Biosurfactant-producing microorganisms

Abstract

The invention provides a Burkholderia thailantensis DIS2 bacterium, a Burkholderia thailantensis DIS2.1 bacterium, a bacterium with all recognition characteristics of the Burkholderia thailantensis DIS2 bacterium and the Burkholderia thailantensis DIS2.1 bacterium, and a mutant of the Burkholderia thailantensis DIS2 bacterium and the Burkholderia thailantensis DIS2.1 bacterium. The invention also provides a Starmerella bombicola DIS4 yeast, a yeast with all recognition characteristics of the Starmerella bombicola DIS4 yeast, and a mutant of the Starmerella bombicola DIS4 yeast. Also provided are methods for producing rhamnolipids and methods for producing sophorolipids. In order to produce rhamnolipids, raw materials comprising waste carbon sources and fried edible oil are fermented with Burkholderia Thailand, mutants or variants thereof. Similarly, in order to produce sophorolipids, a raw material comprising a waste carbon source and a deep-fried edible oil is fermented with Starmomyces sp., a mutant or a variant thereof.

Description

Technical Field

[0001] The present disclosure relates to the field of biosurfactants, more specifically to rhamnolipids and sophorolipids, microorganisms producing them and uses thereof. Background Art

[0002] Surfactants are surface-active agents that can reduce the surface tension between two phases (e.g., liquid-liquid, solid-liquid, and gas-liquid interfaces). These ingredients represent the most versatile category in the chemical industry, as they are used in a variety of areas that affect our daily lives. Surfactants are used in many industries, from cleaning products to cosmetics, agriculture, and more. On an industrial scale, surfactants are currently derived from unsustainable petrochemical processes (i.e., synthetic surfactants) that use palm and / or petroleum feedstocks. Synthetic surfactants are divided into two categories: petrochemical surfactants and oleochemical surfactants. Petrochemical surfactants are derived from petroleum feedstocks, while oleochemical surfactants can be derived from renewable feedstocks while still having a portion of palm / petroleum feedstocks. Synthetic surfactants cause serious environmental issues due to their poor biodegradability and significant environmental toxicity. Therefore, methods for producing biosurfactants (such as rhamnolipids and sophorolipids) can serve as a sustainable alternative to synthetic surfactants. Biosurfactants can be prepared from palm-based ingredients or obtained from microorganisms that produce biosurfactants. Unfortunately, palm tree agriculture is a major cause of deforestation and supports unethical labor standards. Therefore, it would be more desirable and sustainable to produce biosurfactants from microorganisms.

[0003] In addition, currently commercial production of biosurfactants (e.g., sophorolipids and rhamnolipids) using microorganisms is done using traditional fermentation feedstocks (e.g., laboratory-grade or food-grade edible feedstocks). It would be more desirable to produce biosurfactants from non-food-grade renewable feedstocks.

[0004] Rhamnolipids, first discovered in cultures of Pseudomonas aeruginosa, are among the most intensively studied biosurfactants. They are among the most commercially promising biosurfactants worldwide due to their excellent surface activity, low toxicity, and high biodegradability. Due to the pathogenicity of Pseudomonas aeruginosa, non-pathogenic bacteria have been studied to potentially discover new species for the non-pathogenic production of rhamnolipids. This will ultimately have a significant impact on the commercialization of such ingredients, as ensuring non-pathogenicity and non-toxicity is key in industries such as consumer products and pharmaceuticals. Burkholderia thailandensis is one such non-pathogenic bacterium that has been identified as a promising candidate for commercial rhamnolipid production. However, the current process for producing rhamnolipids using Burkholderia thailandensis is inefficient, has low yields, and is not commercially viable. In addition to rhamnolipids, another biosurfactant that has shown good commercial potential in recent years is sophorolipids. These biosurfactants have been produced in the past using a yeast species called Starmerella bombicola.Therefore, there is a need to improve the production of biosurfactants such as rhamnolipids and sophorolipids, especially from the perspective of industrial scale and sustainability. Summary of the invention

[0005] In one aspect, a Thai Burkholderia DIS2 bacterium, a mutant or variant thereof, deposited in IDAC with accession number 240222-01, is provided. Also provided is a bacterium, a mutant or variant thereof having all the identification features of Thai Burkholderia DIS2 deposited in IDAC with accession number 240222-01. In another aspect, a Thai Burkholderia DIS2.1 bacterium, a mutant or variant thereof, deposited in IDAC with accession number 070323-01, is provided. Also provided is a bacterium, a mutant or variant thereof having all the identification features of Thai Burkholderia DIS2.1 deposited in IDAC with accession number 070323-01. In another aspect, a bacterium, a mutant or variant thereof having all the identification features of Thai Burkholderia DIS2.1 deposited in IDAC with accession number 070323-01, is provided. In another aspect, a bombus saccharomyces cerevisiae DIS4 yeast, a mutant or variant thereof, deposited in IDAC with accession number 210223-01, is provided. Also provided is a yeast, mutant or variant thereof having all the identifying characteristics of Bombyx mossima DIS4 deposited with IDAC under accession number 210223-01.

[0006] In another aspect, a method for producing rhamnolipid is provided, the method comprising: fermenting with Burkholderia thailandica, its mutant or variant, wherein the fermentation is carried out with a raw material comprising a waste carbon source and a fried edible oil. The waste carbon source can be enzyme-treated, physically treated or heat-treated or untreated. In one embodiment, the waste carbon source is selected from whey, glycerol, maple syrup waste and starch waste. In one embodiment, the fried edible oil is selected from fried corn oil, fried rapeseed oil, fried peanut oil, fried coconut oil, fried grape seed oil, fried soybean oil, fried olive oil and fried cottonseed oil. In addition, ethanol can also be added to the raw material. Burkholderia thailandica can be Burkholderia thailandica DIS2 or Burkholderia thailandica DIS2.1. A method for extracting rhamnolipid is by solvent extraction, for example, using ethyl acetate or ethanol as an extraction solvent.

[0007] In another aspect, a method for producing a sophorolipid is provided, the method comprising: fermenting with bumblebee Starmosaccharomyces, a mutant or variant thereof, wherein the fermentation is carried out with a raw material comprising a waste carbon source and a fried edible oil. The waste carbon source may be enzyme-treated, physically treated or heat-treated or untreated, and may be selected from whey, glycerol, maple syrup waste and starch waste. The fried edible oil may preferably be selected from fried corn oil, fried rapeseed oil, fried peanut oil, fried coconut oil, fried grape seed oil, fried soybean oil, fried olive oil and fried cottonseed oil. In one embodiment, the bumblebee Starmosaccharomyces is ATCC 22214 or bumblebee Starmosaccharomyces DIS4. One method of extracting rhamnolipids is by solvent extraction, for example, using ethyl acetate or ethanol as an extraction solvent.

[0008] Many further features and combinations thereof relating to the present improvement will be apparent to those skilled in the art after reading this disclosure. BRIEF DESCRIPTION OF THE DRAWINGS

[0009] Figure 1 is a diagram of the introduction of exemplary mutations into the chromosome of Burkholderia thailandensis.

[0010] Figure 2 is a gel image showing the deletion of the scmR gene in Burkholderia thailandensis DIS2.

[0011] Figure 3 It is a graph showing the change in optical density measured at 545 nm over time when Burkholderia thailandensis DIS2 was cultured in PA14 medium (●), BGR1 medium (■) and M9 medium (▲).

[0012] Figure 4The optical density at 545 nm was measured at the endpoint when Burkholderia thailandensis was cultured with rapeseed oil, corn oil, ethanol (1.6 M or 0.8 M), glycerol, sodium gluconate, dextrose, sucrose, mannitol, fructose, maltose, sorbitol, sodium pyruvate, sodium fumarate, sodium acetate, sodium formate, sodium benzoate, sodium octanoate or sodium succinate.

[0013] Figure 5A The optical density at 600 nm was measured at the endpoint when Burkholderia thailandensis DIS2 was cultured with glycerol, sucrose, d-glucose, mannitol, sorbitol, corn oil or ethanol.

[0014] Figure 5B yes Figure 5A Figure 3 Rhamnolipid (RL) production of cultures.

[0015] Fig. 6A It is a graph showing the change in optical density of Burkholderia thailandensis DIS2 culture measured at 600 nm over time at a temperature of 25°C (●), 30°C (■), 32°C (▲), 35°C (▼), 37°C (◆) or 40°C (○).

[0016] Figure 6B yes Fig. 6A Rhamnolipid (RL) production in cultures of .

