Molecular marker VsChr1250303380 related to yield traits of vicia sativa and application thereof

Abstract

The invention discloses a molecular marker VsChr1250303380 related to yield traits of Vicia sativa and application of the molecular marker VsChr1250303380, and belongs to the technical field of biology. The molecular marker VsChr1250303380 is located on a chromosome 1 of a common vetch reference genome (the downloading website is http: / / dx.doi. Org / 10.5524 / 100954), and the molecular marker VsChr1250303380 is located on the chromosome 1 of the common vetch reference genome. The nucleotide sequence of the insertion or deletion fragment is as shown in SEQ ID NO.3. The nucleotide sequences of the primer pair used for amplifying the InDel molecular marker VsChr1250303380 are as shown in SEQ ID NO. 1 to 2. By means of the marker, the breeding efficiency can be greatly improved, and the function of rapidly screening high-yield vicia sativa materials at the molecular level is achieved.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to molecular markers related to yield traits of pea vine and applications thereof. Background Art

[0002] At present, crop breeding methods are mainly divided into molecular breeding and traditional breeding. In the breeding process, the selection of target traits depends largely on genotype and phenotype. Molecular marker-assisted breeding uses the characteristics of molecular markers being closely linked to target trait genes. By detecting molecular markers, the presence of target genes can be detected to achieve the purpose of selecting target traits. It has the advantages of being fast, accurate, and not affected by environmental conditions. With the help of molecular markers, the target trait genotype is selected to shorten the breeding period, speed up the breeding process, improve breeding efficiency, and overcome many difficulties in conventional breeding methods. The research and development and application of molecular marker technology based on genome-wide association analysis (GWAS) has become one of the important hotspots and competitive areas in the current breeding field.

[0003] Vicia sativa L. is an important self-pollinating annual forage legume. Vicia sativa is mainly distributed in Turkey, Australia, New Zealand and various parts of China. Because Vicia sativa has high nutritional value and good palatability, and does not adversely affect the fermentation of ruminant silage, it is an important raw material for making feed. In addition, Vicia sativa can also be used as high-quality green manure and cold-resistant crops, and has broad application prospects in environmental protection and ecological restoration. However, since traditional breeding methods rely on natural variation and phenotypic observation, their cycles are long and their efficiency is low, making it difficult to meet the rapidly growing demand for high-quality and high-yield feed in animal husbandry in a short period of time. Especially in the context of the rapid development of animal husbandry, the yield problem of feed crops is particularly prominent. Existing feed crop varieties generally have problems of low yield and instability, which makes it difficult to ensure the efficient operation of the feed supply chain. At the same time, the determination process of high-yield traits usually requires a lot of time, money and manpower, which seriously affects breeding efficiency. For this reason, it is particularly important to develop accurate and efficient molecular marker technology. Molecular marker-assisted breeding can quickly locate gene loci associated with high-yield traits, greatly improving breeding efficiency. The present invention combines genome-wide association analysis of peas with the third-generation molecular marker technology to develop InDel molecular markers associated with yield traits of peas, providing a scientific basis for breeding peas with high-yield traits, thereby accelerating the selection of high-yield peas. Summary of the invention

[0004] One of the purposes of the present invention is to provide a molecular marker related to the yield trait of pea.

[0005] The second object of the present invention is to provide the application of the above-mentioned molecular markers related to the yield traits of pea.

[0006] To achieve the above object, the present invention adopts the following technical solutions:

[0007] The invention discloses a pair of molecular markers related to the yield trait of pea stalks, which are located on chromosome 1 of pea stalks. The molecular markers are named Vs_Chr1_250303380.

[0008] The molecular marker Vs_Chr1_250303380 is an insertion / deletion fragment on chromosome 1 of the reference genome of V.

[0009] AAATCAAAACCAAATTCAAGAATCTTTCAAAAATTTAGAGACAAATGTTTTTGAATTTC (shown in SEQ ID NO. 3).

[0010] A primer pair for amplifying a molecular marker related to the yield trait of pea, wherein the primer pair sequence corresponding to the molecular marker Vs_Chr1_250303380 is:

[0011] Vs_Chr1_250303380-F: GTGGAGAAAGAAAGAGGTAGA (shown in SEQ ID NO.1);

[0012] Vs_Chr1_250303380-R: CATGTTTCTGAAAACCCATT (shown in SEQ ID NO. 2).

