Endogenous folic acid supplement and application thereof

Abstract

The invention relates to an endogenous folic acid supplement and application thereof. The folic acid supplement comprises xylooligosaccharide and Bacteroides xylans XB1A. The endogenous folic acid supplement can replace exogenous folic acid, so that the risk caused by direct intake of folic acid to a human body is avoided, and the endogenous folic acid supplement is safe.

Description

Technical Field

[0001] The present invention relates to the field of medicine, in particular to an endogenous folic acid supplement and application thereof. Background Art

[0002] As a kind of dietary fiber, xylooligosaccharides are widely found in Chinese herbal medicine and daily diet. They are difficult to be digested and absorbed by the human body's own enzymes, but they have attracted much attention because of their rich content in plants and their multiple biological activities. Studies have shown that the beneficial effects of xylan are directly related to the metabolism of intestinal flora, among which Bacteroides xylanolyticus has a high degradation activity on xylan. With the additional supplementation of para-aminobenzoic acid (a precursor for folic acid synthesis), Bacteroides xylanolyticus can synthesize folic acid. However, folic acid, as an essential trace element for the human body, cannot be synthesized by itself in the body and relies entirely on exogenous folic acid supplementation. Therefore, natural folic acid produced by intestinal flora may be a potential substitute for exogenous folic acid supplementation.

[0003] Folic acid is an essential trace element for the human body and plays a key auxiliary role in the one-carbon metabolism in the body. For example, the methylation of DNA, RNA, and protein, as well as the biosynthesis and functional maintenance of DNA, all rely on the participation of folic acid. However, mammals cannot synthesize folic acid in their bodies and can only rely on exogenous supplementation to maintain normal levels. Low folate status occurs when the folic acid content in the diet consumed in daily life is low, or the folic acid consumed cannot be absorbed, and some genetic defects or drug interference lead to abnormal folic acid metabolism. Studies have found that folic acid deficiency in pregnant women can affect the normal development of the fetus and may cause fetal growth retardation, premature birth, etc. Folic acid and the one-carbon metabolism in which it participates are also crucial for cancer. For example, high levels of folic acid intake can reduce the risk of lung cancer in men. Ensuring adequate folic acid intake can also prevent neuronal defects, anemia, and many other adverse health conditions, such as cardiovascular disease. In addition, a randomized, double-blind, placebo-controlled study showed that oral supplementation of 800 μg of folic acid per day for 3 years increased serum folate concentrations, reduced plasma total homocysteine ​​levels, and improved cognitive function. It can be seen that folic acid plays an irreplaceable and important role in host health.

[0004] Since the human body cannot synthesize folic acid, it can only be taken in through diet, exogenous supplementation, or synthesized by intestinal microorganisms. However, studies have found that excessive intake of folic acid synthesized in vitro can cause harm to the human body, such as increasing the risk of colorectal cancer. Therefore, natural sources of folic acid are safer to consume, but folic acid-containing foods such as vegetables can cause folic acid loss due to high temperatures during cooking, so research on folic acid synthesis by intestinal microorganisms is very necessary. At present, studies have found that folic acid-producing lactic acid bacteria colonizing in the intestine can produce folic acid to provide the host with folic acid needs, and folic acid synthesized by lactic acid bacteria is safer than directly ingesting synthetic folic acid. In addition, strains with the ability to produce folic acid include Lactococus lactis spp.cremoris CM 22 and Lactococus lactis spp.lactis CM 28. Strains with the ability to synthesize folic acid have also been found in Bifidobacterium, Streptococcus, and a few Lactobacilli. Qiao et al. found that Ganoderma lucidum monoterpene derivatives (GMD) alleviated fatty degeneration in NAFLD patients through the intestinal flora-folate-liver pathway. Among them, the four Bacteroides species enriched in the intestine, including BX, BT, Bacteroides dorei and Bacteroides uniformis, may be related to the increase of intestinal folate content. Summary of the invention

[0005] The technical purpose of the present application is to provide a folic acid supplement.

[0006] In one aspect, the present invention provides a folic acid supplement comprising xylo-oligosaccharide.

[0007] In a specific embodiment, the folate supplement further comprises Bacteroides xylanisolvens XB1A.

[0008] In a specific embodiment, in the folic acid supplement, the ratio of xylo-oligosaccharide to Bacteroides xylanolyticus XB1A is: 1-2 g xylo-oligosaccharide: 2×10 7 CFU of Bacteroides xylanisolvens XB1A. Those skilled in the art will understand that the ratio range values ​​of the above two components are proportionally enlarged or reduced, and are also within the protection scope of the present application.

[0009] In a specific embodiment, the folic acid supplement can be in the form of tablets, suspensions, capsules or granules.

[0010] In another aspect, the present invention provides use of xylo-oligosaccharide in preparing a folic acid supplement.

