Method and strain for synthesizing gallic acid by double-cell catalysis of terephthalic acid
Through the two-cell catalytic method, a strain expressing a specific gene was constructed to catalyze the synthesis of terephthalic acid into gallic acid, solving the environmental pollution, equipment damage and high cost problems of gallic acid production in the prior art, and achieving efficient and inexpensive biosynthesis.
Patent Information
- Application Number
- CN202510036713.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-01-09
- Publication Date
- 2025-03-21
AI Technical Summary
In the prior art, the production of gallic acid depends on chemical synthesis, which has problems such as environmental pollution, equipment damage and limited raw material sources. At the same time, traditional biosynthesis paths are complex and costly.
Using the two-cell catalytic method, the protocatechic transformed strains expressing the tphAB gene cluster and the tpaK gene and the gallic transformed strains expressing the pobA gene were used, and E. coli was used as the host bacteria to catalyze the synthesis of terephthalic acid into gallic acid.
It significantly improves the intracellular concentration of terephthalic acid and the conversion rate of gallic acid, provides cheap raw materials and high-value conversion routes, and achieves efficient biosynthesis of gallic acid.
Smart Images
Figure CN119662742A_ABST
Abstract
Description
Technical Field
[0001] The invention relates to the technical fields of genetic engineering and metabolic engineering, and in particular to a method and strain for synthesizing gallic acid from terephthalic acid by double-cell catalysis. Background Art
[0002] Gallic acid (GA) is a naturally occurring polyphenol that is widely found in many fruits and plants that can be used for pharmaceuticals, such as blueberries, walnuts, apples, oak bark, pomegranates, and tea. GA and its derivatives have a variety of biological activities, including antibacterial, anti-inflammatory, antioxidant, anti-tumor, cardioprotective and neuroprotective. Therefore, it can be used in food, cosmetics and other fields. Its production method mainly relies on chemical synthesis such as acid hydrolysis and alkaline hydrolysis, that is, tannins are extracted from plant tissues and hydrolyzed to obtain glucose and GA. However, this process will cause environmental pollution, harsh reaction conditions, and great damage to equipment. In addition, the extraction source of tannins is limited and cannot be mass-produced. Traditional biosynthesis of gallic acid relies on the intermediate products of the glycolysis pathway as precursors, and the synthesis path is complex and costly.
[0003] There is a benzene ring naturally present in the molecular structure of terephthalic acid (TPA). Therefore, using it as a substrate can provide the skeleton of the benzene ring in the synthesis of protocatechuic acid. The synthesis of GA through TPA has the characteristics of short path and few intermediates. At the same time, as one of the monomers of polyethylene terephthalate (PET), TPA can be obtained by depolymerization of waste PET, which reduces the cost of raw materials for synthesizing GA. In addition, we can use the depolymerized monomer as a substrate to produce gallic acid, which can also achieve the upgrading and recycling of PET, which is both economically beneficial and environmentally friendly. However, in the literature reports on the production of GA through TPA, the available concentration of TPA is low (≤0.5 g), which limits the production of GA. Summary of the invention
[0004] The first object of the present invention is to provide a method for synthesizing gallic acid from terephthalic acid using a dual-cell catalysis.
[0005] To achieve the above object, the present invention adopts the following technical solution: A method for synthesizing gallic acid from terephthalic acid using double-cell catalysis, comprising: Using Escherichia coli as the host bacteria, the expression tb In gene cluster oeLh , tphAb , tPc , tb Genes and genes encoding TPA transporters ikB of protocatechuic acid-transformed strains; Using Escherichia coli as the host bacteria, construct and express the gene encoding p-hydroxybenzoate hydroxylase oeLh Gallic acid transformed strains; The bacterial cells of the protocatechuic acid transformation strain and the gallic acid transformation strain are used as catalysts to catalyze the synthesis of gallic acid from substrate terephthalic acid.
[0006] As a preferred embodiment, the gene ikB Gene ID: 4226178; tb In gene cluster oeLh , tph , tPc , tb The Gene IDs of the genes are: 8564237, 8564238, 8564239, 8564240.