[0017] Fig. 7A is a graph of rhamnolipid (RL) production by Burkholderia thailandensis DIS2 cultures using different nitrogen sources (urea, NaNO3, KNO3, NH4NO3, (NH4)2SO4, or peptone).

[0018] Figure 7B It is a graph of rhamnolipid (RL) production of Burkholderia thailandensis DIS2 culture using different phosphate sources (C1 (KH2PO4 0.1M), C2 (KH2PO4 0.05M+K2HPO4 0.05M), C3 (KH2PO4 0.05M+Na2HPO4 0.05M), C4 (K2HPO4 0.1M), C5 (K2HPO4 0.05M+Na2HPO4 0.05M) or C6 (Na2HPO4 0.1M)).

[0019] Figure 8 This is a diagram of the factor redistribution of the Taguchi analysis performed.

[0020] Fig. 9 Graphs showing rhamnolipid (RL) production for each of the sixteen Taguchi factors shown in Table 4.

[0021] Fig. 10Ais a graph showing the relative dry cell weight (DCW) obtained after fermentation using nine different oils, one control oil (Oil 1) and eight frying oils (Oils 2-9).

[0022] Fig. 10B is a graph showing the relative sophorolipid (SL) yields obtained after fermentation using nine different oils, one control oil (Oil 1) and eight frying oils (Oils 2-9).

[0023] Fig. 10C is a graph showing the relative productivity obtained after fermentation using nine different oils, one control oil (Oil 1) and eight frying oils (Oils 2-9).

[0024] Fig.11A is a graph showing the dry cell weight (DCW) obtained after fermentation with glucose, table sugar or waste maple syrup as carbon source.

[0025] Fig. 11B is a graph showing the sophorolipid yields obtained after fermentation with glucose, table sugar or waste maple syrup as carbon source.

[0026] Fig. 11C is a graph showing the productivity of fermentations using glucose, table sugar or waste maple syrup as a carbon source.

[0027] Fig. 12A is a graph showing the dry cell weight after fermentation using commercial yeast extract (YE1) or waste Saccharomyces cerevisiae extract (YE2 and YE3).

[0028] Fig. 12B is a graph showing the sophorolipid production after fermentation using commercial yeast extract (YE1) or waste Saccharomyces cerevisiae extract (YE2 and YE3).

[0029] Fig. 12C is a graph showing the productivity of fermentations using commercial yeast extract (YE1) or waste Saccharomyces cerevisiae extract (YE2 and YE3).

[0030] Fig.13A Biosurfactant profiles are shown for fermentations using pure yeast extract (commercial).

[0031] Fig. 13B Shown are biosurfactant profiles from fermentations using waste Saccharomyces cerevisiae extract.

[0032] Fig.14A is a graph showing dry cell weight in different fermentations with different yeast inoculum amounts.

[0033] Fig. 14B is a graph showing the sophorolipid production in different fermentations with different yeast inoculum amounts.

[0034] Fig. 14C The graph shows the productivity obtained when the yeast inoculum size was varied. DETAILED DESCRIPTION

[0035] Provided herein is a method for producing biosurfactants using agricultural food waste as raw materials by microorganisms. More specifically, the term "biosurfactant" as used herein refers to a surfactant composition obtained from a microorganism, which contains rhamnolipids or sophorolipids or is composed of rhamnolipids or sophorolipids. The microorganisms contemplated by the present disclosure include Burkholderia thailandensis or Bombus spp. Starmosaccharomyces cerevisiae and mutants and variants thereof. In some embodiments, two different mutants of the same strain can be combined. For example, Burkholderia thailandensis DIS2 and Burkholderia thailandensis DIS2.1 (DIS2 with ΔscmR mutation) can be combined. In some embodiments, Burkholderia thailandensis E264 (American Type Culture Collection (ATCC) 700388) can be used to produce rhamnolipids. Variants include, but are not limited to, spontaneous mutant strains, mutant strains obtained by ultraviolet or chemical mutagen treatment, cell fusion strains, and genetically recombinant strains. In another example, Bombus spp. Starmosaccharomyces cerevisiae is used to produce sophorolipids. In some embodiments, Bombus spp. Starmosaccharomyces cerevisiae is Bombus spp. Starmosaccharomyces cerevisiae DIS4. In further embodiments, the Bombyx mossaccharomyces cerevisiae is strain ATCC 22214. Strains contemplated by the present disclosure, particularly DIS2, DIS2.1 and DIS4, are described in further detail below.

[0036] The present disclosure advantageously utilizes agricultural food waste as raw material for fermentation performed by microorganisms to produce biosurfactants. Compared with the traditional method using food-grade edible raw materials, the present method achieves a significant reduction in cost and improves sustainability by replacing food-grade edible raw materials with agricultural food waste raw materials. The agricultural food waste of the present disclosure includes waste carbon sources (treated or untreated) and frying edible oil. The waste carbon source can be selected from whey, glycerol, maple syrup waste and starch waste. In one example, the waste carbon source can be heat-treated. In another example, the waste carbon source can be physically treated, such as by grinding. The treatment methods described herein can be combined or performed independently. Whey can be used "as is" as a waste byproduct of the dairy industry, or whey can be further processed by introducing lactase to decompose whey into galactose and glucose. If treated, whey-derived galactose and glucose can be combined or used for fermentation alone. Similarly, starch waste can be provided untreated, or can be treated (e.g., enzyme-treated) to obtain glucose by decomposing starch polymers. In some embodiments, maple syrup waste can be provided untreated. In some embodiments, maple syrup waste is defined as maple syrup that is not suitable for consumption (i.e., inedible) and is discarded in a commercial process. This may be due to microbial contamination. In some embodiments, maple syrup waste is directly used without any treatment. Maple syrup waste generally has a high content of sucrose, such as 70 to 90% by weight or 75 to 85% by weight. In some embodiments, the agricultural food waste used in the present disclosure includes whey and fried edible oil, or is mainly composed of whey and fried edible oil. In some embodiments, the agricultural food waste used in the present disclosure includes maple syrup waste and fried edible oil, or is mainly composed of maple syrup waste and fried edible oil. In some embodiments, the agricultural food waste used in the present disclosure includes glycerol and fried edible oil, or is mainly composed of glycerol and fried edible oil. Glycerol may be advantageous in producing sophorolipids.

[0037] Biosurfactants (such as sophorolipids and rhamnolipids) contain fatty acids and sugar moieties. It is found that the medium comprising a fatty acid source (such as fried edible oil) and a waste carbon source is conducive to promoting the generation of biosurfactants. In addition, another advantage is to use two different waste sources to improve the environmental benefits of the method. Fried edible oil is a frying oil used for frying food and discarded as waste. Fried edible oil can be obtained from restaurants, cafeterias, municipalities, waste management units, etc. The example of fried edible oil includes but is not limited to fried corn oil, fried rapeseed oil, fried peanut oil, fried coconut oil, fried grapeseed oil, fried soybean oil, fried olive oil and fried cottonseed oil. Fried edible oil can be used as a raw material in the form obtained from a waste source, that is, without pretreatment. In some embodiments, fried edible oil comprises 75% to 85% fatty acid content and 15% to 25% carbon content.

[0038] Fermentation is carried out to produce biosurfactant using culture of Thai Burkholderia mutant or its variant or bumblebee raw Starmo yeast mother mutant or its variant.If necessary, pre-culture can be carried out on agar plate before fermentation, usually inoculated from the original strain of microorganism.After incubation for 48 hours on a flat plate at a suitable temperature (for example, about 30 ° C for bumblebee raw Starmo yeast, about 37 ° C for Thai Burkholderia, although it can also be 30 ° C for Thai Burkholderia), isolate colonies and replicate for inoculation in the liquid pre-culture in the pre-culture bottle.In one example, the pre-culture flask is a 125mL flask containing 25mL agricultural food raw material medium.Raw materials can include untreated waste carbon source and / or processed waste carbon source, and fried edible oil.This 48-hour liquid pre-culture can be used as an inoculum for large-scale fermentation.

