SNP molecular markers for identifying early-flowering chrysanthemum varieties and their applications
By developing SNP molecular markers at the 214-base site of the CiSMXL gene in chrysanthemum and using Hitom next-generation sequencing technology to identify the flowering period of chrysanthemum seedlings, the environmental dependence and high cost of existing technologies for identifying the flowering period of chrysanthemums have been solved, enabling rapid and accurate breeding and screening.
Patent Information
- Application Number
- CN202510076474.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-01-17
- Publication Date
- 2025-10-28
- Estimated Expiration
- 2045-01-17
AI Technical Summary
Existing SNP molecular marker technology lacks adaptability to a wide range of populations and environmental conditions in chrysanthemum flowering period identification, and cannot accurately identify seedlings, resulting in long breeding cycles, high costs, and significant environmental influences.
Genome-wide association analysis (GWAS) revealed that the 214-base site of the CiSMXL gene in chrysanthemum is associated with flowering time. SNP molecular markers were developed using Hitom next-generation sequencing technology to identify flowering time in the seedling stage. Specific primers and kits were provided for PCR amplification and fluorescence detection.
It enables rapid, accurate, and low-cost identification of flowering time in chrysanthemum seedlings, reduces environmental interference, improves breeding and screening efficiency, and lowers production costs.
Smart Images

Figure CN119662889B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of SNP molecular marker technology, specifically relating to an SNP molecular marker for identifying early-flowering chrysanthemum varieties and its application. Background Technology
[0002] Chrysanthemum (Chrysanthemum morifolium Ramat.) belongs to the Asteraceae family and has high ornamental and economic value. It is widely popular due to its extremely beautiful and brightly colored flowers and has become one of the commercially developed flowering crops.
[0003] Flowering time is a crucial trait affecting chrysanthemum production and quality, and its timing directly determines the chrysanthemum's growth cycle, market supply, and economic benefits. To achieve precise control and identification of flowering time, traditional phenotypic observation methods are increasingly unable to meet the demands of modern agriculture for speed, accuracy, and non-destructive methods. Traditional methods primarily rely on observing flowering time, which typically requires a long growth cycle and is easily affected by environmental and cultivation management factors. Furthermore, phenotypic observation requires significant manual labor, resulting in high costs.
[0004] With advancements in genomics, SNP molecular marker technology has been increasingly incorporated into plant breeding and flowering time identification. Genome-wide association studies (GWAS) of large-scale genetic resources can identify gene loci associated with important traits, making it possible to detect SNP molecular markers for flowering time. However, existing SNP molecular markers are mostly concentrated on a few single traits or a small number of gene regions, and related studies are largely limited to single varieties or small populations, lacking adaptation studies to broad populations and environmental conditions. More importantly, existing methods often lack markers that can accurately identify flowering time in the seedling or early stages, which is crucial for shortening breeding cycles and improving efficiency. Summary of the Invention
[0005] The technical problem to be solved by the present invention is to provide an SNP molecular marker for identifying early-flowering varieties of chrysanthemum and its application.
[0006] This invention, through extensive population and flowering trait GWAS analysis, discovered a candidate gene (CM01G712150) with a nonsynonymous substitution (T→A) at nucleotide 214 (exon 1), causing a mutation at amino acid position 72 from serine to threonine. Sequencing confirmed that this site is significantly associated with the early or late flowering period of chrysanthemums. Protein sequence alignment revealed homology with AT4G29920 (ARABIDOPSIS THALIANA HEAT SHOCK PROTEIN-RELATED) in Arabidopsis thaliana, hence the name CiSMXL. Specifically, the T allele at this site is closely associated with the early flowering phenotype, while the A allele is significantly associated with the late flowering phenotype. Therefore, locating the CiSMXL mutation site associated with flowering period and developing corresponding SNP molecular marker tools will help to rapidly identify flowering characteristics.
[0007] Furthermore, this invention proposes a method based on Hitom next-generation sequencing technology, utilizing the 214th site of CiSMXL as a SNP molecular marker to achieve rapid identification of flowering time at the seedling stage. This method has advantages such as high efficiency, speed, low cost, and minimal environmental interference, effectively overcoming the shortcomings of existing technologies, and is particularly suitable for large-scale breeding and cultivation management.