[0011] In another aspect, the present invention provides use of xylo-oligosaccharides and Bacteroides xylanisolvens XB1A in preparing a folic acid supplement.

[0012] Beneficial Effects

[0013] The folic acid supplement provided by the present application has the following advantages over the folic acid or folic acid supplements on the market:

[0014] 1. It avoids the risks to the human body caused by direct intake of folic acid, so it is safe.

[0015] 2. The combined use of xylooligosaccharides and Bacteroides xylanolyticus can increase the folate content in model mice, especially in the liver of mice, and has the potential to be developed into a folic acid supplement. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 :LC-MS detection of folic acid synthesis by human intestinal Bacteroides using oligoxylose.

[0017] Figure 2 : ELISA method was used to detect the folic acid content in mice treated with different doses of xylo-oligosaccharides (XO). (a) Folic acid content in mouse serum; (b) Folic acid content in mouse feces; (c) Folic acid content in mouse liver; (d) Folic acid content in mouse kidney.

[0018] Figure 3 :16S rRNA diversity sequencing analysis of changes in intestinal flora in mice treated with oligoxylose (XO) and prediction of metabolic function. (a) α-diversity analysis at the ASV level; (b) β-diversity analysis at the ASV level, Adonis test method; (c) β-diversity analysis at the ASV level, ANOSIM test method; (d) Venn diagram analysis; (e) phylum level community composition bar chart analysis; (f) genus level heat map analysis; (g) genus level comparison of two groups, analysis of differential species; (h) genus water LEfSe analysis of differential species; (i) PICRUST2 prediction of glycosidase; (j) PICRUST2 prediction of metabolism-related genes.

[0019] Figure 4:Detection of folate content in mouse tissues after antibiotic treatment (ELISA method) and analysis of changes in intestinal flora composition (16S rRNA diversity sequencing). (a) Detection of folate content in feces; (b) Detection of folate content in serum; (c) Detection of folate content in liver; (d) Detection of folate content in kidney; (ef) β-diversity analysis at the ASV level; (g) Column chart analysis of community composition at the phylum level; (h) Heat map analysis at the genus level; (i) Comparative analysis of different species between two groups at the genus level; (j) LEfSe analysis of different species at the genus level; (k) PICRUST2 prediction of glycosidases; (l) PICRUST2 prediction of metabolism-related genes.

[0020] Figure 5 :Metagenomic sequencing analysis of strains involved in folate synthesis and analysis of signaling pathways involved in folate synthesis. (a) Two-group comparison analysis of BX bacteria at the species level; (b) LEfSe analysis of BX bacteria at the species level; (c) β-diversity analysis using the CAZy database; (d) glycosidase analysis using two-group comparison; (e) LEfSe analysis of differential enzymes; (f) β-diversity analysis using the KEGG database; (g) Differential metabolic pathways analysis using two-group comparison; (h) LEfSe analysis of differential metabolic pathways.

[0021] Figure 6 : ELISA was used to detect the folic acid content in mouse feces, serum, liver and kidney.

[0022] Bacteroides xylanolyticus and oligoxylose were used to detect (a) the folate content in mouse feces; (b) the folate content in mouse serum; (c) the folate content in mouse liver; (d) the folate content in mouse kidney.

[0023] Mice treated with folic acid-deficient diets were tested for (e) folic acid content in mouse feces; (f) folic acid content in mouse serum; (g) folic acid content in mouse liver; (h) folic acid content in mouse kidney;

[0024] Mice treated with folic acid-enriched feed were tested for (i) folic acid content in mouse feces; (j) folic acid content in mouse serum; (k) folic acid content in mouse liver; and (l) folic acid content in mouse kidney. DETAILED DESCRIPTION

[0025] The technical solution of the present application is described in detail below through specific examples so that those skilled in the art can better understand the present application. However, it should be understood that these implementation modes are not intended to limit the scope of the present application.

[0026] Experimental methods:

[0027] (I) HPLC detection of folic acid content in vitro

[0028] 1. Sample preparation: Bacteroides xylanisolvens XB1A (BX, purchased from German Microbial Culture Collection DSMZ) or BX_Δfolp strain stored at -80°C was inoculated into fresh BHI medium containing 10% fetal bovine serum at 37°C in an anaerobic incubator for 24 h. 20 μL of the bacterial solution was inoculated into 2 mL of BHI medium containing 10% fetal bovine serum for passage. After washing with YCFA medium, 100 μL of the culture medium was used. The cells were resuspended in YCFA medium, and the OD600 value was measured after diluting 50 times. The OD600 value was diluted to ~0.4 with YCFA medium, and the diluted bacterial solution was co-cultured with xylooligosaccharides (XO, MacLean) or glucose with a final concentration of 0 mg / mL, 2.5 mg / mL, and 5 mg / mL, and p-aminobenzoic acid sodium salt (pABA) with a final concentration of 0 μg / mL, 15 μg / mL, and 30 μg / mL. PABA with a final concentration of 30 μg / mL was added to YCFA medium as a negative control, and the cells were cultured in an anaerobic incubator at 37°C for 40 h. After the culture, ultrasonic treatment was performed using an ultrasonic disruptor for 1 min (40% amplitude, 5 s on, 5 s off, 6 times), and the supernatant was collected by centrifugation at 12,000 rpm for 1 min. The supernatant was desalted once using a desalting column and freeze-dried using a freeze dryer. The freeze-dried product was dissolved in ultrapure water with 1 / 5 of the original volume before freeze-drying, and folic acid was analyzed using high performance liquid chromatography after passing through a 0.22 μM filter.

