Major single nucleotide polymorphism sites associated with soybean nodule number and their application

By localizing the SNP site Chr02_43129492 on soybean chromosome 2, developing PCR amplification-specific primer combination and KASP molecular marker, the limitations of localization of symbiotic nitrogen fixation traits in soybeans were solved, efficient identification and breeding of nodules, improving the efficiency of symbiotic nitrogen fixation in soybeans, reducing the abuse of nitrogen fertilizers, and promoting sustainable agricultural development.

CN119662884BActive Publication Date: 2025-08-12INST OF CEREAL & OIL CROPS HEBEI ACAD OF AGRI & FORESTRY SCI
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411914584.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-12-24
Publication Date
2025-08-12
Estimated Expiration
2044-12-24

AI Technical Summary

Technical Problem

When the prior art locates complex quantitative traits such as the number of soybean symbiotic nitrogen fixation, such as the number of nodules, dry weight of nodules, and size of nodules, the localization population with large confidence intervals has certain limitations, and it is difficult to effectively develop closely linked molecular markers, affecting the efficiency of soybean symbiotic nitrogen fixation and nitrogen fertilizer utilization.

Method used

By locate the SNP site Chr02_43129492 on soybean chromosome 2, PCR amplification-specific primer combinations 2T-FAM, 2T-VIC and 2T-R were developed, soybean genotypes were detected by fluorescence quantitative PCR, distinguishing genotypes with high nodule tumor number (T/T) and low nodule tumor number (C/C), and developing KASP molecular markers for molecular marker-assisted selection breeding.

Benefits of technology

Accurate identification of the number of soybean nodules has been achieved, the breeding process has been simplified, the cost and time has been reduced, the efficiency of symbiotic nitrogen fixation in soybeans has been improved, the abuse of nitrogen fertilizer has been reduced, and the sustainable development of agriculture has been promoted.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119662884B_ABST
    Figure CN119662884B_ABST
Patent Text Reader

Abstract

The present invention discloses a major single nucleotide polymorphism (SNP) site associated with soybean nodule number and its application. The SNP site is located on soybean chromosome 2. The physical distance of the SNP site in the soybean genome version number Glycine max Wm82.a2.v1 is Chr02_43129492. The SNP site corresponds to base 20 of the sequence shown in SEQ ID NO. 1. When the site is homozygous for T / T, the corresponding genotype is A; when the site is homozygous for C / C, the corresponding genotype is B. The nodule number of soybeans homozygous for genotype A is greater than, or potentially greater than, those homozygous for genotype B. By detecting this SNP, the present invention can accurately classify a soybean population into low-nodule (C / C) and high-nodule (T / T) groups. Therefore, this molecular marker can be used as a basis for preliminary identification of soybean nodule number. It is highly efficient and applicable, with simple operation, low cost, and short time consumption. It is of great value in identifying high-nodulation soybean germplasm, addressing nitrogen fertilizer overuse, and promoting sustainable agricultural development.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of molecular biotechnology, in particular to major single nucleotide polymorphism sites related to soybean nodule quantity and applications thereof. Background Art

[0002] Soybean (Glycine max L. Merr.), native to China, is one of the country's important oilseed crops and a major source of protein and vegetable oil. Nitrogen is crucial for crop growth. However, the irrational application of nitrogen fertilizers in modern agriculture has led to environmental problems such as soil compaction, acidification, and eutrophication, seriously impacting the sustainable development of agriculture. As a typical legume, soybeans, through symbiotic nitrogen fixation with rhizobia, can effectively increase yields while reducing nitrogen fertilizer use and mitigating environmental pollution. Symbiotic nitrogen fixation between soybeans and rhizobia is an effective way to address nitrogen fertilizer overuse and improve its utilization.