[0013] The present invention also discloses the use of the above molecular marker primer pair in assisted breeding of high and low yield traits of peas. Specifically, the molecular marker of the present invention can be used in future molecular marker assisted breeding, by extracting DNA from leaves at the seedling stage, detecting whether the molecular marker of the present invention exists, and then identifying the yield trait of peas. The detection can use the PCR detection method, specifically the above molecular marker primer pair can be used, and the detection can also be performed by sequencing method.

[0014] The present invention also discloses the application of the molecular marker in identifying the yield characteristics of pea stalks, especially in screening and identifying high-yield pea stalks. The specific steps for identifying whether pea stalks have high-yield characteristics are as follows:

[0015] (1) The DNA of the test germplasm was used as a template for PCR amplification, and the primer pair corresponding to the marker Vs_Chr1_250303380 was used as a primer. The reaction system of PCR amplification is shown in Table 1:

[0016] Table 1 PCR amplification reaction system

[0017]

[0018]

[0019] PCR amplification program: pre-denaturation at 98°C for 30s; denaturation at 98°C for 10s, annealing at 55°C for 5s, extension at 72°C for 5s, 35 cycles; extension at 72°C for 1min; storage at 4°C.

[0020] (2) Agarose gel electrophoresis test of PCR products, and judging the yield of peas according to the results:

[0021] If the PCR amplification product is a characteristic band with a length of 160 bp as shown in SEQ ID NO.4, the pea is a low-yield type; if the PCR amplification product is a characteristic band with a length of 101 bp as shown in SEQ ID NO.5, the pea is a high-yield type.

[0022] In addition, a reagent containing the above molecular marker primer pair can be selected to make a kit, which can be used to identify the yield traits of the pea material. Furthermore, the kit can be used to identify or assist in identifying the genotype of the pea. The specific identification method can be:

[0023] (1) extracting genomic DNA of the pea to be tested;

[0024] (2) using the genomic DNA extracted in step (1) as a template, performing PCR amplification using the primer pair of the molecular marker described in claim 1, and performing electrophoresis detection and / or sequencing on the PCR amplification product;

[0025] (3) The PCR amplification product is subjected to electrophoresis detection and / or sequencing. If the PCR amplification product is a characteristic band with a length of 160 bp as shown in SEQ ID NO.4, the pea is a low-yield genotype; if the PCR amplification product is a characteristic band with a length of 101 bp as shown in SEQ ID NO.5, the pea is a high-yield genotype. The present invention has the following advantages:

[0026] (1) The molecular markers in the present invention are closely related to the yield traits of pea, and can be applied to molecular marker-assisted breeding of pea yield traits, to the screening of germplasm resources for high-yield pea, and to the genetic improvement of pea.

[0027] (2) The molecular markers of the present invention have the characteristics of convenient detection, stable amplification products and high specificity, and can be applied to the breeding practice of pea quickly and with high throughput. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 The figure is the result of genome-wide association analysis of dry weight traits of pea, which is a Manhattan diagram obtained based on EMMAX software analysis. The red sites shown are the InDel positions associated with the present invention.

[0029] Figure 2 Box plot of DW (dry weight) corresponding to different genotypes of the Vs_Chr1_250303380 locus in the genome-wide association analysis. 0 / 0 means that the genotype of the Vs_Chr1_250303380 locus is a low-yield genotype, and 1 / 1 means that the genotype of the Vs_Chr1_250303380 locus is a high-yield genotype. The dots are the extreme values ​​of the data, and the values ​​above are the P values ​​for testing differences.

[0030] Figure 3 The sequence differences between the 0 / 0 genotype and the 1 / 1 genotype within the molecular marker Vs_Chr1_250303380 region.

[0031] Figure 4 This is the electrophoresis diagram of molecular markers amplified from some of the germplasm resources of Aglaonema ovata, and the concentration of agarose gel is 2%. In the figure, M represents DNA marker. DETAILED DESCRIPTION

[0032] The present invention will be described in detail below through specific embodiments. These embodiments are provided to enable a more thorough understanding of the present invention and to fully convey the scope of the present invention to those skilled in the art.

[0033] Unless otherwise specified, the technical means used in the examples are conventional means known to those skilled in the art. The test methods in the following examples are conventional methods unless otherwise specified. Unless otherwise specified, the reagents and materials used can all be purchased from the market.