[0029] 2. Preparation of standard products: Use 0.05 mol / L KOH to prepare 5 mg / mL folic acid standard solution, dilute the 5 mg / mL folic acid standard solution with double distilled water to 500 μg / mL, 250 μg / mL, 100 μg / mL, 50 μg / mL, 20 μg / mL, 10 μg / mL, 4 μg / mL, 2 μg / mL, 0.8 μg / mL, and 0.4 μg / mL folic acid standard solutions, and filter through a 0.22 μM filter before analyzing folic acid using high performance liquid chromatography.

[0030] 3. Determination of folic acid by high performance liquid chromatography-mass spectrometry: 1) Turn on the computer, turn on the switch buttons of each module of the liquid mass spectrometer, install the chromatographic column (ACQUITY UPLC HSST3 column (1.7μm, 2.1×100mm ID), open the software, set the injection volume to 10μL, column temperature to 30°C, and flow rate to 0.3mL / min in the method group; mass spectrometry conditions: in ESI positive ion mode, select Sensitivity mode, and use MSE scanning method. Ion scanning range: 100-1000Da; scanning time: 0.5sec; Corn voltage: 25V; m / z: 442.1475. Mobile phase A: B methanol (0.1% formic acid)

[0031] Time (min) B％ curve 0 5 - 2 5 6 6 50 6 8 95 1 10 5 1

[0032] UV detector: wavelength is 210nm. The sampling time of a single sample is 25min. After setting, save the method group; 2) Use the corresponding mobile phase to clean the column, balance the column with mobile phase A, and start adding samples after the baseline is stable; 3) Detect the standard solution to be tested, the injection volume is 10μL, and folic acid can be separated within 25min; 4) Detect the sample solution to be tested, the injection volume is 10μL, and detect the peak area of ​​folic acid at the corresponding retention time.

[0033] 4. Data analysis: Mark the peak areas of the standards of different concentrations to draw the standard curve, then substitute the peak areas of the samples into the standard curve equation to calculate the corresponding concentration. Use Graphpad Prism 9.0 to draw the bar graph.

[0034] (II) ELISA to detect folic acid content in the body

[0035] Use folic acid ELISA kit for subsequent folic acid content detection. The experimental steps are as follows:

[0036] 1. Dilution of standard: dilute the original standard with the standard diluent in the kit in multiples to make the concentrations of 0.5μg / L, 1μg / L, 2μg / L, 4μg / L, and 8μg / L folic acid standard for later testing.

[0037] 2. Sample preparation: Take mouse serum, liver, kidney, and cecal feces for testing. The serum sample was diluted 5 times with sample diluent and loaded for testing. About 50 mg of liver, kidney, and cecal feces were weighed and added with 0.45 mL 1×PBS for grinding and homogenization. Centrifuge at 5000 rpm for 15-30 min and take the supernatant for testing.

[0038] 3. Set up blank wells (blank control wells do not add samples and enzyme-labeled reagents, and the rest of the steps are the same), standard wells, and sample wells to be tested. Accurately add 50μL of sample to the enzyme-labeled plate and gently shake to mix. Incubate at 37℃ for 30min. Take out and discard the liquid, spin dry, fill each well with washing solution, let it stand for 30s and then discard, repeat 5 times, and pat dry. Add 50μL of enzyme-labeled reagent to each well, except for the blank wells, incubate at 37℃ for 30min, and wash 5 times. First add 50μL of color developer A to each well, then add 50μL of color developer B, gently shake and mix, and color at 37℃ in the dark for 10min. Take out and add 50μL of stop solution, and use Bio-Tek microplate reader to measure the absorbance value of each well at a wavelength of 450nm.

[0039] 4. Data analysis: Draw a standard curve with the absorbance value of each concentration standard as the ordinate and the concentration as the abscissa. Substitute the sample absorbance value into the equation to calculate the sample concentration. Use Graphpad Prism 9.0 software to draw the graph.

[0040] Example 1: Production of folic acid by Bacteroides xylanisolans XB1A using xylooligosaccharides in vitro

[0041] Experimental Materials:

[0042] Bacteroides cellulosilyticus: purchased from Beijing Beina Chuanglian Biotechnology Research Institute (Beijing, China)

[0043] Bacteroides finegoldii: purchased from German Microbial Culture Collection DSMZ

[0044] Bacteroides thetaiotaomicron and Bacteroides ovatus: both purchased from ATCC.

