Luminal type breast cancer bone metastasis marker based on circCCDC50 in tumor vesicles and prediction and diagnosis kit

Abstract

The invention belongs to the technical field of biological detection, discloses a Luminal type breast cancer bone metastasis marker based on circCCDC50 in tumor vesicles and a prediction and diagnosis kit, and particularly discloses application of circCCDC50 as a biomarker in preparation of a product for diagnosing / predicting breast cancer bone metastasis. According to the invention, the circCCDC50 is used as the biological marker of the Luminal breast cancer bone metastasis for the first time, the circRNA can be used as a supplementary marker for detecting the Luminal breast cancer bone metastasis, missing detection of the Luminal breast cancer bone metastasis caused by too small metastasis focus is avoided, and the circCCDC50 can cover a wide and valuable Luminal breast cancer bone metastasis prediction index.

Description

Technical Field

[0001] The present invention belongs to the technical field of biological detection, and specifically relates to a luminal breast cancer bone metastasis marker and a predictive diagnosis kit based on circCCDC50 in tumor vesicles. Background Art

[0002] Breast cancer (BC) has been the leading cause of cancer-related death in women. The main cause of death in BC patients is metastasis to bones, brain, lungs and other visceral organs. BC metastasis has organ affinity, and factors such as BC molecular subtypes, the immune microenvironment of metastatic organs, the vascular microenvironment of metastatic organs, and the interaction between cancer cells and metastatic organs all play a role in organ-specific metastasis. Luminal BC (LBC) accounts for 70% of all breast cancers. LBC, especially ER+ tumors, has a higher tendency to metastasize to the bone. More than 70% of patients with advanced BC will develop bone metastasis, leading to severe bone pain and skeletal-related events (SREs) such as pathological fractures. SREs greatly reduce the quality of life of breast cancer patients with bone metastasis, resulting in a 25% decrease in overall survival. Moreover, even if some LBC patients undergo radical BC surgery, they still have a high risk of bone metastasis recurrence, and the peak of recurrence is concentrated in 2-3 years and 5 years after surgery. Bone metastasis is an important factor affecting the prognosis of BC. When patients have early BC and no metastasis, their 5-year survival rate is as high as 90%. Once metastasis occurs, their 5-year survival rate will drop to 10%, and the median survival period is only 2.3 years. Therefore, it is necessary to predict the risk of bone metastasis in LBC patients. However, the specific regulatory mechanism of LBC bone metastasis has not yet been clarified, which makes it difficult to predict the risk of LBC bone metastasis. Summary of the invention

[0003] The purpose of the first aspect of the present invention is to provide the use of circCCDC50 as a biomarker in the preparation of a product for the diagnosis / prediction of breast cancer bone metastasis.

[0004] The second aspect of the present invention aims to provide the use of a substance for detecting circCCDC50 in the preparation of a product for diagnosing / predicting breast cancer bone metastasis.

[0005] The third aspect of the present invention is to provide a primer for detecting circCCDC50.

[0006] The fourth aspect of the present invention aims to provide a kit for diagnosing / predicting breast cancer bone metastasis.

[0007] The fifth aspect of the present invention aims to provide a system for early diagnosis / prediction of bone metastasis of luminal breast cancer.

[0008] In order to achieve the above object, the technical solution adopted by the present invention is:

[0009] In a first aspect, the present invention provides the use of circCCDC50 as a biomarker in the preparation of a product for the diagnosis / prediction of breast cancer bone metastasis.

[0010] In some embodiments of the present invention, the breast cancer includes luminal breast cancer.

[0011] The present invention provides the use of circCCDC50 as a biomarker for early diagnosis of luminal breast cancer bone metastasis. The circRNA can be used as a supplementary marker for the detection of luminal breast cancer bone metastasis, and avoids the missed detection of luminal breast cancer bone metastasis due to the small size of the metastatic lesion. circCCDC50 can cover a wide range of valuable predictive indicators for luminal breast cancer bone metastasis. Specifically, the present invention quantitatively analyzes circCCDC50 by qRT-PCR, and finds that there is a difference in the expression level of circCCDC50 in the plasma samples of luminal breast cancer patients with and without bone metastasis, and compared with the expression level of circCCDC50 in the plasma samples of luminal breast cancer patients without bone metastasis, the expression level of circCCDC50 in the plasma samples of luminal breast cancer patients with bone metastasis is significantly increased, indicating that circCCDC50 has the potential to be a biomarker for luminal breast cancer bone metastasis.