[0039] Fermentation can be carried out in a continuous process, a semi-continuous process or in batches. The medium used for fermentation can contain 5 to 20% by weight of agricultural food waste (waste carbon source and fried edible oil). In some embodiments, the medium used for fermentation contains 7 to 13v / v%, 8 to 12v / v%, 9 to 11v / v% or about 10v / v% fried edible oil. In some embodiments, the medium used for fermentation contains 1 to 10% by weight, 1 to 8% by weight of waste carbon source (after or before treatment) or 1 to 6% by weight. In other embodiments, the concentration of the waste carbon source can be 20 to 200g / L, 50 to 150g / L or about 100g / L. In some embodiments, fermentation is carried out at a temperature of 25 to 40°C. Although waste carbon source and fried edible oil content can be used for the fermentation of Burkholderia thailandensis or Bombus staminamo yeast, other fermentation parameters (such as temperature, pH, salt / nitrogen content in oxygen level and medium) will be different, because in one case it is bacterial fermentation, and in another case it is yeast fermentation. In one example, fermentation is carried out in batches in 1 L flasks for 6 to 8 days at 30°C ± 5% for B. bumblebee and 30°C ± 5% for B. thailandensis, with a maximum temperature of 37°C ± 5%. The preferred pH for B. thailandensis fermentation is 6 ± 0.3 and the preferred pH for B. bumblebee fermentation is 4 ± 0.5. Other components in the fermentation medium include a nitrogen source and salts. In some embodiments, the nitrogen source is a yeast extract obtained from brewery waste.

[0040] The culture medium produced by the fermentation is treated according to the fermentation performed (i.e., with Burkholderia thailandica or Bombus stamina) to recover rhamnolipid or sophorolipid. Liquid extraction using an extraction solvent (e.g., ethyl acetate or preferably ethanol) produces a liquid phase and an organic phase, wherein the organic phase comprises an extraction solvent and sophorolipid or rhamnolipid. When the extraction solvent is ethyl acetate, liquid extraction can be performed, wherein the ratio of the culture medium to the extraction solvent is 0.8-1.2: 1, 0.9-1.1: 1, 0.95-1.05: 1 or about 1: 1. Liquid extraction can be performed, wherein the ratio of the culture medium to the extraction solvent is 0.8-1.2: 3, 0.9-1.1: 3, 0.95-1.05: 3 or about 1: 3. In some embodiments, the solvent extraction process is repeated until the desired recovery rate of rhamnolipid or sophorolipid is recovered from the culture medium. For example, solvent extraction can be performed once, twice, three times or more. Then, the extraction solvent can be evaporated to obtain a rhamnolipid or sophorolipid in solid form. Then, the rhamnolipid or sophorolipid can be optionally washed with an organic solvent (e.g., hexane). Hexane can help remove fried edible oil residues. The washing step can be repeated until the desired purity is reached. The obtained product can be resuspended in a resuspension phase (e.g., ethyl acetate or ethanol), then lyophilized and packaged. In some embodiments, the resuspension phase and the extraction solvent have the same composition. Resuspension can be carried out in a resuspension phase that is less in amount relative to the biosurfactant. Other extraction methods are contemplated herein, such as by weight method or ultrafiltration.

[0041] In some embodiments, the Burkholderia thailandensis strain is DIS2, a mutant or variant thereof, and the DIS2 was deposited in the Canadian National Microbiological Laboratory International Depository (IDAC, 1015 Arlington Street, Winnipeg, Manitoba, Canada, R3E 3R2) on February 24, 2022, as "Thai Burkholderia thailandensis DIS2", with a deposit number of 240222-01. In order to identify strains that overproduce natural rhamnolipids, Thai Burkholderia thailandensis DIS2 was identified by screening a library of thirty Thai Burkholderia thailandensis (also known as Thai Burkholderia thailandensis (B.thailandensis)) strains. Thirty strains were cultured in a test tube containing 5 mL of basic medium at 30 ° C under stirring at 200 rpm for 7 days. The term "minimal medium (minimal medium)" or "minimal media (minimal media)" used herein should be understood as known in the art. In some embodiments, the basic medium contains the minimum amount of nutrients required for microbial growth, such as water, a carbon source, and inorganic salts. In this case, the basic medium is PA14 medium, which contains (in g / L): 0.9 Na2HPO4, 0.7 KH2PO4, 2.0 NaNO3, 0.1 CaCl2·2H2O, 0.4 MgSO4.7H2O, and a trace element solution (2 mL / L) (Abdel-Mawgoud et al., 2014). The composition of the trace element solution is (in g / L): 2.0 FeSO4·7H2O, 1.5 MnSO4·H2O, and 0.6 (NH4)6Mo7O 24 ·4H2O. Then, the culture flask was inoculated to confirm the strain selection. After the screening, the selected strain was ED852, also known as DIS2.

[0042] As previously described, Burkholderia thailandensis produces rhamnolipids. Rhamnolipids are glycolipid surfactants. Rhamnolipids typically contain 3-hydroxy fatty acid dimers connected to a mono- or di-rhamnose moiety via a β-glycosidic bond, or rhamnolipids may contain a single fatty acid chain (rather than a dimer). In some embodiments, rhamnolipids have C8-C 12 alkyl chains and may contain one or more degrees of unsaturation. Two exemplary rhamnolipids are the monorhamnolipids rhamnosyl-β-hydroxydecanoyl-β-hydroxydecanoate (Rha-C 10 -C 10 ) and the dirhamnolipid rhamnosyl-rhamnosyl-β-hydroxydecanoyl-β-hydroxydecanoate (Rha-Rha-C 10 -C 10 ).

[0043] Yeast Bombus spp. was originally found in bumble bee honey in Canada and concentrated grape juice in South Africa. Bombus spp. was later isolated from the tongue of early spring bumblebees (Bombus pratorum) in Spain; it was also isolated from the body surface of red-tailed bumblebees (Bombus lapidaries) in Germany. Bombus spp. is a yeast species that produces sophorolipids. It is an oval to elliptical budding yeast. The yeast exhibits a variety of colony morphologies, depending on the growth conditions. For example, on malt agar, the colonies appear small, raised and white. Typically, bombus spp. does not undergo any filamentous growth. In some embodiments, bombus spp. is a strain provided by the American Type Culture Collection (ATCC): ATCC 22214. ATCC 22214 can be cultured in yeast and mold agar or yeast and mold broth (e.g., ATCC medium 200), yeast extract peptone dextrose (YEPD) (e.g., ATCC medium 1245), and Emmon's modified Sabouraud agar (e.g., ATCC medium 28). Bombus spp. can be grown at temperatures between 4°C and 35°C.

[0044] Sophorolipids are surfactants comprising disaccharides (sophorose) and ω / ω-1 hydroxy fatty acid chains. The yield and chemical structure of sophorolipids can depend on the energy source, pH, oxygen concentration and other cell culture parameters provided to bumblebee raw Starmo yeast. Typically, the growth limiting nutrient of bumblebee raw Starmo yeast (S. bombicola) is nitrogen. When nitrogen is exhausted, the yeast stops proliferating and enters the "stationary phase" that causes sophorolipids to be produced. On the other hand, a sufficient amount of phosphorus must be provided for the production of sophorolipids. However, nitrogen and phosphorus are not the only nutritional restrictions for the production of sophorolipids. Other nutritionally relevant parameters that can be considered include, but are not limited to, the absolute amount of glucose or nitrogen in the C / N or C / P ratio, the type of nitrogen source, acidity and the presence of regulatory proteins. In a preferred embodiment, the Bombus spp. strain is Bombus spp. DIS4, a mutant or variant thereof, deposited at the National Microbiological Laboratory, IDAC, 1015 Arlington Street, Winnipeg, Manitoba, Canada, R3E 3R2, on February 21, 2023, as "Bombus spp. DIS4", with accession number 210223-01. Details of the identification of Bombus spp. DIS4 are provided in the Examples section below (see Example 3).

[0045] The present disclosure contemplates mutants and variants of Burkholderia thailandensis and Bombus stamina. For example, a mutant of DIS2 having an antibiotic resistance gene was generated, which mutant is referred to herein as Burkholderia thailandensis DIS2.1. Thus, in some embodiments, the Burkholderia thailandensis strain is DIS2.1, a mutant or variant thereof, which DIS2.1 was deposited at the National Microbiological Laboratory, IDAC, on March 8, 2023.

[0046] 1015 Arlington Street, Winnipeg, Manitoba, Canada, R3E 3R2, as "Burkholderia thailandica DIS2.1", deposit number 070323-01.

[0047] To generate mutants of DIS2, the effects of antibiotics on DIS2 strains were evaluated. Some inhibition tests were performed with trimethoprim, kanamycin and tetracycline. Specifically, 100 μL cultures of DIS2 strains were inoculated under seven different conditions: medium containing 0, 5, 10, 25, 50, 100 or 200 μg / mL antibiotics (trimethoprim, kanamycin or tetracycline). The plates were incubated at 30°C for 48 hours. After incubation, growth was evaluated and the minimum inhibitory concentration was determined. DIS2 was able to grow in cultures at concentrations of 5 μg / mL trimethoprim, 200 μg / mL kanamycin and 200 μg / mL tetracycline.

