A new miRNA Nta-miRN2072f and application thereof in regulating resistance of tobacco to bacterial wilt

By knocking out Nta-miRN2072f in the tobacco variety CB-1, a mutant resistant to bacterial wilt was constructed using gene editing technology. This filled the technical gap in regulating tobacco resistance to bacterial wilt, significantly improved tobacco resistance to bacterial wilt, and promoted the breeding of disease-resistant varieties.

CN119662721BActive Publication Date: 2025-12-26TOBACCO RESEARCH INSTITUTE OF CHINESE ACADEMY OF AGRICULTURAL SCIENCES (QINGZHOU TOBACCO RESEARCH INSTITUTE OF CHINA NATIONAL TOBACCO COMPANY)
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510114678.0
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-01-24
Publication Date
2025-12-26
Estimated Expiration
2045-01-24

AI Technical Summary

Technical Problem

The function of miRNA in tobacco resistance to bacterial wilt is unclear in existing technologies, and there is a lack of effective regulatory means, which makes it difficult to breed disease-resistant tobacco varieties.

Method used

By knocking out Nta-miRN2072f in the tobacco variety CB-1, a mutant resistant to bacterial wilt was constructed using gene editing technology. The gene editing vector was then transferred into the tobacco using Agrobacterium-mediated transformation, achieving dual-target knockout of Nta-miRN2072f and obtaining a mutant resistant to bacterial wilt.

Benefits of technology

It significantly improved the resistance of tobacco to bacterial wilt, reduced the incidence and disease index of bacterial wilt, and promoted the breeding of new bacterial wilt-resistant varieties.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119662721B_ABST
    Figure CN119662721B_ABST
Patent Text Reader

Abstract

The application provides a new miRNA Nta-miRN2072f and application thereof in regulating resistance of tobacco to bacterial wilt, and belongs to the technical field of biology.A new miRNA-Nta-miRN2072f is found in tobacco, which can regulate the resistance of tobacco to bacterial wilt, and the resistance of a gene knockout mutant to bacterial wilt can be significantly improved by carrying out knockout of Nta-miRN2072f in a susceptible tobacco variety CB-1, which is helpful for cultivation of a new tobacco variety resistant to bacterial wilt.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the field of biotechnology, and particularly relates to a new miRNA Nta-miRN2072f and application thereof in regulating resistance of tobacco to bacterial wilt. BACKGROUND

[0002] Tobacco is infected by various pathogens during growth. Among them, tobacco bacterial wilt caused by Pseudomonas syringae pv. tabaci has caused great losses to tobacco production. Pseudomonas syringae is a soil-borne bacterium that usually colonizes in the xylem tissue of plant roots, infects the roots of susceptible plants through small wounds, and then rapidly transfers to the stem tissue. Exopolysaccharides produced by Pseudomonas syringae cause blockage of the xylem, leading to wilting of the plant. When the plant wilts, the bacteria transfer from the plant roots to the soil. For the prevention and control of tobacco bacterial wilt, developing resistant varieties is a green and economic method. Studying the molecular mechanism of miRNA regulating tobacco bacterial wilt resistance and mining genes related to the formation of tobacco bacterial wilt resistance are helpful for the cultivation of disease-resistant varieties.

[0003] miRNA is a kind of endogenous small non-coding single-stranded RNA molecule with 20-24 nucleotides, which regulates the expression of target genes at the post-transcriptional level depending on the complementarity with specific mRNA, realizes the functions of cutting, degrading mRNA or inhibiting translation, and most miRNAs target negative regulation of mRNA. With the continuous development of miRNA research, researchers have found a large number of miRNAs in plants, which have been confirmed to be involved in important biological processes such as plant growth and development, metabolism, signal transmission, and resistance to external biological and non-biological stresses. Plants can resist pathogen invasion by up-regulating or down-regulating the expression of miRNA. miRNA plays an important role in protecting plants from pathogen invasion by regulating ROS, MAPK signal cascade and various transcription factors involved in opening defense genes. These miRNAs are also involved in opening downstream genes encoding pathogenesis-related proteins, phenolic compounds or plant antitoxins and various plant hormone signals in response to pathogen attack, thereby regulating plant disease resistance.