[0012] In some embodiments of the present invention, the circCCDC50 is circCCDC50 detected in tumor vesicles.

[0013] In some embodiments of the present invention, the nucleotide sequence of circCCDC50 is as follows:

[0014] CGCTACAAAGACCTGTGAGGATTTGGGAGTGAACAACAAGACTGTGAAATTG

[0015] CTCAGGAAATTCAGGAGAAGCTGGCTATTGAGGCAGAGAGACGCATTCAGGA

[0016] GAAGAAGGATGAGTATGCCGAGATTTTGCTGTCCTGGAGGACCACACCCTGGCTC

[0017] ACAGCCTGCAGGAACAAGAGATTGAGCATCATTTGGCATCGAACGTTCAGCGGAA

[0018] CCGTTTGGTCCAGCATGATCTCCAGGTGGCTAAGCAGCTCCAAGAGGAAGATCTG

[0019] AAAGCGCAGGCCCAGCTCCAGAAG (SEQ ID NO: 1).

[0020] In some embodiments of the present invention, the product includes at least one of a reagent, a kit, a test paper, a system and a chip.

[0021] The second aspect of the present invention provides the use of a substance for detecting circCCDC50 in the preparation of a product for diagnosing / predicting breast cancer bone metastasis.

[0022] In some embodiments of the present invention, the substance includes a substance for quantitatively detecting the expression level of circCCDC50.

[0023] In some embodiments of the present invention, the substance includes a substance for detecting the circCCDC50 by PCR, biochip method, or nucleic acid sequencing method.

[0024] In some embodiments of the present invention, the substance includes one or more of a circCCDC50-specific probe, a gene chip, and a PCR primer.

[0025] In some embodiments of the present invention, the nucleotide sequence of the PCR primer is shown in SEQ ID NO: 2-3.

[0026] In some embodiments of the present invention, the product includes but is not limited to a reagent, a kit, a test paper, a system or a chip.

[0027] In some embodiments of the present invention, the test sample of the product is selected from at least one of the blood, tissues, cells, and excrement of the subject to be tested.

[0028] In some embodiments of the present invention, the breast cancer includes luminal breast cancer.

[0029] In some embodiments of the present invention, the circCCDC50 is circCCDC50 detected in tumor vesicles.

[0030] In some embodiments of the present invention, the tumor vesicles are obtained by the following steps: collecting and storing peripheral blood in an EDTA blood collection tube, centrifuging the whole blood, and taking the supernatant; and extracting the tumor vesicles from the supernatant by ultracentrifugation.

[0031] In a third aspect of the present invention, a primer for detecting circCCDC50 is provided, and the nucleotide sequence of the primer is shown in SEQ ID NO: 2-3.

[0032] The fourth aspect of the present invention provides a kit for diagnosing / predicting breast cancer bone metastasis, comprising the primers of the third aspect of the present invention.

[0033] This application uses the primers of circCCDC50 as the primers of the molecular marker of bone metastasis of luminal breast cancer and is used to prepare a luminal breast cancer bone metastasis prediction kit, which can be used for the molecular marker of bone metastasis of luminal breast cancer. The expression level of circCCDC50 is significantly different in the plasma of luminal breast cancer patients with and without bone metastasis, which can be used as a physical examination indicator to detect abnormalities in an earlier and non-invasive manner, and help guide the next step of detection.

[0034] In some embodiments of the present invention, the kit further comprises an RNA extraction reagent, a reagent for RNA reverse transcription reaction, and a reagent for PCR reaction.

[0035] In some embodiments of the present invention, the reagents for RNA reverse transcription reaction include reverse transcriptase, reverse transcription primers, random primers and buffer.

[0036] In some embodiments of the present invention, the reverse transcriptase comprises M-MLV reverse transcriptase, AMV reverse transcriptase or a combination thereof.

[0037] In some embodiments of the present invention, the buffer comprises dNTPs and metal ions (such as magnesium ions, manganese ions or calcium ions), and at least one of ATP and / or GTP.

[0038] In some embodiments of the present invention, the reagents used for PCR reaction include SYBR green mixed solution.