[0048] Example 1: Burkholderia thailandensis DIS2.1

[0049] In order to obtain Burkholderia thailandensis DIS2.1 (abbreviated as "DIS2.1"), gene deletion or mutation was performed by two-step allelic exchange. The upstream and downstream of the target gene / site were amplified by polymerase chain reaction (PCR) and inserted into the suicide vector: pEX18 plasmid by Gibson assembly. Then, the constructed vector was transformed into a conjugated Escherichia coli (E.coli) strain: SM10. Then, the mutant allele was transferred to Burkholderia thailandensis (DIS2 strain) by biparental mating between Burkholderia thailandensis DIS2 and E. coli SM10. The vector containing the deletion allele was integrated into the Burkholderia thailandensis DIS2 chromosome by homologous recombination in vivo, and the antibiotic resistance marker encoded in the integrated plasmid backbone (using trimethoprim resistance marker, Tmp) was selected. The isolated partial diploids underwent a second homologous recombination, and reverse selection was performed by the suicide marker PheS (α subunit of phenylalanyl tRNA synthase) protein to isolate the colonies that lost the plasmid backbone. In the presence of p-chlorophenylalanine, only strains with disrupted PheS genes can grow. Figure 1As shown, depending on the upstream or downstream integration of the plasmid backbone, the second homologous recombination has a theoretical 50% chance of obtaining correct confirmation. In the other 50% chance, a wild-type revertant mutant is obtained.

[0050] To construct the suicide vector pEX18-ΔscmRup-down-Tmp-PheS, PCR was performed using synthetic oligonucleotides purchased from Integrated DNA technology for cloning. All PCR reactions were performed using Q5 high-fidelity polymerase (New England Biolabs) in the provided buffer. PCR of the scmR upstream and downstream regions (900 bp) was achieved on genomic DNA of the DIS2 strain using primer pairs dis63 / 64 and dis65 / 66 (Table 1), respectively. The plasmid backbone pET28-Tmp-PheS was amplified into two different parts using primers dis59 / 60 and dis61 / 62 (Table 1), which contained specific overlaps for inserting the scmR upstream / downstream sequences into the suicide vector by Gibson assembly.

[0051] Table 1 : Primer sequences, where the underlined portions highlight the overlap used for Gibson assembly.

[0052]

[0053] The concentration of the primers used was 0.5 μM. The PCR program was: 98°C for 2 min, 30 cycles of 98°C for 10 s, 65°C for 30 s and 72°C for 30 s / kb, and finally 72°C for 5 min. All PCR products were verified on agarose gels and analyzed using FavorPrep TM GEL / PCR purification kit (Favorgen) was used for purification.

[0054] For vector assembly, a total of four different fragments (pEX18-1; pEX18-2; ΔscmRup; ΔscmRdown) were combined by Gibson assembly. Isothermal assembly (Gibson assembly) was performed using a homemade mixture prepared according to Gibson et al. FavorPrep TM The resulting assembled vector was purified using the MicroElute GEL / PCR Purification Kit (Favorgen) and transformed into electrocompetent E. coli DH5α to maintain the plasmid. TMPlasmids were extracted using the Plasmid DNA Extraction Mini Kit and confirmed by Sanger sequencing using the universal primers M13F and M13R contained in the pEX18 vector backbone (Centre d'expertise et de services Génome Québec). Confirmed plasmids were finally transformed into electrocompetent E. coli SM10 before conjugation with DIS2.

[0055] Transformation was performed by incubating the two strains together, spreading the strains on Luria-Bertani (LB) plates and incubating overnight at 37°C. The next day, the cells were resuspended in liquid LB medium (OD i-600nm =0.05) and incubate at 37°C with continuous stirring until the OD 600nm =0.5-1. Then, the two solutions were mixed, centrifuged, and resuspended in 50 μL of tryptic soy broth (TSB) liquid medium and spread on LB-Agar plates supplemented with 100 μg / mL of trimetoxins antibiotics (for vector pEX18 integration) and 50 μg / mL of gentamicin and 15 μg / mL of polymyxin B (for elimination of E. coli SM10). Only the DIS2 strain that has integrated the pEX18 vector into its genome can grow. The plates were incubated at 37°C for three days and colonies were reisolated on fresh LB plates supplemented with a selection marker (100 μg / mL of trimethoprim).

[0056] To select for mutants deleted by the PheS counter-selectable marker, five different colonies were incubated overnight at 37°C in the absence of antibiotics. The next day, different dilutions of the culture were spread on minimal medium (MM) agar plates supplemented with 10 mM p-chlorophenylalanine for PheS counter-selection. The plates were incubated continuously at 37°C for five days. A total of fifty colonies were re-isolated on LB plates with and without trimethoprim to verify the loss of the plasmid backbone (i.e., loss of the antibiotic marker). Sensitive colonies were picked out for PCR colony amplification of the scmR region using primer pair dis81 / 82 (surrounding the scmR gene). Finally, genomic DNA of the positive strains was extracted, PCR was performed on the scmR region using primers 81 / 82, and the agarose gel was run ( Figure 2 ) and compared with the DIS2 wild-type strain by aligning the sequences. The final selected strain (named DIS2.1) was validated by Sanger sequencing using dis81 and dis82 primers (Centre d'expertise et de services Génome Québec) (Table 2).

[0057] Table 2 : scmR sequence regions ΔscmR of DIS2 and DIS2.1. For DIS2, the scmR gene is highlighted in bold and underlined, and for DIS2.1, the inserted linker replacing the scmR gene is underlined. Both upstream and downstream scmR regions of DIS2 and DIS2.1 strains are marked in bold font.

[0058]

[0059]

[0060] Example 2: Optimization of growth conditions for Burkholderia thailandensis

[0061] Implementing the Taguchi method requires three steps. Designing the experiment is the first step, then conducting the experiment and analyzing it, and finally performing a validation analysis to confirm the predictive model (Morsi et al., 2004). The Taguchi method is based on the use of orthogonal arrays, which allows the variables (also called factors) to be distributed in a balanced manner.

[0062] In the present embodiment, the first step of optimization is performed to determine the basic medium that can produce rhamnolipids. Different carbon sources, nitrogen sources and phosphorus sources are screened in the basic medium composition to select the best candidate for optimizing the production medium. Subsequently, the optimum temperature for rhamnolipid production is determined. Finally, the Taguchi method is implemented to determine the optimum conditions for optimizing the biosynthesis of rhamnolipids in Burkholderia thailandensis DIS2.

[0063] Three basic salt media were tested based on mineral media used for rhamnolipid biosynthesis in other bacteria (e.g., Pseudomonas aeruginosa or Burkholderia glumae). The first medium tested was the M9 medium, which contained (in g / L): 15 KH2PO4, 64 Na2HPO4, 0.1 CaCl2, 2.0 MgSO4·7H2O, 2.5NaCl, and 13.78 NaNO3 (Smith et al., 2016). The second medium tested was the BGR1 medium, which contained (in g / L): 3.67 KH2PO4, 2.643 K2HPO4, 0.13CaCl2, 0.1 MgSO4 7H2O, and 9 urea (Nickzad et al., 2018). Finally, the third medium tested was the PA14 medium, which contained (in g / L): 0.9 Na2HPO4, 0.7 KH2PO4, 2.0 NaNO3, 0.1 CaCl2·2H2O, 0.4 MgSO4.7H2O and a trace element solution (2 mL / L) (Abdel-Mawgoud et al., 2014). The composition of the trace element solution was (g / L): 2.0 FeSO4·7H2O, 1.5 MnSO4·H2O and 0.6 (NH4)6Mo7O 24 ·4H2O. The experiment was performed in a microtiter plate: 200 μL of medium was inoculated and the starting OD 600 The plate was placed on the Bioscreen TM (Growth Curves, USA) and incubated at 37°C for 72 hours.

[0064] To determine the minimal media capable of growing Burkholderia thailandensis, five replicates were cultured using three different minimal media supplemented with 4% glycerol. TM The obtained growth curves showed that among the three tested media, PA14 medium was the best candidate for the cultivation of Burkholderia thailandensis ( Figure 3 ).

