV:00 plants wilted more severely than those of the TRV:GhDRP1 interference plants. The results showed that after drought treatment followed by 24 hours of rehydration, the survival rate of the TRV:GhDRP1 interference plants was approximately 2.5 times that of the control TRV:00 plants. Figure 3c) The above results indicate that TRV:GhDRP1 plants are more drought-resistant than the control TRV:00. Figure 3 a) indicates that GhDRP1 negatively regulates the drought resistance of cotton.
[0056] Example 5: Creation of CRISPR / Cas9 materials based on the GhDRP1 gene
[0057] First, design target sites, i.e., sgRNAs, containing GhDRP1 gene-specific sequences:
[0058] sgRNA1 (SEQ ID No.3):ACTGCCTTCGCTCTCACCGT;
[0059] sgRNA2 (SEQ ID No. 4): GTTCAATAAACGATCCTCGC;
[0060] The first round of PCR amplification was performed using pYLgRNA-AtU3b and pYLgRNA-AtU6-29 as templates: 20 μL reaction system: 10 μL 2×KOD Buffer, pYLgRNA-AtU3b or pYLgRNA-AtU6-29 (20-50 ng), primers UF 40 mM / GhDRP1-SgRNA1-R 20 mM, GhDRP1-SgRNA2-R 20 mM; GhDRP1-sgRNA1-F 20 mM, GhDRP1-SgRNA2-F 20 mM / gR-R 40 mM, gently mixed; the primer sequences involved are:
[0061] GhDRP1-SgRNA1-F (SEQ ID No.5):
[0062] ACTGCCTTCGCTCTCACCGTGTTTTAGAGCTAGAAAT;
[0063] GhDRP1-SgRNA1-R (SEQ ID No. 6):
[0064] ACGGTGAGAGCGAAGGCAGTCAATCTCTTAGTCGACT;
[0065] GhDRP1-SgRNA2-F (SEQ ID No.7):
[0066] GTTCAATAAACGATCCTCGCGTTTTAGAGCTAGAAAT;
[0067] GhDRP1-SgRNA2-R (SEQ ID No.8):
[0068] GCGAGGATCGTTTATTGAACTGACCAATGTTGCTCC.
[0069] UF: CTCCGTTTTACCTGTGGAATCG;
[0070] gR-R:CGGAGGAAAATTCCATCCAC.
[0071] The amplification program was: 98℃, 10 s; 68℃, 5 s; 42 cycles; 12℃, 10 min. Gene products containing the pYLgRNA-AtU3b and pYLgRNA-AtU6-29 promoters and sgRNA fragments were cloned and detected by 1% agarose gel electrophoresis. The second round of PCR amplification used the first round PCR product as a template: 20 μL reaction system: 10 μL 2×KOD Buffer, 20-50 ng of the first round PCR mixture, primers Pps-GGL / Pgs-GG2 30 / 30 mM, Pps-GG2 / Pgs-GGR 30 / 30 mM, and ddH2O to a final volume of 20 μL, gently mixed. The primer sequences involved were:
[0072] Pps-GGL:TTCAGAggtctcTctcgACTAGTATGGAATCGGCAGCAAAGG;
[0073] Pgs-GG2: AGCGTGggtctcGtcagggTCCATCCACTCCAAGCTC;
[0074] Pps-GG2:TTCAGAggtctcTctgacacTGGAATCGGCAGCAAAGG;
[0075] Pgs-GGR:AGCGTGggtctcGaccgACGCGTATCCATCCACTCCAAGCTC.
[0076] The amplification program was as follows: 98℃, 10 s; 68℃, 5 s; 42 cycles; 12℃, 10 min to clone the complete sgRNA1 / 2 expression cassette. The second-round PCR products were purified and recovered, and the size and concentration of the amplified products were detected by agarose gel electrophoresis. The Cas9 gene and sgRNA1 / 2 expression cassette were tandemly assembled into a modified cotton CRISPR / Cas9 vector using the Golden Gate method.
[0077] 15 μL reaction system: 1.5 μL of 10×CutSmart Buffer, 1.5 μL of 10 mM ATP, 80-150 ng of CRISPR / Cas9-P35-N (gene editing vector kindly provided by Professor Liu Yaoguang of South China Agricultural University), 20-50 ng of sgRNA expression cassette mixture, 0.5 μL (10 U) of BsaⅠ-HF, and 0.2 μL (80 U) of T4 DNA Ligase. Gently mix and transform E. coli DH5α by heat shock. Positive clones were screened using kanamycin resistance. The colonies were then identified by PCR using SP-L2 (GTCGTGCTCCACATGTTGACCG) and SP-R (CCGACATAGATGCAATAACTTC) vector primer pairs to identify the expression cassettes of sgRNA1 and sgRNA2. Finally, the correctly sequenced monoclonal plasmids were transformed into Agrobacterium LBA4404. Using Agrobacterium-mediated cotton genetic transformation, the hypocotyls of etiolated cotton seedlings were transformed. Through a series of processes including cell dedifferentiation, redifferentiation, and plant regeneration, gene-edited plants were finally obtained.
[0078] Example 6: Drought resistance test of ghdrp1 mutant materials
[0079] Wild-type and ghdrp1 mutant plants were subjected to drought treatment when they reached the two-leaf-one-heart stage, and the results were as follows: Figure 4 As shown: After 10 days of continuous water shortage, all leaves of wild-type plants wilted, while only cotyledons of ghdrp1 mutant plants wilted, and true leaves did not show wilting phenotype. After 12 hours of rehydration, the survival rate of mutant plants was about 2.5 times that of wild-type plants. There was no significant difference in plant height between wild-type and ghdrp1 mutant plants. The above results indicate that ghdrp1 mutant plants have stronger drought resistance than wild-type plants.
[0080] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.
Claims
1. Genes GhDRP1 Its application in negatively regulating drought resistance in cotton is characterized by: The gene GhDRP1 The amino acid sequence of the encoded protein is shown in SEQ ID No. 2; the application involves inhibiting or knocking out genes in cotton through gene interference. GhDRP1 accomplish.
2. The gene according to claim 1 GhDRP1 Its application in negatively regulating drought resistance in cotton is characterized by: The gene GhDRP1 The nucleotide sequence is shown in SEQ ID No.
1.
3. The gene according to claim 2 GhDRP1 Its application in negatively regulating drought resistance in cotton is characterized by: The gene interference method is RNAi technology or gene editing.
4. A method for cultivating drought-resistant cotton, characterized in that: The method involves suppressing or knocking out genes in cotton plants. GhDRP1 The gene GhDRP1 The nucleotide sequence is shown in SEQ ID No.
1.
5. The method for cultivating drought-resistant cotton according to claim 4, characterized in that: The inhibition is achieved by constructing genes. GhDRP1 The VIGS expression vector was then injected into the back of cotton cotyledons using Agrobacterium-mediated transformation. After injection, the cotton was protected from light for 12 hours before being cultured under normal light.
6. The method for cultivating drought-resistant cotton according to claim 5, characterized in that: The injection area must cover more than 95% of the cotton cotyledon area.
7. The method for cultivating drought-resistant cotton according to claim 6, characterized in that: The knockout refers to the use of gene editing technology to construct genes. GhDRP1 The CRISPR / Cas9 recombinant vector was then transformed into the hypocotyl of cotton etiolated seedlings using Agrobacterium-mediated transformation to obtain gene-edited plants.