[0007] As a preferred embodiment, the p-hydroxybenzoate hydroxylase is a Y386F mutant of p-hydroxybenzoate hydroxylase encoded by the nucleotide sequence shown in Gene ID: 83679755.
[0008] As a preferred embodiment, the protocatechuic acid transformed strain tb Gene clusters and ikB The genes are connected to the same vector plasmid for co-expression; tb Gene clusters and ikB The original RBS sequence of the vector plasmid was inserted between the genes.
[0009] As a preferred embodiment, the protocatechuic acid transformation strain and the gallic acid transformation strain use PET-28a plasmid as a vector plasmid to connect the gene to be expressed.
[0010] As a preferred embodiment, the protocatechuic acid transformation strain or the gallic acid transformation strain is cultured as seeds, protein expression is induced, the supernatant is discarded by centrifugation to collect bacterial sludge, and the bacterial sludge is used as a catalyst for substrate catalysis.
[0011] Furthermore, the bacterial sludge of the protocatechuic acid transformation strain or the gallic acid transformation strain is mixed in a mass ratio of 1:1-3 as a catalyst; preferably, the mass ratio is 1:2-3.
[0012] As a preferred embodiment, the catalytic system for synthesizing gallic acid includes: the substrate terephthalic acid, the catalyst and a buffer solution.
[0013] As a preferred embodiment, the catalyst catalyzes the synthesis of gallic acid from terephthalic acid at 20-30°C and pH 6.5-7.5.
[0014] The second object of the present invention is to provide a protocatechuic acid transformation strain constructed by the above method.
[0015] The present invention has the following beneficial effects: (1) The protocatechuic acid transformation strain constructed by the present invention utilizes transporter proteins to assist terephthalic acid to enter cells, significantly increasing the intracellular concentration of terephthalic acid and further increasing the conversion rate of terephthalic acid to synthesize gallic acid.
[0016] (2) The present invention provides a new route for the high-value conversion of waste carbon resources containing terephthalic acid, such as polyethylene terephthalate (PET), and also provides cheap raw materials for the biosynthesis of gallic acid, which has practical significance and guiding value for the production of gallic acid by microbial bioconversion. BRIEF DESCRIPTION OF THE DRAWINGS
[0017] Figure 1 This is the synthetic pathway for TPA to synthesize GA.
[0018] Figure 2 This is a protein gel image of TPA1,2-dioxygenase and TPA transporter expression.
[0019] Figure 3 is the yield of PCA produced from TPA.
[0020] Figure 4 When the transporter protein TpaK is not expressed, TPA produces PCA.
[0021] Figure 5 This is a protein gel image of p-hydroxybenzoate hydroxylase expression.
[0022] Figure 6 is the yield of GA produced by PCA.
[0023] Figure 7 This is the flow chart of GA production by dual-cell catalysis of TPA.
[0024] Figure 8 is the yield of GA produced by TPA.
[0025] Fig. 9 It is the yield of GA under the orthogonal experiment of pH and temperature.
[0026] Fig.10 It is the GA yield when the double cells are added in different ratios. DETAILED DESCRIPTION
[0027] Material: 1. Escherichia coli Escherichia coli DH5α competent cell (General Biotechnology (Anhui) Co., Ltd.) 2. Escherichia coli Escherichia coliBL21(DE3) competent cells (General Biotechnology (Anhui) Co., Ltd.) 3. High-fidelity DNA polymerase 2 × Phanta Max Master Mix (Nanjing Novozymes Co., Ltd.).
[0028] 4. Colony PCR enzyme Green Taq Master Mix (Nanjing Novozyme Co., Ltd.) 5. ClonExpressII One Step Cloning Kit (Nanjing Novogene Corporation).
[0029] 6. EcoRI, XhoI, BamHI and other restriction endonucleases (NEB) 7. Plasmid extraction kit (Beijing Zhuangmeng International Biogene Technology Co., Ltd.).
[0030] 8. DNA gel recovery kit (Beijing Zhuangmeng International Biogene Technology Co., Ltd.).