[0065] A variety of carbon sources were pre-selected for testing: glycerol, sucrose, dextrose, mannitol, sorbitol, ethanol, rapeseed oil, fructose, corn oil, sodium gluconate, sodium pyruvate, sodium succinate, sodium octanoate, sodium fumarate, sodium benzoate, sodium acetate, and sodium formate. Carbon sources were added to the PA14 medium at a fixed concentration of 1.6 M, except corn oil. The medium was supplemented with 4% (w / v) corn oil. A lower concentration of ethanol (0.8 M) was also tested because this compound is toxic to Burkholderia thailandensis.

[0066] At Bioscreen TMThe cells were cultured in PA14 medium containing different carbon sources at 37°C for four days. The cells were stirred for 20 seconds and then the optical density (OD) at 545 nm was measured. 545 )value( Figure 4 ). Statistical differences between data points were determined using one-way analysis of variance (ANOVA) and Duncan's multiple range test. Different lowercase letters indicate statistically significant differences (p<0.05). Results indicated by the same letter were not found to be statistically different. Results indicated by different letters were found to be significantly different. Error bars represent standard error of the mean (n=3).

[0067] from Figure 4 Seven of the best performing carbon sources were selected: glycerol, sucrose, dextrose, mannitol, sorbitol, corn oil, and 0.8 M (or 2 wt.%) ethanol for further testing. New cultures were performed in tubes containing 3 mL of the basic medium PA14 for 5 days. The Thai Burkholderia was cultured again using the same concentration of carbon source (i.e., 1.6 M except for ethanol (0.8 M) and corn oil (4% v / v). At the end of the culture period, the OD was measured. 600 and rhamnolipid production (respectively Figure 5A and Figure 5B ). Statistical differences were determined using ANOVA and Duncan's multiple range test. Different lowercase letters indicate statistically significant differences (p<0.05). Results with the same letter were not found to be statistically different. Results with different letters indicate significant differences. Error bars indicate standard error of the mean (n=3).

[0068] When Burkholderia thailandensis was grown on mannitol or sorbitol, OD 600 Better value ( Figure 5A ), however OD 600 It may be affected by the polyhydroxyalkanoate (PHA) content in the cells (Martinez 2020). Therefore, it is not possible to directly conclude whether the difference is due to bacterial growth alone or whether PHA production has an effect on OD 600 In addition, the rhamnolipid production was similar in cultures carried out in glycerol, mannitol, sorbitol, corn oil, or ethanol ( Figure 5B ). Based on economic considerations, assuming equal or similar levels of rhamnolipid production, the two optimal carbon sources are glycerol and ethanol. Ethanol is affordable and can represent favorable conditions for fermentation due to its anti-foaming properties (facilitating mixing during fermentation). For these reasons, ethanol was chosen for subsequent experiments.

[0069] The temperature range of the culture medium was tested: 25, 30, 32, 34, 37 and 40°C. These two boundary values ​​represent the typical minimum and maximum temperatures used in the industry. The culture medium was stirred at 200 rpm (Infors TM ) were performed in 125 mL baffled flasks containing 25 mL of basic medium (PA14) and 2% ethanol for 6 days. Rhamnolipids were quantified at the last point. The experiment was repeated twice, and a one-way analysis of variance (ANOVA) was performed to evaluate the significance of each carbon or nitrogen source on rhamnolipid production with a statistical confidence level of 95%.

[0070] Fig. 6A and Figure 6B Preliminary screening results for various culture temperatures are shown. 600 Value Fig. 6A At all growth temperatures tested, OD 600 All reached the same value, about 6UA. However, the growth rate varied depending on the temperature. In fact, Burkholderia thailandensis grew slower at 25°C and 40°C compared to the other conditions, reaching the stationary phase in 6 days, while the length of the logarithmic phase for the other conditions was 3 or 4 days. Among the six temperatures tested, rhamnolipid production was highest when Burkholderia thailandensis was cultured at 25°C, 30°C, 32°C or 40°C ( Figure 6B ). Culture was performed in PA14 medium containing EtOH as a carbon source for seven days with a stirring speed of 200 rpm. Statistical differences were determined using ANOVA and Duncan's multiple range test. Different lowercase letters indicate statistically significant differences (p<0.05). Error bars represent standard errors of the mean (n=4). The values ​​are mean ± standard deviation (error bars) of four replicates.

[0071] A previous study conducted on Burkholderia thailandensis showed that higher temperatures hinder the production of rhamnolipids and favor the production of PHAs. In fact, when Burkholderia thailandensis was cultured in NB medium containing 4% glycerol for 264 h in a shake flask experiment, the production of rhamnolipids reached 2.79 g / L and 1.99 g / L at 25°C and 30°C, respectively (Funston et al., 2016). Under the current test conditions, a decrease in rhamnolipid production was observed when the temperature was increased (35°C and 37°C), reaching 189 ppm and 136 ppm, respectively. In the present example, the medium was minimal in composition, while the medium in the study of Funston et al. (Funston et al., 2016) was rich in composition, which could explain the observed lag in the decrease in rhamnolipid production over the temperature range. Unexpectedly, the production of rhamnolipids increased when the culture was carried out at 40°C.

[0072] According to the obtained OD 600and rhamnolipid values, 30°C was chosen as the optimal temperature for a number of reasons. Cultivations performed at 25°C, 30°C, 32°C, or 40°C produced rhamnolipids best, but growth was slower at extreme temperatures. Therefore, in order to develop the shortest and cheapest process, a temperature of 30°C was chosen for subsequent experiments.

[0073] Then, nitrogen sources and phosphate sources were studied. Specifically, the following six nitrogen sources were studied: urea, NaNO3, KNO3, NH4NO3, (NH4)2SO4 and peptone. They were added to the basic medium PA14 at a fixed molar concentration (calculated based on the molar concentration of NaNO3 in the basic medium first tested): 20mM. Six combinations of three phosphate sources (KH2PO4, K2HPO4, Na2HPO4) were studied here (as shown in Table 2). They were added to the basic medium PA14 at a fixed molar concentration (calculated based on the molar concentration of the combination of KH2PO4 and Na2HPO4 in the basic medium first tested): 0.1M. The effects of various nitrogen and phosphorus sources were tested using ethanol as a carbon source. The experiment was carried out in a 125mL baffled flask containing 25mL of MSM medium (containing 2% glycerol) for 6 days with a stirring speed of 200rpm (Infors TM ). N-2-Hydroxyethylpiperazine-N-2-ethanesulfonic acid (HEPES) (200 mM) at pH 7 was added to the medium, and then at OD 600 =0.05. Rhamnolipids were quantitatively analyzed at the last point. The experiment was repeated twice and a one-way ANOVA was performed.

[0074] (ANOVA) was performed to evaluate the significance of each nitrogen or phosphorus source on rhamnolipid production at a statistical confidence level of 95%. Table 2 : Phosphate concentrations used for different test combinations

[0075]

[0076] Cultured at 30°C for 5 days in PA14 medium containing a fixed concentration of EtOH (0.8M) under stirring at 200rpm. Nitrogen sources were added at 20mM except for peptone, which was added at an industrial standard concentration (5g / L). Phosphorus sources were added as shown in Table 2. Statistical differences were determined using ANOVA and Duncan's multiple range test. Different lowercase letters indicate statistically significant differences (p<0.05). Results marked with the same letter did not find statistical differences. Results marked with different letters found significant differences. Error bars represent standard errors of the mean (n=4).

[0077] Fig. 7A and Figure 7BResults of a preliminary screening of various nitrogen and phosphorus sources are shown. Of the six nitrogen sources tested, significant differences in rhamnolipid production were observed when cultures were grown using NaNO3 ( Fig. 7A ). However, surprisingly, the cultures tested with urea performed poorly, considering that urea is the optimal nitrogen source for rhamnolipid production in B. glumae. Regarding phosphate buffer composition, none of the six combinations tested had a significant effect on rhamnolipid production ( Figure 7B ).

[0078] Based on these observations, NaNO3 and phosphate combination 3 were selected for the next experiments. Under non-optimized conditions, the yield value of rhamnolipids was 230 ppm. The Taguchi experimental plan used a set of fractional factorial designs (fractional factorialdesign), consisting of orthogonal arrays, focusing on the estimation of main effects. Experimental design using orthogonal arrays greatly reduces the number of experiments to be performed. In this study, Taguchi tables were used, more specifically the L16 design, which enables the study of up to 15 parameters through 16 runs, including some interaction studies ( Figure 8 ). For each factor, two values ​​can be evaluated. There are multiple configurations for L16 Taguchi design. In this model, each number corresponds to an effect. More precisely, the numbers above or below the line actually represent the interaction between the two factors corresponding to the numbers on either side of the line. For example, factor 3 gives the response of the interaction between factors 1 and 2. The distribution of these factors is to minimize the probability of interaction between the factors. Based on this strategy, these factors are summarized in Table 3 below.