[0034] Unless otherwise defined, all professional and scientific terms used herein have the same meanings as those familiar to those skilled in the art. In addition, any methods and materials similar or equivalent to those described herein may be applied to the present invention. The preferred implementation methods and materials described herein are for demonstration purposes only.

[0035] Example 1 Development of molecular markers related to pea yield

[0036] The present invention uses the DW (dry weight, unit g) index to evaluate the yield trait of the pea. The higher the value, the higher the yield of the pea. The lower the value, the lower the yield of the pea. After measuring the DW of the pea population, an InDel site was located in the pea through GWAS analysis ( Figure 1Red site), named Vs_Chr1_250303380. This site is located at the 250303380 site on chromosome 1 of the reference genome of the pea (download URL: http: / / dx.doi.org / 10.5524 / 100954), where the first allele type of the inserted InDel is 0 / 0; the second allele type of the deleted InDel is 1 / 1. DW distribution box plot of different genotypes of the Vs_Chr1_250303380 site in the pea population ( Figure 2 ), indicating that the dry weight of the 1 / 1 genotype of the pea is significantly higher than that of the 0 / 0 genotype. At the 250303380th site on chromosome 1 of the pea, the insertion / deletion fragment is AAATCAAAACCAAATTCAAGAATCTTTCAAAAATTTAGAGACAAATGTTTTTGAATTTC (shown in SEQ ID NO.3) ( Figure 3 ), the 0 / 0 type has the inserted fragment of SEQ ID NO.3, while the 1 / 1 type lacks the inserted fragment of SEQ ID NO.3.

[0037] Based on the InDel variation and its upstream and downstream sequences, the following primers were designed using Primer 5.0 software:

[0038] Vs_Chr1_250303380-F: GTGGAGAAAGAAAGAGGTAGA (shown in SEQ ID NO.1);

[0039] Vs_Chr1_250303380-R: CATGTTTCTGAAAACCCATT (shown in SEQ ID NO. 2).

[0040] Then, the primers were used to perform PCR amplification on the samples to be tested. The results showed that the PCR product of the low-yield sagittaria sample had a characteristic band of 160 bp, and the PCR product of the high-yield sagittaria sample had a characteristic band of 101 bp.

[0041] Example 2 Verification of the Accuracy of the Molecular Markers Described in the Present Invention

[0042] 222 germplasms were identified, and the specific germplasm materials used are shown in Table 2:

[0043] Table 2 Dry weight index of 222 pea germplasm materials and genotype corresponding to Vs_Chr1_250303380 locus

[0044]

[0045]

[0046]

[0047]

[0048]

[0049]

[0050] Note: In the table, genotype . / . represents missing genotype.

[0051] 1) using the genomic DNA of the pea to be identified as a template, performing PCR amplification using the primer pair to obtain a PCR product;

[0052] The reaction system of PCR amplification is as follows: template DNA 10-100ng, 10μM forward primer 1μL, 10μM reverse primer 1μL, 2×TaqPCRMasterMix 5μL, deionized water to 10μL; the reaction program of the PCR amplification is preferably: 98℃ pre-denaturation for 30s; 98℃ denaturation for 10s, 55℃ annealing for 5s, 72℃ extension for 5s, 35 cycles; 72℃ extension for 5min; 4℃ storage. 2% agarose gel electrophoresis separation, 140V DC voltage electrophoresis for 1h after spotting, and then read the PCR band type of each sample.

[0053] 2) Determine the genotype of the pea genotype according to the size of the PCR product: when the PCR product of the pea genotype to be identified contains the fragment shown in SEQ ID NO.3, the pea genotype to be identified is 0 / 0 type; when the PCR product of the pea genotype to be identified lacks the fragment shown in SEQ ID NO.3, the pea genotype to be identified is 1 / 1 type;

[0054] Specifically, when the PCR product of the to-be-identified Echinops oleraceus contains the fragment shown in SEQ ID NO.3, the band length of the PCR product is 160 bp (SEQ ID NO.4), then the to-be-identified Echinops oleraceus is of type 0 / 0.

[0055] The sequence of SEQ ID NO.4 is as follows:

[0056]

[0057] When the fragment shown in SEQ ID NO.3 is missing from the PCR product of the to-be-identified pea, the band length of the PCR product is 101 bp (SEQ ID NO.5), and the to-be-identified pea is of type 1 / 1.