[0004] Studies have shown that pathogens induce the expression of a large number of miRNAs in plants when they infect plants, and then control and promote the reprogramming of gene expression. For example, overexpression of miR172 in tobacco promotes TMV infection, while silencing of miR172 inhibits TMV infection. When miR319b is overexpressed in rice, the resistance of rice to rice blast is enhanced. In addition, in rice, overexpression of miR7695 promotes resistance to the pathogenic fungus rice blast by inhibiting the expression of the gene encoding the natural resistance-related macrophage protein 6 (OsNramp6). Overexpression of miR160a or miR398b in rice enhances the resistance of rice to rice blast, which is related to the accumulation of hydrogen peroxide and the up-regulation of the expression of defense-related genes. In addition, studies have shown that miR444 and miR528 are involved in the immune response of rice to viruses. After wheat and barley are infected with powdery mildew, the expression of miRNAs also changes. The above evidence all shows that miRNAs play a certain role in biological stress.

[0005] The outstanding role of miRNAs in plant biological stress is increasingly valued. Studies have shown that miRNAs can regulate the resistance of plants to various bacterial diseases, fungal diseases and viral diseases by targeting disease resistance-related genes. However, the function of miRNAs in the interaction between plants and Ralstonia solanacearum is still unclear, and the application of tobacco resistant to Ralstonia solanacearum in tobacco breeding is still blank. Therefore, identifying miRNAs that respond to Ralstonia solanacearum infection in tobacco can provide ideas and strategies for breeding tobacco varieties resistant to Ralstonia solanacearum, and has important application prospects. SUMMARY

[0006] The application provides a new miRNA Nta-miRN2072f and its application in regulating the resistance of tobacco to Ralstonia solanacearum. The miRNA can regulate the resistance of tobacco to Ralstonia solanacearum. Knocking out Nta-miRN2072f in the susceptible tobacco variety CB-1 can significantly improve the resistance of the gene knockout mutant to Ralstonia solanacearum, which is helpful for the cultivation of new tobacco varieties resistant to Ralstonia solanacearum.

[0007] In order to achieve the above purpose, the application provides an application of a Nta-miRN2072f precursor sequence or a biological material containing the Nta-miRN2072f precursor sequence in regulating the resistance of tobacco to Ralstonia solanacearum. The precursor DNA sequence of Nta-miRN2072f is shown as SEQ ID NO: 1.

[0008] The application also provides an application of knocking out Nta-miRN2072f in significantly improving the resistance of tobacco to Ralstonia solanacearum. The precursor sequence of Nta-miRN2072f is shown as SEQ ID NO: 1.

[0009] The application also provides a method for constructing an Nta-miRN2072f knockout mutant with bacterial wilt resistance, comprising the following steps:

[0010] Two target sequences are designed based on the Nta-miRN2072f precursor sequence, then the two target sequences are simultaneously connected on a gene editing vector pDC45, and the vector is transformed into tobacco variety CB-1 by using an agrobacterium transformation method to perform double-target knockout of Nta-miRN2072f;

[0011] Then, the obtained transgenic seedlings are subjected to PCR identification to obtain positive single plants, and then the positive single plants are subjected to sequencing detection to determine the editing position, so as to obtain a homozygous Nta-miRN2072f precursor sequence knockout mutant with bacterial wilt resistance.

[0012] Preferably, the two target sequences are g1 and g2, wherein the g1 sequence is ATGAAGAAGGGGTAGATCTAGGG, and the g2 sequence is AACGATTTTAGATCCAAGACGGG.

[0013] Preferably, the bacterial wilt disease index of the Nta-miRN2072f knockout mutant is 26.19-38.10 at 15 days after inoculation of bacterial wilt bacteria, and the incidence of bacterial wilt is only 28.00%-38.10% of the control CB-1.