[0079] Table 3 : Taguchi parameter

[0080] factor Distribution Number HEPES 1 carbon 2 HEPES / Carbon 3 <![CDATA[NaNO3]]> 4 <![CDATA[HEPES / NaNO3]]> 5 <![CDATA[Carbon / NaNO3]]> 6 <![CDATA[MgSO4 / Phosphate]]> 7 <![CDATA[MgSO4]]> 8 <![CDATA[HEPES / MgSO4]]> 9 TES 10 HEPES / TES 11 <![CDATA[CaCl2]]> 12 Yeast Extract (YE) 13 HEPES / Phosphate 14 Phosphate 15

[0081] For the Burkholderia thailandica E264 strain, 16 runs were performed as described below (Table 4).

[0082] Table 4 :Experimental design of Taguchi table (“-” = not present; “+” = present)

[0083]

[0084]

[0085] Level average analysis is one of the techniques used to explore the results of the Taguchi method: determine the average effect of each factor on the experimental results. Thus, determine the factor with the strongest effect.

[0086] The following formula shows how to calculate the average effect of an experiment:

[0087] T=(Y1+Y2+…+Y n ) / n

[0088] Where Y1 = result of the first experiment, Y2 = result of the second experiment, T represents the overall mean of the experiments, and n is the number of times the experiment was run.

[0089] For example, for the calculation of the effect of two values ​​of factor A, A1 and A2 represent the average effect of factor A on levels 1 and 2, respectively. The following equation can evaluate the effect of each level.

[0090] A1=(Y1+Y2+…+Y8) / 8

[0091] A2=(Y9+Y 10 +…+Y 16 ) / 8

[0092] For each factor, the relative effect (ΔX) is calculated as the difference between the highest and lowest mean responses for each level. In this way, the effects of all factors can be identified, thereby determining the factor with the largest effect. Fig. 9 The experimental design of 16 runs performed at two levels for each factor and the mean values ​​(± standard deviation) of the responses of three replicates are shown. 16 runs were performed over 5 days at 30°C with stirring at 200 rpm. Statistical differences were determined using ANOVA and Duncan's multiple range test. Different lowercase letters indicate statistically significant differences (p < 0.05). Error bars indicate standard errors of the mean (n = 3).

[0093] The data set of responses for rhamnolipid production was explored to determine the optimal operating conditions. Based on the responses obtained for each run, the effect of each factor was calculated according to the horizontal average analysis. The average value for all runs was 245 ppm. Detailed results describing the effect of each factor are listed in Table 5.

[0094] The first observation that can be made here is that pH is important for rhamnolipid production in the case of Burkholderia thailandensis E264. In fact, when 200 mM HEPES buffer was added to the culture medium (resulting in a stable pH of 7.00 during the culture), rhamnolipid production increased.

[0095] The concentration of the carbon source also had an effect, as the production of rhamnolipids was higher when B. thailandensis was cultured with 0.8 M ethanol instead of 0.4 M ethanol. Ethanol has been used as a feedstock for rhamnolipid production in P. aeruginosa, enabling better rhamnolipid production compared to other substrates such as glycerol, rapeseed oil or glucose. It was desirable to evaluate whether ethanol could be a better substrate to increase rhamnolipid production, as it can be used as a defoaming agent and therefore represents an advantage for the implementation of industrial-scale biosurfactant production processes.

[0096] The addition of yeast extract to the medium does not play a significant role in the biosynthesis of rhamnolipids. The use of yeast extract as a nitrogen source has been studied in Pseudomonas aeruginosa and resulted in a reduction in the production of rhamnolipids. It is desirable to test the addition of yeast extract to shorten the lag phase in cultures carried out in minimal medium. Since this does not appear to affect the production of rhamnolipids, the use of small concentrations of yeast extract is contemplated.

[0097] On the other hand, the addition of trace element solution promoted production. Interestingly, the opposite effect was observed in Burkholderia glumae. In fact, a recent study showed that trace elements (metal ions) positively affect bacterial growth but prevent rhamnolipid biosynthesis (Nickzad et al., 2018).

[0098] Then, limitation of NaNO3, CaCl2 and phosphate promoted the rhamnolipid pathway, as better results were obtained at low levels corresponding to these factors. Unexpectedly, the present results showed that higher concentrations of MgSO4 enabled better rhamnolipid production by B. thailandensis. In contrast, optimization work on rhamnolipid production in B. glumae showed that MgSO4 did not affect biosurfactant synthesis (Nickzad et al., 2018).

[0099] Table 5 :Effects of various factors in L16 design on rhamnolipid production by Burkholderia thailandensis E264

[0100] HEPES carbon NaNO3 MgSO4 TES CaCl2 YE phosphorus Level 1 -33.73 -77.25 15.92 -48.94 -78.58 20.07 -5.61 98.3 Level 2 33.73 77.25 -15.92 48.94 57.75 -20.07 5.61 12.59

[0101] Unfortunately, judging by the effects attributable to other columns of the matrix, it appears that there are some significant interactions between the factors in this model (Table 6). In fact, if no interactions were detected, the correlation values ​​for each column would be close to zero. Instead, major interactions were observed for columns 3 (HEPES / Carbon), 5 (HEPES / NaNO3), 6 (Carbon / NaNO3), and 7 (MgSO4 / Phosphate).

[0102] Table 6: Effects associated with the factors corresponding to the interactions in the selected Taguchi design.

[0103] List 3 5 6 7 9 11 14 Level 1 -43.29 -30.44 -69.73 51.18 14.35 -13.45 9.58 Level 2 43.29 30.44 47.79 -51.18 -14.35 13.45 -9.58

[0104] After determining the effect of each factor on rhamnolipid production, their combined effect was calculated because in the Taguchi method, the effects of each factor are cumulative. In this way, a new experiment was designed based on the results generated by the L16 table. This experiment was conducted to verify the model based on the hypothesis.

[0105] The optimal level of each factor was chosen and theoretical values ​​are given based on the fact that the individual effects are cumulative in this type of experiment. The bold values ​​in Table 7 indicate the level of each factor that resulted in an increase in rhamnolipid production.

[0106] Table 7 : Combinations to optimize rhamnolipid production

[0107] HEPES EtOH <![CDATA[NaNO3]]> <![CDATA[MgSO4]]> TES <![CDATA[CaCl2]]> YE phosphorus Level 1 -33.73 -77.25 <![CDATA[ 15.92 ]]> -48.94 -78.58 <![CDATA[ 20.07 ]]> -5.61 <![CDATA[ 98.3 ]]> Level 2 <![CDATA[ 33.73 ]]> <![CDATA[ 77.25 ]]> -15.92 <![CDATA[ 48.94 ]]> <![CDATA[ 57.75 ]]> -20.07 <![CDATA[ 5.61 ]]> 12.59

[0108] To validate the experimentally determined optimization results, shake flask experiments were performed under the optimal culture conditions (Table 7) and the rhamnolipid production was determined. The observed experimental values ​​(average of three replicates) and the values ​​predicted by the model equation are listed in Table 8. The validation run failed to reach the predicted values ​​for rhamnolipid production, indicating some interaction between the factors. However, the implementation of the Taguchi table (more precisely the L16 table) showed that the approach was valid, as higher rhamnolipid production values ​​were obtained compared to the initial conditions studied.

[0109] Table 8 : Experimental values ​​for rhamnolipid production

[0110] response Value before optimization Predicted value Average experimental value RL(ppm) 230 817.15 557.52

[0111] Example 3: Optimization of Sophorolipid Production

[0112] The production of sophorolipids depends on the presence of sugars and fatty acids as raw materials for yeast. The culture medium used contained 100 g / L glucose, 10% (v / v) oil, 5 g / L yeast extract, 0.7 g / L peptone, and 0.7 g / L salt. A variety of raw materials were tested, and the production of sophorolipids was confirmed when whey, glycerol, and waste cooking oil were used to culture Bombus vesicularis ATCC 22214. Whey is a waste product from the dairy industry and contains a large amount of lactose. Structurally, lactose is a sugar consisting of one glucose unit and one galactose unit. Pretreatment of lactose with a specific enzyme called lactase can release the glucose unit. Subsequently, the yeast Bombus vesicularis vesicularis can use glucose and / or galactose as raw materials. Glycerol is a byproduct of fermentation to produce bioethanol and can also be considered as a potential raw material for the production of sophorolipids. Glycerol can improve the acidic form of sophorolipids.