[0045] Bacteroides cellulosilyticus (BC), Bacteroides finegoldii (BF), Bacteroides ovatus (BO), Bacteroides thetaiotaomicron (BT) and BX were co-cultured in YCFA medium with or without 5 mg / mL XO, and the folate content was detected by HPLC.

[0046] The results are as follows Figure 1 As shown, when XO was additionally supplemented, the folate production of BC, BF and BO decreased, while that of BT and BX increased, among which the folate production of BX increased significantly (p=0.0207).

[0047] Example 2: Effect of Xylo-oligosaccharides on Folic Acid Content in Mouse Serum, Liver and Kidney

[0048] C57 / BL6 male mice were gavaged with 250mg / kg, 500mg / kg, 1g / kg, and 2g / kg of XO continuously, and the mice were sacrificed after 4 weeks. The liver, kidney, cecum feces, and serum of the mice were collected for pretreatment and sample preparation, and the folic acid content was detected using a folic acid ELISA kit.

[0049] The results are as follows Figure 2 As shown in ad, it can be seen from the figure that except for the no significant change in the folic acid content in mouse feces, XO can significantly increase the folic acid content in mouse serum, liver, and kidney, and also increase the folic acid content in mouse cecum feces, and has a certain concentration dependence.

[0050] Example 3: Effect of Xylooligosaccharides on the Microbiota Composition of Mice

[0051] 16S rRNA diversity sequencing was used to further analyze the effect of XO on the composition of mouse microbiota.

[0052] The 16S rRNA diversity sequencing method is as follows:

[0053] 1. Extraction and detection of total DNA from mouse cecal feces

[0054] 1) Total DNA extraction

[0055] (a) Add 0.05 g of mouse cecal feces, 978 μL of Sodium Phosphate Buffer, and 122 μL of MT Buffer to a Lysing Matrix E tube;

[0056] (b) Oscillation in MP grinder for 40 s at a speed of 6 m / s;

[0057] (c) centrifugation at 14,000 rpm for 10 min;

[0058] (d) Transfer the supernatant to a 1.5 mL centrifuge tube, add 250 μL PPS, and mix well;

[0059] (e) Centrifuge at 14,000 rpm for 5 min at room temperature.

[0060] (f) Transfer the supernatant to a 2-mL tube containing 900 μL of Binding Matrix, mix well, and invert for 3 min.

[0061] (g) Centrifuge for 5 seconds and carefully discard the supernatant;

[0062] (h) Add 500 μL of 5.5 M guanidine thiocyanate solution, mix well, and transfer to the SPINTM Filter;

[0063] (i) Add 500 μL SEWS-M, centrifuge at 14,000 rpm for 1 min, discard the filtrate, and repeat the washing once;

[0064] (j) discard the liquid in the collection tube, centrifuge at 14,000 rpm for 3 min to remove the residual solution, and air dry for 3 min;

[0065] (k) Add 100 μL of DES eluent preheated at 55°C and let stand for 5 min;

[0066] (l) Centrifuge at 14,000 rpm for 2 min at room temperature, discard the SPINTM Filter, and obtain total DNA.

[0067] 2) DNA testing

[0068] Detection was performed using 1% agarose gel electrophoresis at a voltage of 5 V / cm for 20 min.

[0069] 2. PCR Amplification

[0070] Primers were designed for the 16S V3-V4 region and PCR amplification was performed. The reaction conditions for PCR amplification were denaturation at 95°C for 30 seconds, annealing temperature (Tm) of 55°C for 30 seconds, extension at 72°C for 45 seconds, and 30 cycles.

[0071] Table 3-1 Primer sequences used for diversity sequencing

[0072] Primers Sequence (5'→3') Upstream primer 338F ACTCCTACGGGAGGCAGCAG(SEQ ID No.:1) Downstream primer 806R GGACTACHVGGGTWTCTAAT(SEQ ID No.:2)

[0073] Table 3-2 PCR amplification system

[0074] Reagent name volume 5×FastPfu Buffer 4μL 2.5mM dNTPs 2μL Upstream primer (5 μM) 0.8μL Downstream primer (5 μM) 0.8μL FastPfu DNA Polymerase 0.4μL BSA 0.2μL DNA 10ng <![CDATA[ddH2O]]> Make up to 20 μL

[0075] 3. PCR product identification, purification and quantification

[0076] 1) PCR product identification

[0077] Each sample was replicated three times, and the PCR products of the three replicates were mixed and detected by 2% agarose gel electrophoresis.