[0031] 9. Kanamycin (Sinopharm Chemical Reagent Co., Ltd.).
[0032] 10. LB liquid medium (g / L): peptone 10, yeast extract powder 5, sodium chloride 10.
[0033] 11. LB solid medium (g / L): peptone 10, yeast extract powder 5, sodium chloride 10, agar powder 20.
[0034] 12. Transformant screening medium (g / L): peptone 10, yeast extract 5, glucose 10, kanamycin 0.1.
[0035] 13. Induction expression medium (g / L): peptone 10, yeast extract powder 5, sodium chloride 10.
[0036] 14. Biotransformation medium (mM): Tris 50, 2% glycerol, pH adjusted to 7.0 with phosphoric acid.
[0037] Example 1 Construction of an engineered bacterium for synthesizing protocatechuic acid E. coli -PET28a(+)- tphAB-tpaK ; (1) According to NCBI report Comamonas testosteroni CNB-1 derived tb (include oeLh , tphAb , tPc , tbGenes, Gene IDs are: 8564237, 8564238, 8564239, 8564240) and Rhodococcus jostii Source ikB The DNA sequence of the gene (Gene ID: 4226178) was Comamonas testosterone CNB-1 and Rhodococcus jostii The genome was used as a template, single-enzyme PET-28a(+) was used as a vector (EcoRI restriction site), and primers were designed. tb -F / R and ikB -F / R is as follows, PCR amplification is performed to obtain the target gene: tb -F 5'- TGGGTCGCGGATCCGAATTCATGCAAGAATCCATCAT -3'; tb -R 5'-GACATATGTATATCTCCTTCTAGTGGTGACCAGTCGGGCC -3'; ikB -F 5'- GGCCCGACTGGTCACCACTAGAAGGAGATATACATATGTC -3'; ikB -R 5'-GACGGAGCTCGAATTCCTACTTGCGGGCGAGCGAA -3'.
[0038] Will tb and ikB After the gene amplification fragments were purified and recovered, they were cloned and connected with the PET-28a(+) vector plasmid after enzyme digestion, purification and recovery. The RBS sequence (AAGGAG) was inserted by primer carrying. tb and ikB The fragments were transformed into DH5α Escherichia coli competent cells, positive transformants were screened on kanamycin resistance plates, plasmids were extracted, and restriction endonuclease BamHI was used for digestion verification. After digestion, two fragments of about 4.3 kb and 6 kb were obtained by agarose gel electrophoresis. The plasmid was named PET-28a(+)- tb -RBS- ikB .
[0039] (2) PET-28a(+)- tb -RBS- ikBThe plasmid was transformed into BL21 (DE3) Escherichia coli competent cells by heat stimulation, and positive transformants were screened on kanamycin resistance plates. The plasmid was extracted and digested with restriction endonuclease BamHI for verification. After digestion, two fragments of about 4.3 kb and 6 kb were obtained by agarose gel electrophoresis. The positive transformants were inoculated into 5 mL LB liquid medium and cultured at 37 ° C overnight to obtain seed liquid. The seed liquid was inoculated into a 2L shake flask containing 500 mL LB at a 1% inoculation rate and cultured at 37 ° C until OD 600 The final concentration of IPTG was 0.6-0.8, and the protein expression was induced by adding IPTG at 18℃. After 24 hours, the cells were centrifuged at 6000×g for 7 minutes, and the supernatant was discarded to collect the bacterial sludge. The bacterial sludge was resuspended in Tris-Gly buffer and ultrasonically broken until clear. The cells were centrifuged at 8000rpm for 20 minutes, and protein expression was detected by protein electrophoresis. Figure 2 The final engineered bacteria was named E. coli- PET28a(+) -tphAB-tpaK .