[0039] A fifth aspect of the present invention provides a system for early diagnosis / prediction of luminal breast cancer bone metastasis, the system comprising:

[0040] Detection module: used to detect the expression level of circCCDC50 in patient samples and output the circCCDC50 expression data to the analysis module;

[0041] Analysis module: Based on the expression level of circCCDC50, the diagnosis result is determined according to the predetermined rules.

[0042] In some embodiments of the present invention, the predetermined rule is: When the expression level of circCCDC50 is detected to be higher than that of luminal breast cancer samples without bone metastasis, it is judged as a high risk of bone metastasis of luminal breast cancer.

[0043] In some embodiments of the present invention, the predetermined rule is: when the expression level of circCCDC50 is detected by qRT-PCR and the Ct value is less than 27.35, it is judged as a high risk of bone metastasis of luminal breast cancer, otherwise it is a low risk.

[0044] In some embodiments of the present invention, the primers of the third aspect of the present invention or the kit of the fourth aspect of the present invention are used to detect the expression level of circCCDC50 in a patient sample.

[0045] The beneficial effects of the present invention are:

[0046] Based on circCCDC50 isolated from peripheral blood tumor vesicles of patients with luminal breast cancer, the present invention experimentally detected the expression of circCCDC50 in the blood of patients with luminal breast cancer with and without bone metastasis to enhance the understanding of the relevant role of circRNAs in luminal breast cancer. It was found that circRNAs are valuable in predicting bone metastasis of luminal breast cancer (sensitivity is 77.78%, specificity is 77.78%, and AUC reaches 0.908). Specifically, the present invention proposes for the first time to use circCCDC50 as a biomarker for bone metastasis of luminal breast cancer. The circRNA can be used as a supplementary marker for the detection of bone metastasis of luminal breast cancer, and avoids the missed detection of bone metastasis of luminal breast cancer due to the small size of the metastatic lesion. CircCCDC50 can cover a wide range of valuable predictive indicators for bone metastasis of luminal breast cancer, and can be used to predict the probability of bone metastasis of luminal breast cancer.

[0047] The tumor vesicle circCCDC50, a marker for luminal breast cancer bone metastasis provided by the present invention, can detect the circCCDC50 of the tumor vesicle by obtaining peripheral blood, thus realizing convenient operation.

[0048] The luminal breast cancer bone metastasis prediction and diagnosis kit for tumor vesicle circCCDC50 provided by the present invention realizes in vitro detection of circCCDC50 expression level of tumor vesicles in peripheral blood of luminal breast cancer patients, thereby realizing the prediction of luminal breast cancer bone metastasis. BRIEF DESCRIPTION OF THE DRAWINGS

[0049] Figure 1 The result diagram of candidate differential circular RNAs screened out after deep sequencing of circular RNA after collecting tumor vesicles from primary tumor cells of patients with luminal breast cancer with bone metastasis and tumor vesicles from primary tumor cells of patients with luminal breast cancer without metastasis.

[0050] Figure 2 This is a graph showing the expression results of candidate differential circular RNAs in serum tumor vesicles of patients with non-metastatic luminal breast cancer and luminal breast cancer bone metastasis in the examples of the present invention.

[0051] Figure 3 This is a ROC curve diagram of the prediction of luminal breast cancer bone metastasis by circCCDC50 in serum tumor vesicles in the embodiment of the present invention. DETAILED DESCRIPTION

[0052] The present invention is further described in detail below through specific examples.

[0053] It should be understood that these embodiments are only used to illustrate the present invention and are not used to limit the scope of the present invention.

[0054] In order to make the purpose, technical scheme and advantages of the embodiments of the present invention clearer, the technical scheme in the embodiments of the present invention will be described clearly and completely below. If the specific conditions are not specified in the embodiments, they are carried out according to conventional conditions or conditions recommended by the manufacturer. If the manufacturer of the reagents or instruments used is not specified, they are all conventional products that can be purchased commercially.

[0055] The features and performance of the present invention are further described in detail below in conjunction with the embodiments.