[0078] 2) PCR product purification

[0079] PCR product purification uses PCR clean-up Kit, the specific process is as follows:

[0080] (a) Cut the agarose gel containing the target DNA under UV light, absorb the liquid on the surface of the gel with a paper towel and cut it into pieces. Calculate the weight of the gel;

[0081] (b) Add 500 μL of Gel Buffer M per 100-150 mg of gel into a 2 mL centrifuge tube. Place in a 75°C water bath for 5-10 min. Mix several times until the gel is completely melted.

[0082] (c) After the gel is completely melted, add 250 μL of Bind Buffer;

[0083] (d) Add 100 μL of magnetic beads, cover the tube, and mix using an electric vortexer. Mix once every 1 min for a total of 4 times.

[0084] (e) Place the centrifuge tube on the magnetic rack and let it stand for 1-2 minutes to ensure that the magnetic beads are adsorbed to the bottom of the centrifuge tube, and discard the supernatant;

[0085] (f) Add 500 μL Wash Buffer A, mix well with an electric vortexer, and let stand for 30 seconds. Place the centrifuge tube on a magnetic rack, and discard the supernatant after the solution becomes clear;

[0086] (g) Add 700 μL Wash Buffer B, mix well using an electric vortexer, let stand for 30 seconds, place the centrifuge tube on a magnetic rack, and discard the supernatant after the solution becomes clear;

[0087] (h) Place the centrifuge tube at 37-45°C and dry for 5-10 min until cracks appear on the surface of the magnetic beads;

[0088] (i) Add 50 μL of sterile water and mix well using an electric vortexer. Mix once every 1 min for a total of 4 times. Elute with Eluent solution preheated to 65°C to improve the elution efficiency of DNA;

[0089] (j) Place the centrifuge tube on the magnetic rack and let it stand for 1 min to ensure that the magnetic beads are adsorbed to the bottom of the centrifuge tube. Transfer the liquid in the centrifuge tube to a new centrifuge tube. The liquid in the centrifuge tube is the purified DNA, which can be used immediately or stored at -20°C for later use.

[0090] 3) PCR product quantification and normalization

[0091] The PCR products were analyzed by Quantus TM Fluorometer is used for detection and quantification. According to the sequencing amount requirements of each sample, the corresponding proportions are mixed.

[0092] 4. Construction of PE library and Illumina sequencing

[0093] 1) Miseq library construction

[0094] The NEXTFLEX Rapid DNA-Seq Kit was used to construct the library. The specific process is as follows:

[0095] (a) Connector connection;

[0096] (b) using magnetic bead screening to remove linker self-ligated fragments;

[0097] (c) enriching the library template by PCR amplification;

[0098] (d) PCR products are recovered using magnetic beads to obtain the final library.

[0099] 2) Illumina sequencing

[0100] Sequencing was performed using Illumina's PE300 / PE250 platform (Shanghai Meiji Biopharmaceutical Technology Co., Ltd.). The specific process is as follows:

[0101] (a) One end of the DNA fragment is complementary to the adapter base embedded in the chip and fixed on the chip;

[0102] (b) The other end is randomly complementary to another nearby embedded linker base and is also fixed to form a "bridge";

[0103] (c) PCR amplification to generate DNA clusters;

[0104] (d) DNA amplicon is linearized into single strand;

[0105] (e) Add modified DNA polymerase and 4 fluorescently labeled dNTPs, and synthesize only one base in each cycle;

[0106] (f) scanning the surface of the reaction plate with a laser to read the types of nucleotides polymerized in the first round of reaction for each template sequence;

[0107] (g) chemically cutting the "fluorescent group" and "termination group" to restore the 3' end stickiness and continue to polymerize the second nucleotide;

[0108] (h) Count the fluorescence signal results collected in each round to obtain the sequence of the template DNA fragment.

[0109] 5. Data Analysis

[0110] Based on the Sliva 16S rRNA gene database (v 138), the species taxonomy of ASVs was analyzed using the Naive Bayes (or Vsearch, or Blast) classifier in Qiime2. All data analyses were completed on the Meiji BioCloud platform.

[0111] The results of α-diversity analysis showed that the 500mg / kg XO treatment group was significantly different from the blank control and 250mg / kg group ( Figure 3 a); The results of β diversity analysis (intergroup difference test Adonis) showed that there was a significant difference between the blank control group and the oligoxylose treatment group (R2 = 0.3357, p = 0.002) ( Figure 3 b); When the inter-group difference test was performed using ANOSIM analysis, the results also showed that there was a significant difference between the blank control group and the oligoxylose treatment group (R = 0.3181, p = 0.001) ( Figure 3 c); Analysis of bacterial flora composition at the genus level, Venn diagram results showed that the species richness of the 500 mg / kg XO treatment group increased ( Figure 3 d); 4) The bacterial community composition was analyzed at the phylum level. The bar graph results showed that the abundance of Bacteroidetes increased in the 500 mg / kg XO treatment group ( Figure 3 e); The composition of the bacterial community was analyzed at the genus level, and the heat map results showed that Roseburia, Bacteroides, and Eubacterium_xylanophilum_group, which are related to xylan degradation, were significantly enriched ( Figure 3 f); The two groups were compared and analyzed at the genus level. The results showed that Roseburia and Eubacterium_xylanophilum_group were significantly enriched in the 500 mg / kg XO treatment group ( Figure 3 g); LefSe analysis results showed that Eubacterium_xylanophilum_group in the XO treatment group was significantly enriched; PICRUST2 prediction analysis showed that the XO treatment group was significantly enriched in xylan degradation enzymes and genes involved in one-carbon metabolism and folate synthesis ( Figure 3 h, 3i).