[0003] Soybean nodulation is regulated by multiple genes. Identifying genetic loci or genes that regulate symbiotic nodulation is of great significance for improving the efficiency of soybean symbiotic nitrogen fixation and molecular-assisted breeding. With the rapid development of biotechnology in recent years, multiple genes and quantitative trait loci (QTLs) associated with soybean symbiotic nitrogen fixation have been mapped. The SoyBase (http: / / www.soybase.org / ) database contains 68 QTLs related to soybean symbiotic nitrogen fixation, primarily distributed on chromosomes 6, 10, and 11. However, traits related to soybean symbiotic nitrogen fixation, such as nodule number, nodule dry weight, and nodule size, are complex quantitative traits. Using QTL mapping to study soybean symbiotic nitrogen fixation-related traits has limitations, such as large confidence intervals and limited mapping populations. In recent years, genome-wide association studies (GWAS) have been widely used for linkage marker development and gene discovery, and extensive research has been conducted on soybean symbiotic nitrogen fixation.

[0004] Although there have been many studies on the positioning of QTLs and candidate gene mining related to soybean nodulation, soybean symbiotic nitrogen fixation is a complex process regulated by multiple genes and is greatly affected by materials and environment. The nodulation phenotypes of soybean varieties suitable for planting in different regions are not the same. Therefore, the development and identification of molecular markers closely linked to the nodulation trait and further application development based on this have important theoretical research significance and practical application value. Summary of the Invention

[0005] The technical problem to be solved by the present invention is to provide a major effect single nucleotide polymorphism site related to soybean nodule number and an application thereof.

[0006] In order to solve the above technical problems, the technical solutions adopted by the present invention are as follows.

[0007] A single-nucleotide polymorphism (SNP) site associated with soybean nodule number, the SNP site being located on soybean chromosome 2, the physical distance of the SNP site in the soybean genome version number Glycine max Wm82.a2.v1 being Chr02_43129492, the SNP site corresponding to the 20th base of the sequence shown in SEQ ID NO.1, and when the site is T / T homozygous, the corresponding genotype is A; when the site is C / C homozygous, the corresponding genotype is B; and the nodule number is such that soybeans homozygous for genotype A are greater than, or are potentially greater than, soybeans homozygous for genotype B.

[0008] On the other hand, the present invention also includes a reagent or kit for identifying or assisting in identifying the quantitative trait of soybean nodulation, which is used to detect the SNP site corresponding to the 20th base of the sequence shown in SEQ ID NO.1. The reagent or kit contains a PCR amplification specific primer combination corresponding to the SNP site, as well as template DNA, buffer, dNTPs and other necessary components for gene detection.

[0009] As a preferred technical solution of the present invention, the PCR amplification specific primer combination includes: a primer combination of SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO.4 consisting of 2T-FAM, 2T-VIC and 2T-R.

[0010] A primer combination is provided for detecting a single nucleotide polymorphism at the following SNP site in a soybean genome, wherein the SNP site is located on soybean chromosome 2, the physical distance of the SNP site in the soybean genome version number Glycine maxWm82.a2.v1 is Chr02_43129492, the SNP site corresponds to the 20th base of the sequence shown in SEQ ID NO.1, when the site is T / T homozygous, the corresponding genotype is A; when the site is C / C homozygous, the corresponding genotype is B; the nodule number size is: soybeans homozygous for genotype A are greater than, or are candidate greater than, soybeans homozygous for genotype B; the primer combination is the primer combination 2T-FAM, 2T-VIC, and 2T-R consisting of SEQ ID NO.2, SEQ ID NO.3, and SEQ ID NO.4 in the sequence listing; this primer combination is used to detect the SNP site corresponding to the 20th base of the sequence shown in SEQ ID NO.1.

[0011] Application of the SNP site corresponding to the 20th base of the sequence shown in SEQ ID NO.1 in soybean molecular marker-assisted selection breeding.

[0012] The SNP site corresponding to the 20th base of the sequence shown in SEQ ID NO.1 is used in the initial screening, and / or rescreening, and / or identification, and / or classification, and / or auxiliary identification of soybean nodule number in the early stage of soybean molecular marker-assisted selection breeding.

[0013] The invention relates to the application of the primer combination 2T-FAM, 2T-VIC and 2T-R composed of SEQ ID NO. 2, SEQ ID NO. 3 and SEQ ID NO. 4 in the sequence listing in the directional breeding or assisted directional breeding of soybean lines with high nodulation numbers.