[0056] Example 1

[0057] 1. Selection and collection of plasma samples from patients with luminal breast cancer

[0058] Plasma specimens from 38 patients diagnosed with luminal breast cancer who were hospitalized in Sun Yat-sen Memorial Hospital of Sun Yat-sen University from March 2018 to August 2019 (including 17 patients with luminal breast cancer bone metastasis and 21 patients with luminal breast cancer without bone metastasis as controls) were collected as screening and testing cohorts. Plasma specimens from 208 patients diagnosed with luminal breast cancer who were hospitalized in Sun Yat-sen Memorial Hospital of Sun Yat-sen University from September 2019 to March 2024 (including 91 patients with luminal breast cancer bone metastasis and 117 patients with luminal breast cancer without bone metastasis as controls) were collected as validation cohorts. The inclusion criteria for the patients from the above plasma specimens were: 1. Patients with newly diagnosed breast cancer who had not received various treatments; 2. Basic information of the patients such as name, age, drinking history, smoking history, laboratory test indicators such as ALT, AST, TBIL, GGT, GLU, etc., and clinical data such as tumor stage, lymph node metastasis, and tumor type were collected by puncture. The gender and age of all included subjects were the same as those of the case group. This application was also approved by the Ethics Committee of Sun Yat-sen Memorial Hospital, Sun Yat-sen University.

[0059] 2. Experimental Methods

[0060] 2.1circCCDC50 is present in tumor vesicles derived from luminal breast cancer cells with high bone metastasis. Therefore, tumor vesicles need to be isolated from plasma samples and obtained by the following steps:

[0061] Collect and store peripheral blood in EDTA blood collection tubes, centrifuge to separate whole blood, and take supernatant; use ultracentrifugation to extract tumor vesicles from the supernatant. Specifically:

[0062] (1) Draw whole blood using a blood collection tube containing EDTA (purple cap) (two 5 mL blood collection tubes or one 10 mL blood collection tube) and mix by gently inverting;

[0063] (2) Centrifuge at 1900 g for 10 min at 4°C using a swinging bucket rotor. Carefully aspirate the supernatant (plasma) and discard the last 500 μL.

[0064] (3) The obtained plasma was centrifuged again at 4°C, 3000 g for 15 min, and the plasma supernatant was carefully aspirated, taking care not to touch the sediment on the bottom and sides;

[0065] (4) The supernatant was dispensed into EP tubes and frozen at -80°C before tumor vesicles were extracted to avoid repeated freezing and thawing;

[0066] (5) The supernatant was filtered through a 0.45 μm filter membrane and the plasma filtrate was collected;

[0067] (6) Transfer the filtrate to a new centrifuge tube and centrifuge at 8000 × g for 70 min at 4°C in an ultraspeed rotor.

[0068] (7) Remove the supernatant, resuspend with 10 mL of pre-cooled 1× PBS, select an ultracentrifuge rotor, and ultracentrifuge again at 4°C, 8000×g for 70 min.

[0069] (8) Remove the supernatant, resuspend the tumor vesicles in 100 μL of pre-cooled 1× PBS, and store at -80°C.

[0070] The present invention purifies tumor vesicles to remove impurities in plasma and improve the accuracy of prediction.

[0071] 2.2 RNA extraction of tumor vesicle circCCDC50

[0072] RNA was extracted from tumor vesicles by the following steps:

[0073] (1) Add 200 μL of sample to a 1.5 mL centrifuge tube;

[0074] (2) Add 40 μL of proteinase K solution and 300 μL of lysis buffer and mix well (lysis buffer composition: 1.8 M ammonium thiocyanate, 0.02 mM sodium chloride, 0.1 M glacial acetic acid, 1.5 M urea thiocyanate, and the rest is DEPC-treated water);

[0075] (3) Add 20 μL of magnetic bead suspension and 250 μL of isopropanol, and vortex for 3 min to ensure that the magnetic beads are fully dispersed;

[0076] (4) Place the centrifuge tube on the magnetic stand and let it stand for 20 seconds until the magnetic beads are completely adsorbed. Keep the EP tube fixed on the magnetic stand and use a pipette to discard the supernatant. Avoid contact with the magnetic beads during this period.