[0113] The flask tests revealed the potential of the three feedstocks for sophorolipid (SPL) biosynthesis as described in the table below. The SPL yield was determined gravimetrically.

[0114] Table 9 :SPL output results:

[0115] raw material SPL production in flask (g / L) Pre-treated whey + waste cooking oil 5.97 Pure glycerin + waste cooking oil 35.4 Pure glucose + waste cooking oil 33.9

[0116] The effect of initial pH was evaluated by comparing cultures with a fixed initial pH of 4 or 6.5. The results showed that adjusting the pH to 4 at the beginning of the culture resulted in better sophorolipid production. This result was first obtained in flasks and then confirmed in bioreactors. These tests were implemented using glucose (100 g / L) and waste cooking oil (10%) as feedstocks and are summarized in Table 10.

[0117] Table 10 : Results of pH optimization

[0118] Adjust to pH 4.5 Unadjusted pH Cultures in flasks 18.9g / L 14.2g / L Cultures in bioreactors 162g / L 116g / L

[0119] Example 4: Bombus spp. DIS4

[0120] Approximately 50 bumble bees (Bombus impatiens) were collected (from Ontario and Quebec, Canada) during May / June 2022. Bumble bees were then frozen, thawed, and crushed into phosphate-buffered saline (PBS) solution buffer. Different solution stocks were stored in 30% glycerol (v / v) at -80°C. Different volumes of extraction solutions were placed in 239×239 cm 2In a culture dish, the culture dish contains all water-soluble nutrients for the production of sophorolipids and is supplemented with chloramphenicol antibiotics (final concentration of 33 μg / mL) to inhibit bacterial growth. After three days of growth, the evaporation test was performed using the atomized mineral oil assay (as described in Burch et al., 2010), with some improvements (addition of Sudan red). Sudan red was added to the mineral oil to provide better contrast (500 mg / 100 mL). The appearance of a halo around the colony indicates the production of sophorolipids (the halo is caused by the amphiphilic nature of the surfactant); the diameter of the halo was measured and compared with the Bombus stamina 22214 ATCC control strain. All colonies that produce halos are isolated, cultured and re-inoculated for the second oil evaporation verification test.

[0121] The genomic DNA of the strain was also extracted to identify the nature of the strain species. The D1 / D2 domain region of the large subunit (16S) of rDNA was amplified by polymerase chain reaction using NL (SEQ ID No.11: GCATATCAATAAGCGGAGGAAAAG) / NL4 (SEQ ID No.12: GGTCCGTGTTTCAAGACGG) primers using standard Taq DNA polymerase (New Englands Biolabs). The PCR program was: 95°C, 30 seconds, 95°C, 30 seconds for 30 cycles; 50°C, 1 minute, then 68°C, 1 minute, and finally 68°C, 5 minutes. After the PCR reaction, the product was verified on agarose gel and stained with MicroElute TM PCR clean-up kit (Favorgen TM ) were purified. The D1 / D2 PCR products were sequenced by Sanger (Genome Quebec). All obtained sequences were identical to the D1 / D2 subunits of the Bombus spp. Starmerella 22214 ATCC strain and therefore belonged to the Starmerella clade. The strains showing the highest sophorolipid production (growth rate comparable to the ATCC strains) were selected for whole genome next generation sequencing using Illumina sequencing technology (Seqcenter). TM The sequence was analyzed using Prime software and compared with 16 consecutive sequences of the reference ATCC 22214 strain, with the alignment identity ranging from 98.6% to 91.2%. The selected strain was named DIS4.

[0122] Example 5: Production of sophorolipids using waste frying oil

[0123] Three flask assays were performed in 125 mL baffled flasks (25 mL working volume) to test and compare pure rapeseed oil (Oil 1 = pure rapeseed oil as control) with eight different waste cooking oils (Oil 2 to 9), which were a mixture of different waste frying oils obtained from a local restaurant (Quebec, Canada), mainly containing rapeseed oil. For each condition, pure glucose (100 g / L), commercial yeast extract (5 g / L) and a salt mixture containing KH2PO4 (1 g / L), MgSO4.7H2O (0.5 g / L), CaCl2.2H2O (0.1 g / L) and NaCl (0.1 g / L) were used for testing in flasks. Before adding the different oils, the pH was also adjusted to 4 (addition of 2 M HCl solution). For each assay, the different oil sources were added at the beginning of the culture at a final 10% (v / v) concentration. All flasks were tested at OD i,600nm = 0.1 inoculation, starting from an overnight preculture of Bombus spp. Starmosaccharomyces cerevisiae and incubated at 30°C with constant shaking (200 RPM) for seven consecutive days.

[0124] like FIG. 10A to FIG. 10C As shown, it was unexpectedly found that waste frying oil outperformed pure rapeseed oil. Fig. 10A ), the yield and relative productivity of sophorolipids ( FIG. 10B to FIG. 10C ) is higher. Therefore, deep-frying oils, besides being an attractive economic and environmental option, have been shown to enhance biosurfactant productivity.

[0125] Example 6: Use of maple syrup waste as a carbon source in fermentation

[0126] Waste maple syrup was collected from the "Association des Producteurs et Productrices des acéricoles du Québec" and is declassified maple syrup (not suitable for consumption). Three flask assays were repeated in 125 mL baffled flasks (25 mL working volume) to test the comparison between waste maple syrup and table sugar (sucrose) because maple syrup has a high sucrose content (about 80% sucrose). As a control, table sugar (food grade) was used as the sugar source. For each condition, the test in the flask was performed using 10% v / v of waste frying oil, commercial yeast extract (5 g / L) and a salt mixture containing KH2PO4 (1 g / L), MgSO4.7H2O (0.5 g / L), CaCl2.2H2O (0.1 g / L) and NaCl (0.1 g / L). The pH was also adjusted to 4 (by adding 2 M HCl solution) before adding the oil. All flasks were heated at OD i,600nm= 0.1, starting from an overnight preculture of Bombus staminosus DIS4, and cultured at 30°C with continuous shaking (200 RPM) for seven consecutive days.

[0127] like FIG. 11A to FIG. 11C As shown, waste maple syrup proved to be a good alternative for cultivating microorganisms, even though the yield and productivity were slightly reduced compared to the control.

[0128] Example 7: Use of brewery waste as a nitrogen source for the production of sophorolipids

[0129] Yeast extracts are sold in the market in the form of powders, liquids or pastes. They are usually obtained from bakery yeast or spent brewer's yeast (mostly Saccharomyces cerevisiae) by yeast autolysis. In order to use alternative raw materials, people look for alternative sources of yeast extract. Several tests have been conducted, showing that spent brewer's yeast can be used as a suitable alternative nitrogen source in this fermentation process.

[0130] Waste brewery yeasts are available in large quantities and are usually discarded by wine manufacturers after several fermentation cycles. Although they represent a suitable raw material, meaning that they are relatively abundant and cheap, they also contain undesirable components consisting of hop resins and acids produced by wine fermentation and beer solids, which prevent the yeast from growing properly. Therefore, an optimized pretreatment method was developed to eliminate the bitterness of waste brewery yeast and produce yeast extract powder. Waste brewery yeast was collected as yeast paste, centrifuged (11000g-10 minutes-4°C) to remove beer liquid, resuspended in distilled water, and adjusted to pH 9 with NaOH solution for debittering process. The solution was stirred at 4°C for 30 minutes, centrifuged and washed several times with distilled water until the pH became neutral (usually three washing cycles were performed until the pH dropped to 7.7 to 7.5). The debittered yeast paste was then resuspended in 15% w / v distilled water and the pH was adjusted to 5.5, and then the solution was autolyzed at 55°C for 48 hours under continuous shaking (150 to 180RPM). After two days, the hydrolysate was boiled at 100°C for 5 minutes to stop the autolysis reaction. A final centrifugation step (11,000g-10 minutes-4°C) was performed to collect the supernatant, which contains all water-soluble components, including free amino acids, peptides, nucleotides, minerals and vitamins (the exact composition is unknown). Finally, the concentrate was spray-dried and the resulting yeast extract powder was weighed out and used as an alternative source of yeast extract. Three flask assays were performed on brewery yeast extracts from two different sources and compared with commercially available yeast extracts. These tests were performed using glucose (100 g / L) and waste frying oil (10%) as well as 5 g / L yeast extract 1 (YE 1=commercial yeast extract) and yeast extract 2 or 3 (brewery yeast extract) as raw materials.