[0014] Preferably, the number of bacterial wilt bacteria in the root of the Nta-miRN2072f knockout mutant after 2 days of bacterial wilt bacteria infection is only 17.95%-55.38% of the control CB-1.

[0015] The application also provides a method for cultivating a bacterial wilt-resistant tobacco variety, by knocking out Nta-miRN2072f in a susceptible tobacco variety CB-1 to cause loss of function, thereby cultivating a bacterial wilt-resistant tobacco variety, wherein the precursor sequence of the Nta-miRN2072f is shown as SEQ ID NO: 1.

[0016] The application also provides an application of knocking out the Nta-miRN2072f precursor sequence in cultivating a bacterial wilt-resistant tobacco variety, wherein the precursor sequence of the Nta-miRN2072f is shown as SEQ ID NO: 1.

[0017] Compared with the prior art, the application has the following advantages and positive effects:

[0018] The application finds a new miRNA-Nta-miRN2072f in tobacco, which can regulate the resistance of tobacco to bacterial wilt, and by knocking out Nta-miRN2072f in the susceptible tobacco variety CB-1, the resistance of the gene knockout mutant to bacterial wilt can be significantly improved, which is helpful for the cultivation of new tobacco varieties resistant to bacterial wilt. BRIEF DESCRIPTION OF DRAWINGS

[0019] Figure 1 Figure 1 is the structure of Nta-miRN2072f, wherein A. Base sequence alignment of Nta-miRN2072a, Nta-miRN2072fb, Nta-miRN2072c, Nta-miRN2072d, Nta-miRN2072e and Nta-miRN2072f precursor DNA sequences; B. Stem-loop structure of Nta-miRN2072f RNA molecule, the red area is the mature body area of Nta-miRN2072f;

[0020] Figure 2 Figure 3 is the identification of Nta-miRN2072f knockout mutant, wherein A. PCR identification of Nta-miRN2072f knockout mutant; B. Gene editing position of Nta-miRN2072f knockout mutant;

[0021] Figure 3 Figure 4 is the phenotype analysis of Nta-miRN2072f knockout material under bacterial wilt fungus infection, wherein A. Disease condition of CB-1 and mutants (KO_A5, KO_A10) after inoculation of bacterial wilt fungus Y45; B. Disease index of CB-1 and mutants (KO_A5, KO_A10) after inoculation of bacterial wilt fungus, * indicates significant difference, ** indicates extremely significant; C. Morbidity of CB-1 and mutants (KO_A5, KO_A10) after inoculation of bacterial wilt fungus, * indicates significant difference, ** indicates extremely significant; D. Infection condition of CB-1 and mutants (KO_A5, KO_A10) roots by RS10-GFP2 after inoculation of bacterial wilt fungus RS10-GFP2; E. Growth condition of RS10-GFP on NA (kan) of CB-1 and mutants (KO_A5, KO_A10) roots after inoculation of RS10-GFP2; F, G. Quantity statistics of CB-1 and mutants (KO_A5, KO_A10) roots by RS10-GFP2 after inoculation of RS10-GFP2 1dpi and 2dpi, * indicates significant difference, ** indicates extremely significant. DETAILED DESCRIPTION

[0022] The technical solutions in the embodiments of the present application will be clearly and completely described below. Obviously, the described embodiments are only part of the embodiments of the present application, rather than all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those of ordinary skill in the art without creative work belong to the scope of protection of the present application.

[0023] Example 1 Structure analysis of Nta-miRN2072f

[0024] Based on the mature body sequence CUCCGGUCAAGAUCUUCCAUC of Nta-miRN2072, five miRNA precursor DNA sequences of Nta-miRN2072 were predicted in PmiREN (https: / / pmiren.com / ), which were Nta-miRN2072a, Nta-miRN2072b, Nta-miRN2072c, Nta-miRN2072d and Nta-miRN2072e. However, the Nta-miRN2072 precursor cloned from tobacco variety CB-1 in the present study had base differences with the five predicted precursors, so it was named Nta-miRN2072f.