[0014] A method for identifying or assisting in identifying the number of soybean nodules in the early stages of breeding is provided. The method comprises: based on a SNP site corresponding to the 20th base of the sequence shown in SEQ ID NO.1, in the early stages of molecular marker-assisted selection breeding, using genomic DNA of a soybean to be tested as a template, and using a primer combination of 2T-FAM, 2T-VIC, and 2T-R consisting of SEQ ID NO.2, SEQ ID NO.3, and SEQ ID NO.4 to perform fluorescence quantitative PCR amplification. Genotyping is performed based on the fluorescence detection results of the obtained amplified products. If the fluorescence of the amplified product is consistent with the fluorescence of the fluorescent group labeled with the primer 2T-FAM, exhibiting yellow fluorescence, the soybean sample to be tested is a soybean variety with a large number of nodules; if the fluorescence of the amplified product is consistent with the fluorescence of the fluorescent group labeled with the primer 2T-VIC, exhibiting blue fluorescence, the soybean sample to be tested is a soybean variety with a small number of nodules.

[0015] Based on the SNP site corresponding to the 20th base of the sequence shown in SEQ ID NO.1, a molecular marker related to the number of soybean nodules was developed.

[0016] Based on the SNP site corresponding to the 20th base of the sequence shown in SEQ ID NO.1, a molecular marker related to the number of soybean nodules was developed, and the molecular marker was a KASP molecular marker.

[0017] The beneficial effect produced by adopting the above technical scheme is that the research of the present invention collects, plants and sequences early-maturing and very early-maturing soybean varieties suitable for planting in the Bashang Plateau area of ​​northern Hebei Province. In combination with a high-density genetic linkage map, it locates a site on chromosome 2 that is significantly associated with the number of soybean nodules. A linkage disequilibrium analysis is performed on a SNP within its ±100kb region. A molecular marker Chr02_43129492_T_C, which is tightly linked to the nodule number trait, is developed. This marker can accurately divide the participating soybean population into high nodule number (T / T) and low nodule number (C / C). Therefore, this molecular marker can be used as a basis for preliminary identification of soybean nodule number. It has high efficiency and applicability such as simple operation, low cost and short time consumption. It is of great value for digging the germplasm of high-nodulation soybeans, solving the problem of nitrogen fertilizer abuse, and promoting the sustainable development of agriculture. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 This is the normal distribution diagram of the BLUE analysis of the tested soybeans in Example 3;

[0019] Figure 2 The Manhattan plot and QQ plot of the nodule number of the tested soybeans in Example 3;

[0020] Figure 3 This is a schematic diagram of the genotyping results of the test soybeans using the KASP marker in Example 4;

[0021] Figure 4 The bar graph shows the statistical data of the number of nodules and the corresponding genotypes of the tested soybeans in Example 4. DETAILED DESCRIPTION

[0022] The following examples illustrate the present invention in detail. The various raw materials and equipment used in the present invention are all conventional commercial products and can be directly obtained through commercial purchase. The materials, reagents, etc. used in the following examples. Unless otherwise specified, they can be obtained from commercial channels. It should be understood that when used in this specification and the appended claims, the term "comprising" indicates the presence of the described features, wholes, steps, operations, elements and / or components, but does not exclude the presence or addition of one or more other features, wholes, steps, operations, elements, components and / or their collections. It should also be understood that the term "and / or" used in this specification and the appended claims refers to any combination of one or more of the associated listed items and all possible combinations, and includes these combinations.

[0023] As used in this specification and the appended claims, the term "if" can be interpreted as "when..." or "upon..." or "in response to determining..." or "in response to detecting," depending on the context. Similarly, the phrase "if it is determined" or "if [the described condition or event] is detected" can be interpreted as meaning "upon determination," "in response to determining," or "upon detecting [the described condition or event]," or "in response to detecting [the described condition or event]," depending on the context. In addition, in the description of this specification and the appended claims, the terms "first," "second," "third," etc. are used solely to distinguish descriptions and are not to be construed as indicating or implying relative importance. References to "one embodiment" or "some embodiments" in this specification mean that a particular feature, structure, or characteristic described in connection with that embodiment is included in one or more embodiments of the present application. Thus, the phrases "in one embodiment," "in some embodiments," "in other embodiments," "in other embodiments," etc., appearing in various places in this specification, do not necessarily refer to the same embodiment, but rather mean "one or more, but not all, embodiments," unless otherwise specifically emphasized. The terms "include", "comprising", "having" and variations thereof mean "including but not limited to", unless specifically emphasized otherwise.