[0077] (5) Remove the 1.5 mL centrifuge tube from the magnetic stand, add 1000 μL of washing solution I (the composition of washing solution I is: 0.29 g of NaCl dissolved in 34 mL of anhydrous ethanol, add water to 40 mL) to the 1.5 mL centrifuge tube, blow off the magnetic beads hanging on the wall of the tube with a pipette, vortex and oscillate for 1 min, and perform magnetic separation (refer to step (4) for operation);

[0078] (6) Remove the 1.5 mL centrifuge tube from the magnetic stand, add 1000 μL of washing solution II (the composition of washing solution II is 0.14 g TRIS dissolved in 34 mL anhydrous ethanol, and add water to 40 mL) to the 1.5 mL centrifuge tube, blow off the magnetic beads hanging on the wall of the tube with a pipette, vortex and oscillate for 1 min, and perform magnetic separation (refer to step (4) for operation);

[0079] (7) Place the centrifuge tube on a test tube rack, open the lid and let it stand at room temperature for 5 minutes. If there is still liquid, place it on a magnetic separator and let it stand to absorb the remaining liquid. Then remove the centrifuge tube;

[0080] (8) Add 100 μL of elution buffer (2.5% SDS), use a pipette to disperse the magnetic beads, vortex for 1 min, and ensure that the magnetic beads are completely dispersed. After heating at 65°C for 7 min, vortex for about 3 seconds. Place the centrifuge tube on a magnetic separator until the solution is clear, and transfer the supernatant to a new 1.5 mL centrifuge tube. This is the purified nucleic acid, which can be stored at -20°C for later use.

[0081] 2.3 Reverse transcription of RNA from tumor vesicles

[0082] Synthesize cDNA according to the instructions of TOYOBO's reverse transcription kit ReverTraAce qPCR RT Master Mix with gDNARemover. The specific steps are as follows:

[0083] (1) RNA denaturation: For each sample, take 1.0 μg of RNA, add nuclease-free water to make up the volume to 12 μL, and place it on a PCR instrument, setting the program to 65°C and 5 min;

[0084] (2) Removal of genomic DNA: Add 4.0 μL of 4× DNA Master Mix to (1), gently shake to mix, separate and place on a PCR instrument, set the program to 37°C, 5 min;

[0085] (3) Reverse transcription: Add 4.0 μL of 5×RT Master Mix II to (2), gently shake to mix, separate and place on a PCR instrument for reaction. The reaction program is 37°C, 15 min; 50°C, 5 min; 98°C, 5 min.

[0086] 2.4 Real-time fluorescence quantitative PCR was performed on the synthesized cDNA

[0087] The expression level of the target gene in the plasma samples in this experiment was detected by Bio-Rad C1000 fluorescence quantitative instrument (fluorescence quantitative mix reagent: Premix Ex TaqTMII real-time PCR kit, ordered from Takara Company). The primer design is shown in Table 1. The final data analysis was performed by relative quantification (2 -ΔΔCt ) method for analysis; the details are as follows:

[0088] Table 1 circCCDC50 primer sequence list

[0089]

[0090] (1) Reaction configuration: qPCR reaction system: 10 μL SYBR-Green I Premix Ex Taq, 0.8 μL upstream primer, 0.8 μL downstream primer, 7.4 μL enzyme-treated water to obtain Real-time qPCR mix. Mix the prepared Real-time qPCR mix, separate it, and dispense it into 8 tube strips. Add 2 μL of cDNA template. The reaction system is shown in Table 2.

[0091] Table 2 qRT-PCR reaction system

[0092] Reaction components Addition amount SYBR-Green IPremix Ex Taq 10μL Upstream primer 0.8μL Downstream primer 0.8μL Enzyme-treated water 7.4μL cDNA 2μL

[0093] (2) Tightly cover the 8-tube strips, mark them, and centrifuge at room temperature for 1 min at a centrifugal force of 1000 g.

[0094] (3) Set up and run the qPCR program. The PCR program is as follows: 95°C, 5 min; 95°C, 30 sec; 61°C, 30 sec; 72°C, 30 sec, for a total of 40 cycles.

[0095] 2.5 Statistical analysis methods

[0096] SPSS17.0 or GraphPad Prism 9.0 software packages were used for statistical processing of data. GraphPad Prism 9.0 was used to detect the expression of circRNAs and draw ROC (receiver operating characteristic) curves and area under the curve (AUC). Binary logistic regression was used for circRNAs detection and analysis, and the difference was statistically significant when P < 0.05.