[0008] Specifically, the SNP molecular marker provided by this invention for identifying early-flowering chrysanthemum varieties is located at position 296119494 on chromosome 1, with the site name LG01:296119494; it is located at position 214 of the CiSMXL gene; the nucleotide sequence of the CiSMXL gene is shown in SEQ ID No. 1; the two nucleotide bases at this site are T or A, and this SNP molecular marker exhibits T / A polymorphism, leading to changes in the flowering time of chrysanthemums. The traits of different genotypes at this site are as follows: TT: early flowering trait; TA: late flowering trait; AA: late flowering trait.
[0009] The CiSMXL genome fragment is shown in SEQ ID No. 1:
[0010] TGAGGCTGCTTCAGTCTTGAAGCACTCTCTAAGTTTAGCAAGAAGGAGAGGCCATGCTCAGGTCACTCCTCTTCATGTGGCTGCAACTCTTTTGATGAGTTCAAGAGCCACTATTCTAAGAAGAGCTTGCATTAAGTCACAAACAAATGTTTCAAATCATTCCAGTGTTACATCTCAGTTTGGACCTAATAGTACTAATGTCTCACCACCTTTTCATTGTAGGGCACTTGAGCTTTGTTTC;
[0011] The chrysanthemum reference genome used in this invention is the diploid wild chrysanthemum WT genome from China Agricultural University.
[0012] This invention also provides a kit for identifying early-flowering chrysanthemum varieties, characterized in that it contains primers for amplifying the SNP molecular marker described in claim 1. Specifically, the primer sequences are shown in SEQ ID No. 2 and SEQ ID No. 3.
[0013]
[0014] This invention also provides the application of the SNP molecular markers and amplification primers provided above in the breeding of early-flowering chrysanthemums.
[0015] The method for detecting chrysanthemum flowering time using the aforementioned SNP molecular markers includes the following steps:
[0016] (1) Genomic DNA was extracted from the chrysanthemum leaves to be tested;
[0017] (2) Using genomic DNA as a template, the target sequence in the genomic DNA of the sample to be tested is amplified by PCR;
[0018] (3) The amplified samples were detected using a fluorescence detection platform, and the flowering time of chrysanthemums was determined based on the polymorphism of SNP molecular markers reflected by the obtained fluorescence signals.
[0019] (4) When the SNP molecular marker genotype is TT, it is an early flowering trait; when the SNP molecular marker genotype is TA or AA, it is a late flowering trait.
[0020] The composition of the PCR reaction system and the PCR reaction procedure for PCR amplification of the above SNP molecular markers are as follows:
[0021] The concentration ratio of the upstream primer to the downstream primer in each primer pair in the system is 1:1; the final concentration of both the upstream primer and the downstream primer in the system is preferably 0.1-1.5 μmol / L.
[0022] The system also includes:
[0023] dNTPs: The final concentration in the system is 0.1-0.25 mmol / L for each, preferably 0.2 mmol / L;
[0024] Magnesium chloride: The final concentration in the system is 1.0-4.0 mmol / L, preferably 2 mmol / L;
[0025] DNA polymerase: The final concentration in the system is 0.04 U / μL.
[0026] PCR buffer: prepared by mixing potassium chloride (final concentration 10-50 mmol / L) and Tris-HCl (pH 7.5-9.0) (final concentration 1-10 mmol / L).
[0027] This invention utilizes the reference genome of *Chrysanthemum indicum* (WT) and extensive resequencing data to identify a SNP locus significantly associated with the flowering period of *Chrysanthemum indicum*: LG01:296119494. Genome-wide association analysis revealed a significant association between this locus and the flowering period of the *Chrysanthemum indicum* population. The discovery of this innovative finding required the collection of *Chrysanthemum indicum* ecotypes from various regions of my country. The collected seeds were planted at the Shangzhuang Experimental Station of China Agricultural University, and flowering times were recorded for two consecutive years. Genomic DNA was extracted for whole-genome sequencing and resequencing.