[0024] Example 1, plant materials

[0025] The present invention collected, evaluated and identified 260 representative early-maturing and very early-maturing soybean varieties from Northeast China that are suitable for cultivation in the Bashang Plateau area of ​​northern Hebei Province. The micro-core germplasm resources (see Table 1) were sown at the Guyuan Experimental Station of the Institute of Crop Sciences, Chinese Academy of Agricultural Sciences (41°66′N, 115°68′E).

[0026] Table 1 Numbers and names of 260 soybean germplasm resources

[0027]

[0028]

[0029]

[0030]

[0031] Example 2, Experimental Design

[0032] The outdoor artificial inoculation identification method was used to inoculate the rhizobium strain USDA110 into fresh TY liquid medium (each 500 μL of rhizobium was inoculated into 200 mL of TY medium) and cultured in a shaker at 160 rpm at 28°C for 3-4 days until the bacterial concentration reached OD600 =0.8-1.0. Each seed was injected with 2 mL of bacterial solution and then covered with a thin layer of vermiculite. Watering was alternating between B&D nitrogen-free nutrient solution and tap water, with 2 L of water applied each time. Twenty-one days after true leaves emerged, the number of effective nodules was counted, with nodules ≥2 mm as the standard for effective nodule assessment. The soybean nodule number (NN) was calculated. Three biological replicates of the test soybean material were set up in the same environment. Within each biological replicate, one test material was planted in three pots, with three seedlings planted in each pot.

[0033] Example 3. Genotype data and genome-wide association analysis

[0034] The variance, correlation, and skewness of the nodule number of the tested soybeans were analyzed using the corresponding programs in SPSS Statistics V27.0 software, and the heritability analysis was performed using QTL lciMapping V4.1. The results are shown in Table 2. The best linear unbiased estimates (BLUE) of the nodule number were performed using RV4.3.3 software. The normal distribution diagram is shown in Figure 1 .

[0035] Table 2 Statistical analysis of phenotypic variation in nodule number of superior soybean germplasms inoculated with USDA110 in Bashang, northern Hebei

[0036]

[0037] The heritability was 0.75, indicating that the quantitative traits of soybean nodulation in the 260 soybean samples tested were mainly affected by genetic factors and less affected by environmental factors. DNA was extracted from the leaf tissues of the 260 soybean materials collected and resequencing was performed. With reference to the SoySNP50K chip site (SONG QJ, HYTEN DL, JIA GF, QUIGLEY CV, FICKUS EW, NELSON RL, CREGAN PB. Development and evaluation of SoySNP50K, a high-density genotyping array for soybean. PLoS ONE, 2013, 8(1): e54985.), the resequencing data were extracted and a total of 42,499 SNP markers were obtained. After excluding SNP markers with minor allele frequency (MAF) ≤ 5%, a total of 30,799 SNP markers were used for genome-wide association analysis. A genome-wide association analysis of nodule number was performed using the mixed linear model (MLM) in the R package “rMVP” (YINLL, ZHANG HH, TANG ZS, XU JY, YIN D, ZHANG ZW, YUAN XH, ZHU MJ, ZHAO SH, LIU XL. rMVP: A memory-efficient, visualization-enhanced, and parallel-accelerated tool for genome-wide association study. Genomics, Proteomics & Bioinformatics, 2021, 19(4): 619-628.), and Manhattan plots and QQ plots were drawn (see Figure 2 The significance threshold for association analysis was set at LOD ≥ 3.0. A relatively continuous interval with LOD ≥ 3 was found in the physical location Chr.02: 43119820-43230817 of the tested soybean. Variance analysis was performed using the ANOVA function of RV4.3.3, with P < 0.05 as the significance level to determine the significance of phenotypic differences between different haplotype materials.