[0112] In summary, the above research results suggest that XO can significantly change the microbial composition of mice and can significantly enrich the bacterial genera related to xylan degradation.

[0113] Example 4: Effect of intestinal flora on folic acid content in mice

[0114] The intestinal flora was eliminated by mixing antibiotics in drinking water to investigate whether XO could promote folic acid synthesis under the condition of disordered intestinal flora.

[0115] Six-week-old mice were randomly divided into three groups: blank control group, XO treatment group, and antibiotic + XO treatment group. The control group was treated with 0.9% NaCl by intragastric administration, the XO treatment group was orally administered with 1 g / kg XO by intragastric administration, and the antibiotic + XO treatment group was given mixed antibiotics (erythromycin, gentamicin sulfate, gentamicin hydrochloride, penicillin sulfate, and ampicillin sodium) in drinking water and 1 g / kg XO by intragastric administration for 4 consecutive weeks.

[0116] The experimental results showed that after treatment with mixed antibiotic aqueous solution, even with XO supplementation, the folic acid content in serum, liver, and cecal feces was significantly reduced compared with the group treated with XO alone (p = 0.0123, p = 0.008, p = 0.0001), and the folic acid content in the kidney also showed a decreasing trend ( Figure 4 ad). On the contrary, compared with the blank control group, the folate content in the serum, liver and cecal feces of the mice in the XO treatment group was significantly increased (p = 0.004, p = 0.0034, p = 0.0081). In addition, the diversity sequencing results showed that: 1) PCA analysis showed that the microbiota composition of the three groups of mice was significantly different (p < 0.05) ( Figure 4 e); 2) PCoA analysis results also showed that there were significant differences among the three groups of mice (p<0.05) ( Figure 4 f); 3) The results of the community bar graph showed that the bacterial community composition of the antibiotic treatment group was significantly different from that of the untreated group, and the bacterial community of the antibiotic treatment group was mainly composed of Bacteroidetes and Proteobacteria ( Figure 4 g); 4) The community composition was analyzed at the genus level. The results of the community composition bar chart and heatmap chart showed that compared with the xylan treatment group, the bacterial community composition of the antibiotic treatment group had significant changes, and the xylanophilic Bacteroides and Roseburia genera decreased significantly ( Figure 4 h); 5) The two groups were compared and analyzed at the genus level. The results of the two-group comparison analysis and LEfSE difference comparison analysis showed that the Abs+XO group was significantly enriched in Bacteroides ( Figure 4 ij); 6) PICRUST2 functional prediction analysis showed that compared with the XO group, the Abs+XO group was significantly enriched in the abundance of arabinan endo-1,5-β-L-arabinosidase, β-1,4-endo-xylanase, and glucuronolactone-1,4-β-xylanase ( Figure 4 k), and the abundance of proline metabolism and nitrogen metabolism functions increased in the Abs+XO group ( Figure 4 i).

[0117] The above research results suggest that bacteria related to xylan metabolism may play an important role in folate synthesis, but it is not clear what effect the enriched Bacteroidetes in the antibiotic treatment group has on folate synthesis, and it is also unclear which specific strains have an effect on folate synthesis. Therefore, it is speculated that intestinal flora plays an important role in folate synthesis.

[0118] Example 5: Mechanism of xylooligosaccharides in promoting folic acid synthesis

[0119] In order to further explore the role of intestinal bacteria in folate synthesis, a metagenomic sequencing experiment was conducted to first construct the BX gene set, and then a correlation analysis was performed on the BX gene set.

[0120] Metagenomic Sequencing Methods:

[0121] 1. Extraction and detection of total DNA from mouse cecal feces

[0122] The experimental steps are the same as in Example 3.

[0123] 2. DNA fragmentation

[0124] The DNA was fragmented into approximately 400 bp fragments using a Covaris M220 ultrasonic disruptor.

[0125] 3. Construction of PE library

[0126] The experimental steps are the same as in Example 3.