[0028] The present invention differs from other related technical solutions in the prior art in the following ways:
[0029] First, no large-scale resequencing studies have been published on wild chrysanthemum. Previously, identifying the flowering period of chrysanthemums required manual statistics for each variety after flowering, which was costly and labor-intensive. Second, this invention involved extensive labor, including seedling cultivation and extraction of genomic DNA from 161 wild chrysanthemum ecotypes for resequencing. This data, used as a foundation, was combined with the wild chrysanthemum WT reference genome for big data analysis, involving extensive data mining and computation. This approach differs fundamentally from existing techniques that rely on markers from other literature or free databases. Finally, the method of this invention was validated using PCR amplification and sequencing in early-flowering and late-flowering wild chrysanthemum ecotypes. Furthermore, PCR amplification and sequencing were performed on six early-flowering cultivated chrysanthemum varieties and six late-flowering cultivated chrysanthemum varieties. The results showed that the SNP genotypes were consistent with the distribution in early and late flowering varieties, ensuring the high accuracy of SNP molecular marker identification.
[0030] Compared with the prior art, the present invention has the following beneficial effects:
[0031] The features of this invention are: (1) When identifying varieties using this invention, DNA extracted directly from seedlings can be used for detection, unlike traditional methods that require waiting for flower bud transformation or flower opening before identification can be performed, thus shortening the identification time from several months to a few days. (2) Compared to phenotypic identification methods, the DNA detection-based identification method of this invention is not affected by the external environment and will not change due to changes in environmental conditions, resulting in stable and reliable results. (3) Compared to traditional methods for identifying flower bud transformation, the operation of this invention does not require a long period of experience accumulation.
[0032] This invention enables early identification of flowering period in chrysanthemum seedlings by detecting the LG01:296119494 locus, effectively determining whether an individual belongs to the early-flowering or late-flowering type. During the seedling stage, different varieties can be identified based on market demand, allowing for the selection of varieties with different flowering periods. This improves the efficiency of chrysanthemum flowering period screening and breeding, reducing production costs. Furthermore, it can be used for variety identification, effectively protecting the rights and interests of producers and breeders, and providing strong technical support for the protection of chrysanthemum germplasm resources and new varieties. Attached Figure Description
[0033] Figure 1 GWAS analysis results of flowering period traits of wild chrysanthemum ecotypes in different regions.
[0034] Figure 2 . Verification diagram of CiSMXL gene expression in early / late flowering leaves / terminal buds of wild chrysanthemum. Note: A. Number of samples with different genotypes in the population; B. Expression level of CiSMXL gene in early / late flowering leaves / terminal buds; C. PCR electrophoresis diagram of CiSMXL gene fragment in wild chrysanthemum population; D. PCR electrophoresis diagram of CiSMXL gene fragment in cultivated chrysanthemum. Detailed Implementation
[0035] Example 1 This example provides the process for obtaining SNP molecular markers according to the present invention.
[0036] First, the resequencing results of 161 wild chrysanthemum materials were compared with the diploid wild chrysanthemum WT reference genome sequence from China Agricultural University, resulting in 8,090,751 high-quality SNP loci after filtering. Genome-wide association analysis (GWAS) was performed using the phenotype of wild chrysanthemum budding-flowering days, locating a flowering-significantly associated SNP locus, LG01:296119494, located on exon CM01G712150 of chromosome 1 of the wild chrysanthemum genome. Figure 1 After sequence alignment with Arabidopsis protein, it was found to be homologous to the Arabidopsis heat shock protein (ARABIDOPSIS THALIANA HEAT SHOCK PROTEIN-RELATED), hence the name CiSMXL. This gene is induced to express in response to environmental stresses (such as high temperature, low temperature, drought, and salt stress), but its role in flowering regulation has been rarely studied.
[0037] According to haplotype analysis, among the 161 wild chrysanthemum materials, the earliest flowering time was observed when the LG01:296119494 locus was TT, while the flowering time was significantly later when the locus was TA or AA. Furthermore, the flowering time was latest when the locus was homozygous (AA). Figure 2 A).