[0025] As shown in Figure 1 A, the base differences of Nta-miRN2072a, Nta-miRN2072fb, Nta-miRN2072c, Nta-miRN2072d, Nta-miRN2072e and Nta-miRN2072f precursor DNA sequences were analyzed by DNAMAN, and Nta-miRN2072f had base differences with the precursor DNA sequences of Nta-miRN2072a, Nta-miRN2072fb, Nta-miRN2072c, Nta-miRN2072d and Nta-miRN2072e. The precursor sequence of Nta-miRN2072f is shown as SEQ ID NO: 1. Subsequently, structure analysis of Nta-miRN2072f was performed by RNAfold (RNAfold web server), as shown in Figure 1 B, Nta-miRN2072f has a typical stem-loop structure, and Nta-miRN2072 is produced from the 5' arm (red area) of the precursor sequence.

[0026] Example 2 Construction of Nta-miRN2072f knockout mutant

[0027] Based on the location information of precursor sequence on the genome, two knockout target sites were designed by using Huazhong CRISPR-P (http: / / crispr.hzau.edu.cn / CRISPR2 / ) for knockout target site design:

[0028] g1: ATGAAGAAGGGGTAGATCTAGGG,

[0029] g2: AACGATTTTAGATCCAAGACGGG.

[0030] Subsequently, the two target sequences were simultaneously connected on the gene editing vector pDC45 to obtain the knockout vector pDC45-Cas9 / gRNA-Nta-miRN2072f, and Agrobacterium transformation was used to transform pDC45-Cas9 / gRNA-Nta-miRN2072f into CB-1 to perform double-target knockout of Nta-miRN2072f, and obtain T0 generation transgenic materials. For the obtained T0 generation transgenic seedlings, first, primers delect+former_F / delect+former_R, hyg_F / hyg_R and NtActin_F / NtActin_R were used for PCR identification to obtain positive single plants (A), and then the positive single plants were sequenced by primers Nta-miRN2072f-Crispr_F / Nta-miRN2072f-Crispr_R for sequencing detection to determine the editing position (B), and finally two homozygous mutant lines KO_5 and KO_10 were determined. Figure 2 Figure 2 B), and finally two homozygous mutant lines KO_5 and KO_10 were determined.

[0031] delect+former_F: TACCATGCCTTGCATTTAGATT

[0032] delect+former_R: GATGGAAGATCTTGACCGGAG

[0033] hyg_F: CAAAGATCGTTATGTTTATCGGCACT

[0034] hyg_R: TTGGCGACCTCGTATTGGGAA

[0035] NtActin_F: ACCTCTATGGCAACATTGTGCTCAG

[0036] NtActin_R: CTGGGAGCCAAAGCGGTGATT

[0037] ​Nta-miRN2072f-Crispr_F: TACCATGCCTTGCATTTAGATT

[0038] Nta-miRN2072f-Crispr_R: ATCTTATCCTTTTCCTTACTCAGCA

[0039] Example 3 Nta-miRN2072f regulates the resistance of tobacco to bacterial wilt

[0040] To determine the regulatory effect of Nta-miRN2072f on tobacco bacterial wilt, we performed resistance identification of CB-1 and Nta-miRN2072f mutant KO_5 and KO_10 after inoculation with bacterial wilt bacteria (Y45) in the greenhouse Figure 3 A). The disease index of Nta-miRN2072f knockout mutants 15 days after inoculation with bacterial wilt bacteria was only 26.19 and 38.10, and the incidence of bacterial wilt was only 28.00% and 38.10% of the control CB-1 Figure 3 B, 3C).

[0041] Among them, the disease index (Disease index, DI) and the disease rate (Disease rate, DR) formula is as follows:

[0042] DI = (∑(Ni x Vi)) / (N x 4) x 100

[0043] DR = n / N x 100%

[0044] Ni = the number of plants with the corresponding disease index, Vi = the incidence of disease (0, 1, 2, 3 and 4), n = the number of diseased plants, N = the total number of plants used in each treatment.