[0097] 3. Results Analysis

[0098] 3.1 Differential expression of circCCDC50 in plasma

[0099] Three pairs of plasma samples from patients with bone metastasis and controls without bone metastasis were selected from the screening and testing cohorts. Tumor vesicles were isolated and circular RNA was sequenced. Based on the sequencing results, the 10 circular RNAs with the greatest expression differences were selected with |log2FC|>2.0 and P<0.05 as the standard, such as Figure 1Subsequently, the expression levels of these 10 candidate circular RNAs in tumor vesicles of plasma samples were detected by qRT-PCR for validation in the screening and testing cohorts. Figure 2 As shown in the figure, the relative expression level of circCCDC50 in the tumor vesicles of the plasma of patients with luminal breast cancer bone metastasis was significantly higher than that of patients with luminal breast cancer without bone metastasis, and the expression difference was the most significant among the 10 candidate circular RNAs. Therefore, the expression level of circCCDC50 can be used to predict bone metastasis in patients with luminal breast cancer.

[0100] 3.2 Predictive value of plasma circCCDC50 for bone metastasis in patients with luminal breast cancer

[0101] To test the predictive value of plasma circCCDC50 for bone metastasis in patients with luminal breast cancer, plasma samples from 91 pairs of patients with luminal breast cancer bone metastasis and 117 patients with luminal breast cancer without bone metastasis were collected as controls. The expression level of circCCDC50 in the collected plasma samples was detected by qRT-PCR, and the ROC curve was drawn for analysis and comparison to investigate the predictive value of plasma circCCDC50 for bone metastasis in patients with luminal breast cancer. Figure 3 As shown in the figure, the ROC curve shows that the expression level of circCCDC50 can well distinguish the group with bone metastasis from the group without bone metastasis. Specifically, the area under the curve (AUC): 0.902, the sensitivity is 81.11%, the specificity is 82.91%, and the 95% CI: 0.8618-0.9415. In addition, the difference in distinguishing the group with bone metastasis from the group without bone metastasis is significant (P<0.0001). This shows that plasma circCCDC50 can distinguish patients with luminal breast cancer who have bone metastasis and those who do not have bone metastasis. Therefore, circCCDC50 is a good biomarker for the diagnosis of bone metastasis of luminal breast cancer, and circCCDC50 can be used for early diagnosis of bone metastasis of luminal breast cancer.

[0102] The embodiments of the present invention are described in detail above in conjunction with the accompanying drawings, but the present invention is not limited to the above embodiments. Various changes can be made within the knowledge of ordinary technicians in the relevant technical field without departing from the purpose of the present invention. In addition, the embodiments of the present invention and the features in the embodiments can be combined with each other without conflict.

Claims

1. Application of circCCDC50 as a biomarker in the preparation of products for diagnosis / prediction of breast cancer bone metastasis.

2. Application of substances for detecting circCCDC50 in the preparation of products for diagnosis / prediction of breast cancer bone metastasis.

3. The use according to claim 2, characterized in that: The substance includes a substance for quantitatively detecting the expression level of circCCDC50.

4. The use according to claim 3, characterized in that: The substance includes a substance for detecting the circCCDC50 by PCR, biochip method, and nucleic acid sequencing method.

5. The use according to claim 4, characterized in that: The substance includes one or more of a circCCDC50-specific probe, a gene chip, and a PCR primer; Preferably, the nucleotide sequence of the PCR primers is shown in SEQ ID NOs: 2-3.

6. The use according to any one of claims 1 to 5, characterized in that The breast cancer includes luminal breast cancer.

7. A primer for detecting circCCDC50, the nucleotide sequence of the primer is shown in SEQ ID NO: 2-3.

8. A kit for diagnosing / predicting breast cancer bone metastasis, comprising the primers according to claim 7.

9. The kit according to claim 8, characterized in that The kit also includes an RNA extraction reagent, a reagent for RNA reverse transcription reaction, and a reagent for PCR reaction.

10. A system for early diagnosis / prediction of luminal breast cancer bone metastasis, characterized in that: The system comprises: Detection module: used to detect the expression level of circCCDC50 in patient samples and output the circCCDC50 expression data to the analysis module; Analysis module: Based on the expression level of circCCDC50, the diagnosis result is determined according to the predetermined rules; Preferably, the predetermined rule is: when the expression level of circCCDC50 is detected to be higher than that of luminal breast cancer samples without bone metastasis, it is judged as a high risk of bone metastasis of luminal breast cancer; Preferably, the primers described in claim 7 or the kit described in claim 8 or 9 are used to detect the expression level of circCCDC50 in the patient sample.

Images