[0038] To verify that CiSMXL plays a role in regulating the flowering time of chrysanthemums, transcriptome analysis of early and late flowering plants revealed that CiSMXL was highly expressed in the terminal buds of the late-flowering ecotype, significantly higher than in the early-flowering ecotype; and significantly higher than in leaves (regardless of whether it was early or late flowering). Figure 2 B).
[0039] To determine the reliability of the SNP sites, PCR amplification (sequence 1) was performed on the CiSMXL genome fragments of early-flowering wild chrysanthemums: WT, BJ_03J_6_C, SD_01L_2_A, SX_02S_1_B, SX_01J_1_A and late-flowering wild chrysanthemums: SC_02C_1_B, HB_05E_3_A, GD_02Y_1_A, GX_03G_1_C, CQ_01Y_1_B, and the PCR products were sequenced. Figure 2 C) Sequencing results were consistent with resequencing results, accurately identifying wild chrysanthemum species with different flowering times (Table 1). To apply SNP locus identification to a wider range of varieties, CiSMXL genome fragments were amplified by PCR and sequenced in 6 early-flowering cultivars and 6 late-flowering cultivars. Sequencing results showed that in the cultivars, the T genotype accounted for nearly 100% in the early-flowering varieties, while the A genotype accounted for about 30% in the late-flowering varieties (Table 2).
[0040] Table 1. Percentage of CiSMXL fragment genotypes in the wild chrysanthemum population (%)
[0041]
[0042] Table 2. Percentage of CiSMXL fragment genotypes in cultivated chrysanthemums (%)
[0043]
[0044] The CiSMXL genome fragment sequence is as follows (SEQ ID No. 1):
[0045] TGAGGCTGCTTCAGTCTTGAAGCACTCTCTAAGTTTAGCAAGAAGGAGAGGCCATGCTCAGGTCACTCCTCTTCATGTGGCTGCAACTCTTTTGATGAGTTCAAGAGCCACTATTCTAAGAAGAGCTTGCATTAAGTCACAAACAAATGTTTCAAATCATTCCAGTGTTACATCTCAGTTTGGACCTAATAGTACTAATGTCTCACCACCTTTTCATTGTAGGGCACTTGAGCTTTGTTTC
[0046] The above 161 wild chrysanthemum accessions were all sourced from the germplasm bank of China Agricultural University, and their germplasm bank numbers are as follows: NMG_01_1_A, LN_2L_A, LN_02L_B, BJ_06J_3_C, BJ_06J_3_A, BJ_07J_1_B, BJ_06J_3_B, BJ_06J_02_A, BJ_06J_2_C, BJ_06J_2_B, BJ_06J_1_B, BJ_06J_1_C, BJ_06J_1_A, BJ_01J_3_C, BJ_01J_2_A, BJ_01J_3_B, BJ_01J_1_C, BJ_02J_1_A, BJ_02J_2_C, BJ_02J_2_ B, HB_02J_A, HB_02J_C, HB_02J_B, BJ_02J_3_A, BJ_05J_1_C, BJ_05J_1_B, BJ_05J_2_A, BJ_03J_1_B, BJ_04J_1_A, BJ_03J_7_C, BJ_03J_7_B, BJ_03J_ 5_C, BJ_03J_6_C, BJ_03J_5_B, SD_06L_12_A, SD_06L_11_B, SD_06L_12_B, SD_06L_12_C, SD_06L_8_A, SD_06L_9_A, SD_06L_10_A, SD_06L_8_C, SD_06L _9_B, SD_06L_8_B, SD_06L_10_C, SD_06L_5_A, SD_06L_7_B, SD_06L_6_A, SD_06L_6_C, SD_06L_5_C, SD_06L_4_A, SD_06L_7_A, SD_06L_5_B, SD_06L_4 _B, SD_06L_2_A, SD_06L_2_C, SD_06L_2_B, SD_06L_1_A, SX_01J_4_B, SX_0 1J_4_A, SX_01J_4_C, SX_01J_1_A, SX_01J_2_C, SX_01J_2_A, SD_09L_2_A, SD_09L_2_C, SD_01L_2_A, SD_01L_3, SD_01L_1, SD_02L_1_B, SD_02L_1_A, SD_02L_1_C, SD_02L_2_C, SD_05L_2_A, SD_05L_2_B, SD_05L_2_C, SD_03L_ 1_B, SD_03L_1_A, SD_07L_2_A, SD_07L_1_A, SD_07L_2_C, SD_02L_3_B, SD_ 