[0131] like FIG. 12A to FIG. 12C As shown, although brewery yeast reduced cell growth and resulted in relative cell dry weight, brewery yeast maintained similar sophorolipid production, thus achieving improved productivity. In addition, it was found that the biosurfactant production curve ( Fig.13A ) and the biosurfactant production curve of the test waste yeast extract ( Fig. 13B )resemblance.

[0132] Example 8: Effect of inoculation amount on sophorolipid yield

[0133] The effect of inoculum size on growth and sophorolipid production was evaluated. Several ODs were set at the beginning of fermentation: 0.05, 0.1, 0.2 and 0.5. Growth was evaluated by cell dry weight, and sophorolipid production was measured by weighing the product after the extraction and evaporation process. Fermentation used 10% v / v frying oil and 100g / L pure glucose as carbon source.

[0134] from FIG. 14A to FIG. 14C As can be seen, a lower OD (e.g. 0.05) provides more growth than 0.5 ( Fig.14A The improvement in growth was accompanied by an increase in yield and similar productivity ( FIG. 14B to FIG. 14C ).

[0135] Example 9: Ethanol as an extraction solvent for biosurfactants

[0136] Three fermentation bottles were obtained from the fermentation, containing about 23 to 24 mL of fermentation broth, which were labeled F1, F2, and F2, respectively.

[0137] Distilled water was added to the fermentation flasks to bring the different media back to 25 mL (original starting volume), and the reactions were stopped by adding 3 volumes of ethanol to each flask (in this case, 75 mL of reagent grade ethanol was added to each flask).

[0138] Then, the fermentation broth and ethanol were vigorously mixed in a ratio of 1:3 by volume. Yeast was removed by centrifuging the mixture at 4000 rpm for 10 minutes, and the clarified supernatant was analyzed by high performance liquid chromatography (HPLC). Ethanol and water were removed from the supernatant by vacuum distillation (100 mbar pressure at 37°C; it was observed that the vacuum required to remove ethanol was slightly lower than that required when ethyl acetate was used because the boiling point of ethanol was 58°C).

[0139] The residue is suspended in twice the volume of ethanol and filtered to remove polar components such as salt and sugar. The clarified permeate is analyzed by reversed-phase HPLC. Then, the solvent is removed by vacuum distillation, and the residue is weighed. The composition (Table 11) of the residue is determined using the relative peak area of ​​the corresponding chromatogram.

[0140] CaCl2 was used to aid in the precipitation of oleic acid. CaCl2 was added and incubated in a flask at ambient conditions for three days. No precipitation was observed. The pH was lowered with acetic acid and some white precipitate particles were observed in F3.

[0141] Table 11 : Three fermentation bottles (F1, F2 and F3).

[0142]

[0143] It should therefore be seen that the embodiments described and illustrated above are by way of example only. The scope is indicated by the following claims.

[0144] References:

[0145] AbdeI-Mawgoud,A.M.,Lépine,F.,&Deziel,E.(2014).A stereospecificpathway divertsβ-oxidation intermediates to the biosynthesis of rhamnolipidbiosurfactants.Chemistry&biology,21(1),156-164.

[0146] Alexis,J.(1995).Pratique industrielle de la méthode Taguchk / es plansd'exp6rience.Afnor.

[0147] Burch,A.Y.,Shimada,B.K.,Browne,P.J.,&Lindow,S.E.(2010).Novel high-throughput detection method to assess bacterial surfactant production.Appliedand environmental microbiology,76(16),5363-5372.

[0148] Funston,S.J.,Tsaousi,K.,Rudden,M.,Smyth,T.J.,Stevenson,P.S.,Marchant,R.,&Banat,I.M.(2016).Characterising rhamnolipid production in Burkholderiathaliandensis E264,a non-pathogenic producer.Applied Microbiology andBiotechnology,100(18),7945-7956.

[0149] Gibson,D.G.,Young,L.,Chuang,R.Y.,Venter,J.C.,Hutchison III,C.A,&Smith,H.O.(2009).Enzymatic assembly of DNA molecules up to several hundredkliobases.Nature methods,6(5),343-345.

[0150] Martinez,S.,Humery,A.,Groleau,M.C.,&Déziel,E.(2020).Quorum sensingcontrols both rhamnolipid and polyhydroxyalkanoate production in Burkholderiathaliandensis Through scmr regulation.Frontiers in bioengineering andbiotechnology,1033.

[0151] Morsi,H.,Yong,K.L.,&Jewell,A.P.(2004,December).Evaluation of theTaguchi methods for the simultaneous assessment of the effects of multiplevariables in the tumour microenvironment.In International Seminars inSurgical Oncology(Vol.1,No.1,pp.1-9).BioMed Central.

[0152] Nickzad,A.,Guertin,C.,&Déziel,E.(2018).Culture medium optimizationfor production of rhamnolipids by Burkholderia glumae.Colloids andInterfaces,2(4),49.

[0153] Smith,D.D.,Nickzad,A.,Déziel,E.,&Stavrinides,J.(2016).A novelglycolipid biosurfactant confers grazing resistance upon Pantoea ananatisBRT175 against the social amoeba Dictyostelium discoideum.Msphere,1(1),e00075-15.

Claims

1. A Burkholderia thailandensis DIS2 bacterium deposited with IDAC under accession number 240222-01, a mutant or variant thereof.

2. A bacterium, a mutant or a variant thereof having all the identifying characteristics of Burkholderia thailandensis DIS2 deposited with IDAC under accession number 240222-01.

3. A Burkholderia thailandica DIS2.1 bacterium deposited with IDAC under accession number 070323-01, a mutant or variant thereof.

4. A bacterium, a mutant or a variant thereof having all the identifying characteristics of Burkholderia thailandensis DIS2.1 deposited with IDAC under accession number 070323-01.

5. A Starmerella bombicola DIS4 yeast deposited with IDAC under accession number 210223-01, a mutant or variant thereof.

6. A yeast, mutant or variant thereof having all the identifying characteristics of Bombyx mossava DIS4 deposited with IDAC under accession number 210223-01.

7. A method for producing rhamnolipid, wherein the method comprises: Fermentation is performed using Burkholderia thailandensis, mutants or variants thereof, wherein the fermentation is performed using a feedstock comprising a waste carbon source and frying oil.

8. The method of claim 7, wherein the waste carbon source is enzyme-treated, physically treated, thermally treated or untreated.

9. The method of claim 7 or 8, wherein the waste carbon source is selected from the group consisting of whey, glycerol, maple syrup waste and starch waste.

10. The process according to claims 7 to 9, wherein the feedstock further comprises ethanol.

11. The method according to claims 7 to 10, wherein the Burkholderia thailandensis is Burkholderia thailandensis DIS2 and / or Burkholderia thailandensis DIS2.

1.

12. The method according to any one of claims 7 to 11, wherein the frying edible oil is selected from the group consisting of frying corn oil, frying rapeseed oil, frying peanut oil, frying coconut oil, frying grapeseed oil, frying soybean oil, frying olive oil and frying cottonseed oil.

13. The method according to any one of claims 7 to 12, further comprising extracting the rhamnolipid from the fermentation culture medium by solvent extraction using an extraction solvent.

14. The method according to claim 13, wherein the extraction solvent is ethyl acetate or ethanol.

15. A method for producing a sophorolipid, wherein the method comprises: Fermentation is performed using Bombus spp. Stamosaccharomyces cerevisiae, mutants or variants thereof, wherein the fermentation is performed using a feedstock comprising a waste carbon source and frying oil.

16. The method of claim 15, wherein the waste carbon source is enzymatically treated, physically treated or thermally treated or untreated.

17. The method of claim 15 or 16, wherein the waste carbon source is selected from the group consisting of whey, glycerol, maple syrup waste and starch waste.

18. The method of claim 15, wherein the Bombyx mossop is ATCC 22214 or Bombyx mossop DIS4.

19. The method according to any one of claims 15 to 18, wherein the frying edible oil is selected from the group consisting of frying corn oil, frying rapeseed oil, frying peanut oil, frying coconut oil, frying grapeseed oil, frying soybean oil, frying olive oil and frying cottonseed oil.

20. The method according to any one of claims 15 to 19, further comprising extracting the sophorolipid from the fermentation culture medium by solvent extraction using an extraction solvent.

21. The method according to claim 20, wherein the extraction solvent is ethyl acetate or ethanol.

Images