[0058] The sequence of SEQ ID NO.5 is as follows:

[0059]

[0060] The 222 pea materials in Table 2 were analyzed. Except for 6 materials with missing genotypes, 63 pea materials had a genotype of 0 / 0 at the Vs_Chr1_250303380 locus, with an average DW of 16.93946154 g, belonging to low-yield pea; 153 pea materials had a genotype of 1 / 1 at the Vs_Chr1_250303380 locus, with an average DW of 21.05821429 g, belonging to high-yield pea. The variance analysis showed that the DW of high-yield pea and low-yield pea was significantly different (P<0.01).

[0061] 24 materials (germplasm numbers 64, 65, 470, 17, 270, 67, 79, 200, 303, 302, 467, 62, 109, 164, 172, 202, 208, 235, 33, 409, 429, 447, 461, 527) from the 222 samples of Aglaonema spp. in Table 3 were selected for verification. Figure 4 It can be seen that 12 parts of the pea materials amplified a characteristic band of 101bp, which was 1 / 1 type. After statistical analysis, the average DW of these 12 pea materials was 21.36583333g; another 12 pea materials amplified a characteristic band of 160bp, which was 0 / 0 type. After statistical analysis, the average DW of these 12 0 / 0 type pea materials was 8.255g, which was lower than the DW average of 12 1 / 1 type pea materials. Variance analysis showed that the DW of 0 / 0 type and 1 / 1 type was significantly different (P<0.01). The 1 / 1 type pea material genotyped by PCR test results was expected to be a high-yield material, and the actual situation was basically consistent with expectations. Therefore, the InDel molecular marker of the present invention can effectively identify the yield traits of pea, and can be used for the prediction and screening of high-yield pea varieties.

[0062] The embodiments described above are only preferred embodiments of the present invention and are only used to explain the present invention, not to limit the scope of implementation of the present invention. For those skilled in the art, other implementation methods can certainly be easily made by replacement or modification based on the technical contents disclosed in this specification. Therefore, all changes and improvements made on the principles of the present invention should be included in the scope of the patent application of the present invention.

Claims

1. A molecular marker Vs_Chr1_250303380 associated with the yield trait of pea, characterized in that: The molecular marker Vs_Chr1_250303380 is an insertion / deletion fragment AAATCAAAACCAAATTCAAGAATCTTTCAAAAATTTAGAGACAAATGTTTTTGAATTTC on chromosome 1 of the reference genome of Pisum sativum, and its corresponding primer pair sequence is: Vs_Chr1_250303380-F:GTGGAGAAAGAAAGAGGTAGA; Vs_Chr1_250303380-R:CATGTTTCTGAAAACCCATT.

2. Use of the molecular marker described in claim 1 in molecular marker-assisted breeding of pea.

3. The use according to claim 2, characterized in that: The molecular marker is used to identify or assist in identifying the yield trait of pea.

4. A method for identifying the yield characteristics of peas, characterized in that: The method comprises the following steps: (1) extracting the genomic DNA of the pea to be tested; (2) using the genomic DNA extracted in step (1) as a template, performing PCR amplification using the primer pair of the molecular marker described in claim 1, and performing electrophoresis detection and / or sequencing on the PCR amplification product; (3) Determination is made based on the electrophoresis bands and / or sequencing results of step (2), and the specific criteria are: The genomic DNA of the tested pea was amplified by PCR using primers Vs_Chr1_250303380-F and Vs_Chr1_250303380-R. If the PCR amplification product was a characteristic band with a length of 160 bp as shown in SEQ ID NO.4, the pea was a low-yield type; if the PCR amplification product was a characteristic band with a length of 101 bp as shown in SEQ ID NO.5, the pea was a high-yield type.

5. A kit for identifying the yield of peas, characterized in that: Comprising the primer pair described in claim 1.

6. Use of the kit according to claim 5 in identifying the yield genotype of pea.

7. The use according to claim 6, characterized in that: The method for identifying the yield genotype of pea using the kit is as follows: (1) extracting the genomic DNA of the pea to be tested; (2) using the genomic DNA extracted in step (1) as a template, performing PCR amplification using the primer pair of the molecular marker described in claim 1, and performing electrophoresis detection and / or sequencing on the PCR amplification product; (3) The PCR amplification product is subjected to electrophoresis detection and / or sequencing. If the PCR amplification product is a characteristic band with a length of 160 bp as shown in SEQ ID NO.4, the pea is a low-yield genotype; if the PCR amplification product is a characteristic band with a length of 101 bp as shown in SEQ ID NO.5, the pea is a high-yield genotype.

Images