04L_1_B, SD_04L_1_A, SD_04L_2_B, SD_04L_2_C, JS_01S_3_B, SX_02S_1_B,SX_02S_1_A, SX_02S_1_C, HN_02Y_A, SH_02H_1_C, SH_02H_1_A, SH_02H_1_B, SC_08C_2_A, SC_08C_2_B, SC_08C_3_C, S C_08C_3_B, SC_10C_3_A, SC_10C_3_C, SC_10C_1_A, SC_10C_2_A, SC_10C_3_B, SC_02C_1_A, SC_02C_3_C, SC_02C_2_A, S C_02C_2_B, SC_02C_3_A, SC_02C_1_B, SC_02C_3_B, HB_05E_3_A, HB_05E_2_C, HB_05E_2_A, HB_05E_2_B, SC_07C_2_B, S C_04C_2_B, ZJ_01Z_5_C, SC_03C_1_C, SC_03C_1_B, SC_03C_1_A, SC_04C_3_B, SC_04C_2_C, SC_04C_2_A, SC_04C_1_A, S C_04C_1_B, SC_04C_1_C, SC_04C_3_A, SC_01C_1_A, CQ_01Y_1_B, SC_05C_2_B, SC_05C_2_C, SC_05C_4_B, SC_05C_2_A, S C_05C_3_A, SC_05C_4_A, SC_07C_3_A, SC_07C_3_B, SC_07C_2_A, SC_07C_1_B, SC_07C_1_A, SC_07C_1_C, SC_07C_3_C, S C_06C_2_B, SC_06C_3_A, GZ_01Q_1_C, GZ_01Q_1_A, GZ_01Q_1_B, YN_02D_1_B, YN_02D_1_A, GD_02Y_1_B, GD_02Y_1_A, G D_01Y_1_B, GX_01G_1_C, GX_02G_1, GX_02G_5, GX_02G_3, GX_03G_1_C, GX_02G_2, GX_03G_1_A, GX_03G_1_B, GX_02G_4. ,
[0047] Example 2: Detection of the effectiveness of the SNP molecular markers of the present invention
[0048] 1. Extraction of genomic DNA
[0049] Genomic DNA of the tested varieties was extracted from seedling leaves using the CTAB method.
[0050] The specific operating method is as follows: When the seedlings of the above-mentioned male parent, female parent, and tested varieties (offspring) have grown 4-5 true leaves, take a leaf tissue of about 1 square centimeter as a sample, place it in a 2 mL centrifuge tube, add a steel ball with a diameter of 4 mm, add 250 μL of EDTA solvent, and grind at 1200 r / min for 30 s; then add 500 μL of EDTA solvent, mix by inverting, and place in a 65℃ oven for lysis for more than 1 hour; after the solution cools to room temperature, add an equal volume of chloroform (chloroform is mixed with anhydrous ethanol at a ratio of 24:1), centrifuge at 12000 r / min for 10 min; take 600 μL of the supernatant into a new 1.5 mL centrifuge tube, add an equal volume of anhydrous ethanol, invert, and let stand at -20℃ for more than 1 hour; after taking it out from -20℃, centrifuge at 12000 r / min for 10 min, discard the solution, and add 700 μL of EDTA solvent. Centrifuge at 12000 rpm for 10 min with 75% ethanol; discard the solution (supernatant), and after the solution evaporates, add 100 μL of ultrapure water to fully dissolve it, thus completing the extraction.
[0051] The quality and concentration of genomic DNA must meet the requirements of PCR. The standards are as follows: the A260 / A280 ratio detected by Nanodrop2000 (Thermo) UV spectrophotometer should be around 1.8, and the A260 / A230 ratio should be greater than 1.8; the concentration of genomic DNA of the tested variety should be 30-50 ng / μL.
[0052] 2. Using the genomic DNA of the tested varieties and their paternal and maternal parents as templates, PCR amplification was performed to obtain PCR amplification products. The upstream primer was the primer shown in sequence 2 of the sequence listing, and the downstream primer was the primer shown in sequence 3 of the sequence listing.