[0045] Further, we used bacterial wilt bacteria RS10-GFP2 with GFP fluorescence to observe and count the colonization of CB-1 and Nta-miRN2072f mutant root bacterial wilt bacteria Figure 3 D). As shown in the figure, fluorescence microscopy showed that the number of Nta-miRN2072f mutant root bacterial wilt bacteria was significantly reduced compared with CB-1. In addition, through the plate experiment, it was also observed that compared with CB-1, the number of Nta-miRN2072f knockout mutants in the root after 2 days of bacterial wilt bacteria infection was only 17.95% and 55.38% of the control CB-1 Figure 3 E-3G).

[0046] In combination with the above analysis, the new miRNA-Nta-miRN2072f found in tobacco can regulate the resistance of tobacco to bacterial wilt, and after knocking out Nta-miRN2072f in the susceptible tobacco variety CB-1, the resistance of the gene knockout mutant to bacterial wilt is significantly improved, which is helpful for cultivating new tobacco varieties resistant to bacterial wilt.

Claims

1. Knocking out Nta-miRN2072f Use in significantly increasing the resistance of tobacco to bacterial wilt, characterized in that, The precursor sequence of Nta-miRN2072f is shown as SEQ ID NO: 1.​ 2. A plant having resistance to bacterial wilt Nta-miRN2072f The method for constructing a precursor sequence knockout mutant is characterized by, comprising the steps of: Based on Nta-miRN2072f The precursor sequence design knocks out two target sequences, and then the two target sequences are simultaneously connected on the gene editing vector pDC45, and the vector is transformed into tobacco variety CB-1 by means of agrobacterium transformation to carry out Nta- miRN2072f Double-target knockout Then the transgenic seedlings obtained are subjected to PCR identification, and positive single plants are obtained, and then the positive single plants are subjected to sequencing detection to determine the editing position, so as to obtain homozygous Nta-miRN2072f precursor sequence knockout mutants; The precursor sequence of Nta-miRN2072f is shown as SEQ ID NO: 1.​ 3. The construction method of claim 2, wherein, Two target sequences are g1 and g2, wherein g1 sequence is ATGAAGAAGGGGTAGATCTAGGG, and g2 sequence is AACGATTTTAGATCCAAGACGGG.

4. The construction method of claim 2, wherein, Nta-miRN2072f The disease index of the knock-out mutants inoculated with Ralstonia solanacearum for 15 days was 26.19-38.10, and the incidence of bacterial wilt was only 28.00%-38.10% of the control CB-1.

5. The method of construction of claim 2, wherein, Compared with the control CB-1, Nta-miRN2072f The number of P. solanacearum in the roots of the knockout mutants was only 17.95%-55.38% of that of the control CB-1 after 2 days of P. solanacearum infection.

6. A method of breeding a tobacco variety resistant to bacterial wilt, the method comprising, An anti-bacterial wilt tobacco variety is bred by knocking out the function of a bacterial wilt disease susceptible tobacco variety CB-1, wherein the precursor sequence of the CB-1 is shown as SEQ ID NO:

1. Nta-miRN2072f Nta-miRN2072f An anti-bacterial wilt tobacco variety is bred by knocking out the function of a bacterial wilt disease susceptible tobacco variety CB-1, wherein the precursor sequence of the CB-1 is shown as SEQ ID NO:

1. Nta-miRN2072f Nta-miRN2072f An anti-bacterial wilt tobacco variety is bred by knocking out the function of a bacterial wilt disease susceptible tobacco variety 7. Knockout Nta-miRN2072f Use in breeding an anti-pseudomonas tobacco variety, characterized in that, The Nta- miRN2072f The precursor sequence of SEQ ID NO: 1 is shown below.

Citation Information

Patent Citations

  • Application of disease-resistant gene NtTBWRG1 in prevention and treatment of tobacco bacterial wilt

    CN117265002A

  • Tobacco bacterial wilt resistance gene NtWRKY45 and application thereof in tobacco bacterial wilt resistance

    CN117756901A