[0038] Example 4. Development and application of KASP molecular markers

[0039] For sites significantly associated with nodule number between Chr.02:43119820-43230817, a total of three sites were selected: Chr02_43127791_A_G, Chr02_43129492_T_C, and Chr02_43119820_T_C. Based on the KASP principle, KASP molecular markers were developed based on their base sequences. A total of eight pairs of PCR amplification primers were designed. Among them, it was found that at Chr02_43129492, the fluorescence signal could clearly distinguish between varieties with high nodule numbers (genotype T / T), which exhibited yellow fluorescence, and varieties with low nodule numbers (genotype C / C), which exhibited blue fluorescence. The results of the other seven primer combination tests showed that the tested soybean materials all exhibited the same fluorescent group, and the genotyping results were inconsistent with the sequencing results. The molecular markers developed in the present invention are specifically designed as follows (primer sequences synthesized by Shanghai Sangon Biotechnology Co., Ltd.):

[0040] 2T-FAM: GAAGGTGACCAAGTTCATGCTAGCCACAACCATTTATTATT (SEQ ID NO. 2);

[0041] 2T-VIC: GAAGGTCGGAGTCAACGGATTAGCCACAACCATTTATTATC (SEQ ID NO. 3);

[0042] 2T-R: GAGGAACTGAATCATCAAGCTTAC (SEQ ID NO. 4);

[0043] According to the use of this marker, the above-extracted DNA was used as a template for fluorescence quantitative PCR detection and analysis of the test soybean germplasm. The system is shown in Table 3, wherein KASPAssay Mix was prepared by ourselves (1.2 μL each of 2T-FAM and 2T-VIC, 3 μL of 2T-R, and 4.6 μL of ddH2O). The reaction program was: 94°C for 15 min; 94°C for 20 s, 61-55°C for 30 s, for 10 cycles, with a decrease of 0.6°C each cycle; 94°C for 20 s, 55°C for 1 min, for 26 cycles, and finally 30°C for 1 min.

[0044] Table 3 PCR reaction system of test population

[0045]

[0046] like Figure 3As shown, 100 soybean materials were amplified and genotyped using the marker: using the test soybean genomic DNA as a template, fluorescent quantitative PCR amplification was performed using the primer combination 2T-FAM, 2T-VIC, and 2T-R composed of SEQ ID NO. 2, SEQ ID NO. 3, and SEQ ID NO. 4. Genotyping was performed based on the fluorescence detection results of the obtained amplified products. If the fluorescence of the amplified product was consistent with the fluorescence of the fluorescent group labeled with primer 2T-FAM, showing yellow fluorescence, the soybean sample to be tested was a soybean variety with a large number of nodules (genotype T / T); if the fluorescence of the amplified product was consistent with the fluorescence of the fluorescent group labeled with primer 2T-VIC, showing blue fluorescence, the soybean sample to be tested was a soybean variety with a small number of nodules (genotype C / C). The population was divided into two genotypes, T / T and C / C. There were 33 soybean materials with the T / T genotype and 67 soybean materials with the C / C genotype. The mean number of nodules in the T / T genotype (11.822 per plant) was significantly greater than that in the C / C genotype (7.928 per plant) (P < 0.001), as shown in Table 4 and Figure 4 shown.

[0047] Table 4 Statistics of the number of nodules and corresponding genotypes of tested soybeans

[0048]

[0049]

[0050]

[0051] The results showed that the marker could effectively distinguish two homozygous genotypes and had a co-dominant characteristic; the marker could be used to assist in screening soybean progeny materials with high or low nodulation numbers.

[0052] In the above embodiments, the description of each embodiment has its own focus. For parts that are not described or recorded in detail in a certain embodiment, reference can be made to the relevant description of other embodiments.