[0127] 4. Bridge PCR and Sequencing

[0128] Metagenomic sequencing was performed using the Illumina NovaSeq sequencing platform (Shanghai Meiji Biopharmaceutical Technology Co., Ltd.). The specific process is as follows:

[0129] (1) One end of the library molecule is complementary to the primer base, and after one round of amplification, the template information is fixed on the chip;

[0130] (2) The other end of the molecule fixed on the chip is randomly complementary to another nearby primer and is also fixed to form a "bridge";

[0131] (3) PCR amplification to generate DNA clusters;

[0132] (4) DNA amplicon is linearized into a single strand;

[0133] (5) Add modified DNA polymerase and four fluorescently labeled dNTPs, synthesizing only one base in each cycle;

[0134] (6) Scanning the surface of the reaction plate with a laser to read the types of nucleotides polymerized in the first round of reaction for each template sequence;

[0135] (7) Chemically cleave the “fluorescent group” and “termination group” to restore the 3’ end stickiness and continue polymerizing the second nucleotide;

[0136] (8) Count the fluorescence signal results collected in each round to obtain the sequence of the template DNA fragment.

[0137] 5. Analytical methods

[0138] 1) Data quality control

[0139] (a) The adapter sequences at the 3' and 5' ends of the reads were quality-cut using the software fastp (version 0.20.0);

[0140] (b) The software fastp (version 0.20.0) was used to remove reads with a length less than 50 bp after shearing, an average base quality value less than 20, and N bases, and retain high-quality pair-end reads and single-end reads;

[0141] (c) The reads were aligned to the host DNA sequence using the software BWA (version 0.7.17), and contaminating reads with high alignment similarity were removed.

[0142] 2) Assembly

[0143] The optimized sequences were assembled using MEGAHIT (version 1.1.2), a software based on succinct de Bruijn graphs. Contigs with a length of ≥ 300 bp were selected as the final assembly results.

[0144] 3) Gene prediction

[0145] Prodigal (version 2.6.3) was used to predict ORFs for contigs in the splicing results. Genes with a nucleic acid length of ≥ 100 bp were selected and translated into amino acid sequences.

[0146] 4) Construction of non-redundant gene sets

[0147] CD-HIT (version 4.7) was used to cluster the gene sequences predicted by all samples (parameters: 90% identity, 90% coverage), and the longest gene in each cluster was taken as the representative sequence to construct a non-redundant gene set.

[0148] 5) Gene abundance calculation

[0149] SOAPaligner software (version soap2.21release) was used to align the high-quality reads of each sample with the non-redundant gene set (95% identity), and the abundance information of the genes in the corresponding samples was counted.

[0150] 6) Species and functional annotation

[0151] (a) Species taxonomic annotation

[0152] Diamond (version 2.0.13) was used to align the amino acid sequences of the non-redundant gene set with the NR database (the expected value e-value of the BLASTP alignment parameter was set to 1e-5), and the species annotation was obtained through the taxonomic information database corresponding to the NR database. The abundance of the species was then calculated using the sum of the gene abundances corresponding to the species.

[0153] (b) KEGG functional annotation

[0154] Diamond (version 2.0.13) was used to align the amino acid sequences of the non-redundant gene set with the KEGG database (BLASTP alignment parameter setting expected value e-value was 1e-5). The KEGG functions corresponding to the genes were obtained. The abundance of the corresponding functional categories was calculated using the sum of the gene abundances corresponding to KO, Pathway, EC, and Module.

[0155] (c) Annotation of carbohydrate-active enzymes

[0156] The corresponding tool HMMER (version 3.1b2) of the CAZy database was used to align the amino acid sequences of the non-redundant gene set with the CAZy database (the alignment parameter was set with the expected value e-value of 1e-5) to obtain the annotation information of the carbohydrate-active enzymes corresponding to the genes, and then the abundance of the carbohydrate-active enzymes was calculated using the sum of the gene abundances corresponding to the carbohydrate-active enzymes.

[0157] The results showed that: 1) Xylanolytic Bacteroides was significantly enriched in the XO group ( Figure 5 a); 2) KEGG pathway level 3 comparison and LEfSe analysis showed that the abundance of folate synthesis pathway in the XO group was significantly enriched (p<0.05) ( Figure 5 b&c); 3) CAZy analysis showed that the abundance of GH42, GH31, and GH5_21 in the XO group was significantly enriched ( Figure 4 d); 4) LEfSe analysis of the two groups of different carbohydrate enzymes showed that the abundance of the carbohydrate binding module CBM in the XO group was significantly enriched ( Figure 4e); Based on KEGG, the results of β diversity analysis showed that the XO treatment group was significantly different from the control group ( Figure 5 f); The comparative analysis results between the two groups showed that the folate synthesis signaling pathway was significantly enriched in the XO treatment group ( Figure 5 g); LEfSe analysis results also showed that the folate synthesis signaling pathway in the XO treatment group was significantly enriched ( Figure 5 h).

[0158] The above results suggest that Bacteroides xylanilyticus may be the key bacteria for folate synthesis.