[0040] (3) The harvested bacterial sludge was used for whole-cell catalysis. The catalytic system (20 mL) was: Tris-Gly buffer, 0.8 g bacterial sludge, 30 °C, pH 7.0, 200 rpm, different substrate concentrations, and finally the substrate and product were analyzed by liquid chromatography. The results showed that 6.3 g / L (30 mM) TPA could be completely converted to produce 4.62 g / L (30 mM) PCA, and the molar conversion rate reached 100%. Figure 3 . It only expresses tb Engineered strains E. coli- PET28a(+) -tphAB Only 0.5 g / L (3 mM) TPA can produce 0.06 g / L (0.39 mM) PCA, with a molar conversion rate of 13.2%. Figure 4 The addition of the TpaK transporter increased PCA production by 77-fold.
[0041] Example 2 Construction of an engineered bacterium for synthesizing gallic acid E. coli- PET-28a(+) -PobA* ; (1) According to NCBI report Bacillus putida KT2440 source PobA The DNA sequence of a gene Bacillus putida The genome of KT2440 was used as a template, and single-digested PET-28a(+) was used as a vector (EcoRI restriction site). The primers shown below were designed. oeLh -F / R to perform PCR amplification to obtain the target gene: PobA-F 5'-GCGGATCCGAATTcATGAAAACTCAGGTTGCAATTATTGG -3'; PobA -R 5'- AGCTCGAATTcTCAGGCAACTTCCTCGAACGG -3' .
[0042] Will oeLh After the gene amplification fragments are purified and recovered, the mutation primers are designed pobA* -F / R PCR was performed as follows to obtain the mutated gene pobA* : PobA* -F 5'- AACATTGCCGAGAACTTTGTGGGGCTGCCGTT -3'; PobA* -R 5'- AACGGCAGCCCCACAAAGTTCTCGGCAATGTT -3'.
[0043] At this time, the amino acid at position 386 of p-hydroxybenzoate hydroxylase (PobA) mutated from tyrosine to phenylalanine (i.e., the Y386F mutant of the original enzyme). pobA* The nucleotide sequence of SEQ ID NO.1 is obtained. pobA* After purification and recovery, the plasmid was cloned and connected with the PET-28a(+) vector plasmid after enzyme digestion, purification and recovery, and transformed into DH5α Escherichia coli competent cells. Positive transformants were screened on kanamycin resistance plates, and the plasmid was extracted. The restriction endonuclease EcoRI was used for enzyme digestion verification. After enzyme digestion, two enzyme digestion fragments of about 1.2 kb and 5.4 kb were obtained by agarose gel electrophoresis. The plasmid was named PET-28a(+)- pobA* .
[0044] (2) PET-28a(+)- oeLh * Transformed into BL21 (DE3) Escherichia coli competent cells, screened positive transformants on kanamycin resistance plates, extracted plasmids, and digested with restriction endonuclease EcoRI for verification. After digestion, two fragments of about 1.2 kb and 5.4 kb were obtained by agarose gel electrophoresis. The positive transformants were inoculated into 5 mL LB liquid medium and cultured at 37 ° C overnight to obtain seed liquid. The seed liquid was inoculated into a 2L shake flask containing 500 mL LB at a 1% inoculum and cultured at 37 ° C until OD 600The final concentration of IPTG was 0.6-0.8, and the protein expression was induced by adding IPTG at 18℃. After 24 hours, the cells were centrifuged at 6000×g for 7 minutes, and the supernatant was discarded to collect the bacterial sludge. The bacterial sludge was resuspended in Tris-Gly buffer and ultrasonically broken until clear. The cells were centrifuged at 8000rpm for 20 minutes, and protein expression was detected by protein electrophoresis. Figure 5 The final engineered bacteria was named E. coli- PET-28a(+) -pobA* .
[0045] (3) The harvested bacterial sludge was used for whole-cell catalysis. The catalytic system (20 mL) was: Tris-Gly buffer, 0.8 g bacterial sludge, 30 °C, pH 7.0, 200 rpm, different concentrations of PCA. Finally, the substrate and product were analyzed by liquid chromatography. The results showed that 3.08 g / L (20 mM) PCA could be converted to produce 2.1 g / L (12.39 mM) GA, and the molar conversion rate reached 61.94%. Figure 6 .