[0053] In summary, the present invention collects, plants and sequences early-maturing and very early-maturing soybean germplasm resources suitable for planting in the northern Hebei plateau region in the Northeast. In combination with a high-density genetic linkage map, the present invention locates a site on chromosome 2 that is significantly associated with the number of soybean nodules. The SNPs within its ±100kb region are subjected to linkage disequilibrium analysis. A molecular marker Chr02_43129492_T_C, which is tightly linked to the nodule quantity trait, has been developed. This marker can accurately divide the soybean population into high nodule number (T / T) and low nodule number (C / C). Therefore, this molecular marker can be used as the basis for preliminary identification of soybean nodule number, has high efficiency and applicability such as simple operation, low cost and short time consumption, and is of great value for digging the germplasm of high-nodulation soybeans, solving the abuse of nitrogen fertilizers, and promoting the sustainable development of agriculture.

[0054] The embodiments described above are only used to illustrate the technical solutions of the present invention, rather than to limit the same. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. These modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the various embodiments of the present invention, and should all be included in the scope of protection of the present invention.

Claims

1. A reagent or kit for identifying or assisting in identifying the quantitative trait of soybean nodulation, characterized in that: The reagent or kit is used to detect a single nucleotide polymorphism (SNP) site, which is located on soybean chromosome 2. The physical distance of the SNP site in the soybean genome version number Glycine max Wm82.a2.v1 is Chr02_43129492. The SNP site corresponds to the 20th base of the sequence shown in SEQ ID NO.

1. When the site is T / T homozygous, the corresponding genotype is A; when the site is C / C homozygous, the corresponding genotype is B. The nodule number is such that soybeans homozygous for genotype A are greater than, or potentially greater than, soybeans homozygous for genotype B. The reagent or kit comprises a specific PCR amplification primer combination corresponding to the SNP site, as well as template DNA, a buffer, dNTPs, and other necessary components for gene detection. The PCR amplification specific primer combination includes: a primer combination consisting of SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO.4, 2T-FAM, 2T-VIC and 2T-R.

2. A primer combination, characterized in that: Used to detect single nucleotide polymorphisms of the following SNP sites in the soybean genome, the SNP site is located on soybean chromosome 2, the physical distance of the SNP site in the soybean genome version number Glycinemax Wm82.a2.v1 is Chr02_43129492, the SNP site corresponds to the 20th base of the sequence shown in SEQ ID NO.1, when the site is T / T homozygous, the corresponding genotype is A; when the site is C / C homozygous, the corresponding genotype is B; the nodule number size is: soybeans homozygous for genotype A are greater than or are candidate greater than soybeans homozygous for genotype B; the primer combination is the primer pair 2T-FAM, 2T-VIC and 2T-R composed of SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO.4 in the sequence list; this primer combination is used to detect the SNP site described in claim 1.

3. Use of the SNP site according to claim 1 in the early stage of soybean molecular marker-assisted selection breeding to perform primary screening, and / or rescreening, and / or identification, and / or classification, and / or auxiliary identification of soybean nodule number.

4. Use of the primer combination according to claim 2 in directed breeding or assisted directed breeding of soybean lines with high nodulation numbers.

5. A method for identifying or assisting in identifying the number of soybean nodules in the early stages of breeding, characterized in that: Based on the SNP site described in claim 1, in the early stage of molecular marker-assisted selection breeding, the soybean genomic DNA to be tested is used as a template, and the primer combination 2T-FAM, 2T-VIC and 2T-R composed of SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO.4 is used to perform fluorescence quantitative PCR amplification. Genotyping is performed according to the fluorescence detection results of the obtained amplified products. If the fluorescence of the amplified product is consistent with the fluorescence of the fluorescent group labeled with the primer 2T-FAM, and exhibits yellow fluorescence, the soybean sample to be tested is a soybean variety with a large number of nodules; if the fluorescence of the amplified product is consistent with the fluorescence of the fluorescent group labeled with the primer 2T-VIC, and exhibits blue fluorescence, the soybean sample to be tested is a soybean variety with a small number of nodules.

Citation Information

Patent Citations

  • Soy bean nodule number-related QTL (quantitative trait locus), SNP (single nucleotide polymorphism) molecular markers and application thereof

    CN106498048A

  • Soybean oil component content related major mononucleotide polymorphic site and application thereof

    CN117887885A