[0053] The PCR reaction system, totaling 25 μL, includes:
[0054] Template DNA (50 ng): 1 μL
[0055] A mixture of upstream and downstream primers (concentration ratio 1:1, total 10 μmol / L): 2.0 μL.
[0056] dNTPs (2.5 mg / L each): 2.0 μL
[0057] Ex Taq (5 U / μL): 0.2 μL
[0058] 10×Ex Taq Buffer (Mg 2+ plus (20 mmol / L): 2.5 μL,
[0059] ddH2O: 17.3 μL.
[0060] 3. Detection of PCR amplification products
[0061] The PCR amplification products were examined by agarose gel electrophoresis to detect the presence of bands. The products were then subjected to next-generation sequencing. Based on the sequencing results, it was determined whether the wild chrysanthemum being tested was an early / late flowering variety.
[0062] (3.1) Preparation of agarose gel
[0063] Take 20 mL of 50×TAE buffer and add water to 1000 mL to prepare a 1×TAE dilution buffer. Prepare a 1% agarose gel solution by weighing 1 g of agarose and pouring it into a 200 mL Erlenmeyer flask. Add 100 mL of 1×TAE dilution buffer and heat in a microwave oven until the agarose is completely melted. Add 5 μL of nucleic acid dye to the agarose gel solution cooled to 60±5℃, shake thoroughly, and slowly pour into the gel tank. After 20 minutes, vertically and slowly remove the comb and place the gel plate into the electrophoresis tank. Add electrophoresis buffer (1×TAE) to the electrophoresis tank, ensuring the liquid level is approximately 1 mm above the gel surface.
[0064] (3.2) Agarose gel electrophoresis.
[0065] Use a pipette to draw 5 μL of PCR product into each well of the gel. Connect the leads, turn on the electrophoresis apparatus, and set the voltage to 130 V, the current to 300 mA, and the time to 15 min. After electrophoresis, place the gel plate in a gel imaging analyzer to observe the results. The PCR products are then sent to the company for sequencing.
[0066] 4. Test Results
[0067] Based on the sequencing results, if the 69th base of the R-direction sequence of the amplified band of an unknown variety is T, then the variety is an early-flowering variety. If the 69th base of the R-direction sequence of an unknown variety is A, then the variety is a late-flowering variety.
[0068] Of course, the above description is not intended to limit the present invention, and the present invention is not limited to the examples given above. Any changes, modifications, additions or substitutions made by those skilled in the art within the scope of the present invention should be protected by the present invention.
Claims
1. The application of SNP molecular markers for identifying early-flowering chrysanthemum varieties in early-flowering chrysanthemum breeding, characterized in that, The SNP molecular marker is located at position 296119494 on chromosome 1, with the site name LG01:296119494; it is located at position 214 of the CiSMXL gene; the nucleotide sequence of the CiSMXL gene is shown in SEQ ID No. 1; the two nucleotide bases at this site are either T or A. This SNP molecular marker exhibits T / A polymorphism, leading to changes in the flowering time of chrysanthemums. The traits of different genotypes at this site are as follows: TT: Early flowering trait; TA: Late-flowering characteristics; AA: Late-flowering trait.
2. The method for detecting chrysanthemum flowering time using the SNP molecular markers described in claim 1, characterized in that, The method includes the following steps: (1) Extract genomic DNA from chrysanthemum leaves; (2) Using genomic DNA as a template, the target sequence in the genomic DNA of the sample to be tested is amplified by PCR; (3) The amplified samples were detected using a fluorescence detection platform, and the flowering time of chrysanthemums was determined based on the polymorphism of SNP molecular markers reflected by the obtained fluorescence signals. (4) When the SNP molecular marker genotype is TT, it is an early flowering trait; when the SNP molecular marker genotype is TA or AA, it is a late flowering trait.
Citation Information
Patent Citations
Method for efficiently predicting salt tolerance of chrysanthemum based on whole genome
CN116732222A
Application of FNSII-1 gene in variety identification / breeding of high-linarin chrysanthemum
CN117230085A