[0046] Example 3 Dual cells catalyze the production of gallic acid from terephthalic acid; like Figure 7 As shown, E. coli- PET-28a(+) -tphAB-tpaK and E. coli- PET-28a(+) -pobA* The catalytic system was added in a 1:1 mass addition ratio, that is, 0.8 g was added, the catalytic system was: 20 mL, 30 ° C, pH 7.0, 200 rpm, different concentrations of TPA (3, 6, 12, 15, 20, 30 mM) were added, and the substrate and product were analyzed by liquid chromatography. The results showed that the GA yield reached the highest when 30 mM TPA was used as the substrate, which was 3.33 g / L (19.56 mM), but its molar conversion rate was reduced to 65.2%, see Figure 8 .
[0047] Subsequently, an orthogonal experiment was conducted on the pH and temperature of the catalytic system using 30 mM TPA as the substrate, with pH values of 6.5, 7.0, and 7.5 and temperatures of 20, 25, and 30 °C. The results showed that the highest GA yield was obtained at 25 °C and pH 6.5. Fig. 9 Then, on this basis E. coli- PET-28a(+) -tphAB-tpaK and E. coli- PET-28a(+) -pobA*The cell addition amount was optimized, and the cell addition ratio (mass ratio of bacterial sludge) was 1:1, 1:2, and 1:3, respectively. Finally, similar GA yields were obtained under the conditions of 1:2 and 1:3, with the highest GA yield reaching 4.75 g / L (27.94 mM) and the molar conversion rate being 93.73%. Fig.10 .
Claims
1. A method for synthesizing gallic acid from terephthalic acid using a dual-cell catalytic method, characterized in that: include: Using Escherichia coli as the host bacteria, the expression tb In gene cluster oeLh , tph , tPc , tb Genes and genes encoding TPA transporters ikB of protocatechuic acid-transformed strains; Using Escherichia coli as the host bacteria, construct and express the gene encoding p-hydroxybenzoate hydroxylase oeLh Gallic acid transformed strains; The bacterial cells of the protocatechuic acid transformation strain and the gallic acid transformation strain are used as catalysts to catalyze the synthesis of gallic acid from substrate terephthalic acid.
2. The method according to claim 1, characterized in that The gene ikB Gene ID: 4226178; tb In gene cluster oeLh , tph , tPc , tb The Gene IDs of the genes are: 8564237, 8564238, 8564239, 8564240.
3. The method according to claim 1, characterized in that The p-hydroxybenzoate hydroxylase is a Y386F mutant of p-hydroxybenzoate hydroxylase encoded by the nucleotide sequence shown in Gene ID: 83679755.
4. The method according to claim 1, characterized in that: The protocatechuic acid transformed strain tb Gene clusters and ikB The genes are connected to the same vector plasmid for co-expression; tb Gene clusters and ikB The original RBS sequence of the vector plasmid was inserted between the genes.
5. The method according to claim 1, characterized in that The protocatechuic acid transformation strain and the gallic acid transformation strain use the PET-28a plasmid as a vector plasmid to connect the gene to be expressed.
6. The method according to claim 1, characterized in that The protocatechuic acid transformation strain or gallic acid transformation strain is subjected to seed culture and protein expression induction, and then the supernatant is discarded by centrifugation to collect bacterial sludge, and the bacterial sludge is used as a catalyst for substrate catalysis.
7. The method according to claim 6, characterized in that The bacterial sludge of the protocatechuic acid transformation strain or the gallic acid transformation strain is mixed in a mass ratio of 1:1-3 as a catalyst; preferably, the mass ratio is 1:2-3.
8. The method according to claim 1, characterized in that The catalytic system for synthesizing gallic acid comprises: the substrate terephthalic acid, the catalyst and a buffer solution.
9. The method according to claim 1, characterized in that: The catalyst catalyzes substrate terephthalic acid to synthesize gallic acid under the conditions of 20-30° C. and pH 6.5-7.
5.
10. The protocatechuic acid transformation strain constructed by the method according to any one of claims 1 to 9.