[0159] Example 6: Effect of the combined use of Bacteroides xylanolyticus XB1A and xylooligosaccharides on the folic acid content in mice

[0160] Since the results of metagenomic sequencing suggest that BX may be a key strain for the synthesis of folate in the mouse intestinal flora, the effect of BX on folate synthesis in mice was further analyzed in this example, and the effect of the combination of BX and XO on folate synthesis in mice was explored.

[0161] C57 / BL6 mice were randomly divided into 4 groups: blank control group (control), BX treatment group, XO treatment group, BX+XO treatment group, and the dosage was 1g / kg / day for 4 consecutive weeks, and the mice were sacrificed after 4 weeks. The liver, kidney, cecal feces and serum of the mice were taken for pretreatment and sample preparation, and the folic acid content was detected by folic acid ELISA kit, among which, the liver, kidney and feces sample processing method was: 50 mg of the above samples were taken for ultrasonic treatment, centrifuged at 4℃5000rpm for 15-30min, and the supernatant was taken and stored in a centrifuge tube at -20℃.

[0162] The results showed that compared with the blank control group, the folate content in serum, liver, and cecal feces of the BX treatment group was significantly increased (p = 0.0438, p = 0.0106, p = 0.0246); in the XO treatment group, except for the significant increase in folate content in liver, there was no significant change in folate content in feces, serum, and kidney; the folate content in serum, liver, and kidney of the BX+XO treatment group was significantly increased (p = 0.0075, p = 0.0033, p = 0.0381), see for details. Figure 6 ad.

[0163] The above research results show that both BX and XO can promote a significant increase in folic acid content in mice, and the combined effect of the two is better, suggesting that the combination of XO and BX bacteria may have the potential to be synbiotics.

[0164] In order to further explore the changes in folate content in mice after combined treatment with BX and XO under folate deficiency, the mice were divided into five groups: blank control group (control), folate deficiency group (FD), and BX treatment group (FD+BX), XO treatment group (FD+XO), and BX+XO treatment group (FD+BX+XO) under folate deficiency. After 4 weeks of treatment, folate content was detected by ELISA.

[0165] Folate deficiency model construction:

[0166] The folic acid added to the normal feed of mice was completely removed, i.e., the folate deficiency (FD) feed. The 6-week-old mice were randomly divided into 5 groups: blank control group, FD group, FD+BX treatment group, FD+XO treatment group, and FD+BX+XO treatment group. Except for the blank control group, which was treated with 0.9% NaCl by oral gavage, the other groups were treated with the same oral gavage as above.

[0167] The results showed that the folate content in the liver and kidney of the folate deficiency group was reduced, but the folate content in serum and cecal feces was similar to that in the normal group. Under the folate deficiency state, compared with the folate deficiency group, the serum folate content in the BX treatment group increased significantly (p = 0.0321), the folate content in serum, liver, and kidney in the XO treatment group increased significantly (p = 0.0245, p = 0.0205, p < 0.0001), and the folate content in serum, cecal feces, liver, and kidney in the BX + XO treatment group increased significantly (p < 0.0001, p = 0.0140, p = 0.0188, p < 0.0001), see for details. Figure 6 Eh.

[0168] In summary, in the state of folic acid deficiency, the combination of BX and XO may provide the host with the amount of folic acid required.

[0169] In order to further confirm whether the combination of BX and XO can replace exogenous folic acid supplementation, mice were divided into 3 groups: blank control group (Control), high folic acid group (FR) (4 ppm folic acid monomer was supplemented in the mouse feed), and BX+XO treatment group (BX+Xylan). After 4 weeks of treatment, the folic acid content was detected using a folic acid ELISA kit.

[0170] The results showed that the combined use of BX+XO could significantly increase the folic acid content in the serum, cecal feces, liver and kidney of mice, among which the folic acid content in the liver was significantly higher than that in the folic acid enriched group of mice (p=0.0005). Figure 6 il, serum, cecal feces and kidney folate content were also similar to those of the folate-enriched group. This result shows that endogenous folic acid supplementation is more easily absorbed than exogenous folic acid, and the combination of BX and XO has the potential to be used as a folic acid supplement.

Claims

A folic acid supplement comprising xylo-oligosaccharides.

2. The folic acid supplement according to claim 1, wherein The folic acid supplement further comprises Bacteroides xylanisolvens XB1A.

3. The folic acid supplement according to claim 1, wherein In the folic acid supplement, the ratio of xylo-oligosaccharides to Bacteroides xylanolyticus XB1A is: 1-2 g xylo-oligosaccharides: 2×10 7 CFU of Bacteroides xylanisolvens XB1A.

4. The folic acid supplement according to claim 1, wherein The folic acid supplement is in the form of tablets, suspensions, capsules or granules.

5. Use of xylooligosaccharides in the preparation of folic acid supplements.

6. Use of xylo-oligosaccharides and Bacteroides xylanolyticus XB1A in the preparation of folic acid supplements.

Images