Application of ALKBH5 in preparation of medicine for promoting liver ischemia reperfusion injury repair

Abstract

The invention provides application of ALKBH5 and an agonist of the ALKBH5 in preparation of a medicine for promoting liver ischemia-reperfusion injury repair or preventing / treating / relieving liver ischemia-reperfusion injury, application of the ALKBH5 as a YTHDF1 agonist or a YAP agonist, and application of the ALKBH5 in preparation of the YTHDF1 agonist or the YAP agonist. The ALKBH5 is used for promoting the mRNA stability of the YTHDF1 and increasing the protein content of the YTHDF1 by reducing the m6A modification of the mRNA of the YTHDF1; the YTHDF1 specifically recognizes m6A modification of the YAP, so that the translation efficiency of the YAP is promoted, and the protein content of the YAP is increased; the ALKBH5 can be used for regulating the expression of the YTHDF1-YAP so as to relieve the liver cell injury caused by oxygen deficiency-oxygen enrichment. The invention discloses the key effect of the ALKBH5-m6A-YTHDF1-YAP axis in liver I / R injury and provides pharmaceutical application related to the ALKBH5-m6A-YTHDF1-YAP axis, and ALKBH5, YTHDF1 and YAP have important clinical value in the aspects of relieving liver cell death in the IRI process, promoting liver cell repair and regeneration and the like.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine, and specifically relates to the application of ALKBH5-m6A-YTHDF1-YAP axis in liver I / R injury. Background Art

[0002] Reperfusion after a period of ischemia not only fails to restore tissue and organ function, but aggravates the dysfunction and structural damage of tissues and organs. This phenomenon in which tissue damage is aggravated after blood flow is restored on the basis of ischemia, and even irreversible damage occurs, is called ischemia-reperfusion injury (IRI, I / R injury). The IRI process involves many complex events, including mitochondrial dysfunction, oxidative stress, and a series of immune inflammatory reactions.

[0003] There are many ways of RNA epigenetic modification discovered so far, such as 6 -methyladenine (N 6 -methyladenosine,m6A),N 1 -methyladenine (N 1 m6A is a common modification, which is a dynamic and reversible modification catalyzed by methyltransferases, demethylases and binding proteins. It has important regulatory functions and is involved in the pathological processes of various cellular processes and diseases. m6A modification is universal in mammals as a way to regulate messenger RNA (mRNA) and plays an important role in various biological processes. Typically, the m6A modification of mRNA is methylated by a methyltransferase complex (“writer”) and removed by a demethylase (“eraser”). In addition, the m6A mark of the target mRNA can be recognized by m6A binding proteins (“readers”) to regulate its translation. Human alkylation repair homolog 5 (ALKBH5) is an important m6A demethylase. Compared with other members of the same family, ALKBH5 is more specific in substrate selection and only catalyzes the removal of methyl groups on m6A, thereby affecting the splicing, stability and translation of mRNA, thereby dynamically and reversibly regulating gene expression.

[0004] Recent studies have revealed the regulatory effects of ALKBH5 on different organs.

[0005] ALKBH5 mitigates IRI-induced cardiomyocyte apoptosis by promoting the stability of SIRT1 (Liu, Liangliang, and Zhen Liu. “m6A eraser ALKBH5 mitigates the apoptosis of cardiomyocytes in ischemia reperfusion injury through m6A / SIRT1 axis.” Peer J vol. 11 e15269. 11 May. 2023, doi: 10.7717 / peerj.15269). Similarly, during myocardial infarction, ALKBH5 inhibits m6A methylation of MG53 and inhibits MG53 degradation to inhibit cardiomyocyte apoptosis (Li D, Li L, Dong S, YuY, Zhang L, Jiang S. Alkylation Repair Homolog 5 Regulates N(6)-methyladenosine(m6A)Methylation of Mitsugumin 53to Attenuate Myocardial Infarction byInhibiting Apoptosis and Oxidative Stress. J Cardiovasc Pharmacol 2024;83:183-192.). ALKBH5 regulates cardiomyocyte proliferation and heart regeneration by demethylating the mRNA of YTHDF1 (Han, Zhenbo et al. "ALKBH5 regulates cardiomyocyte proliferation and heart regeneration by demethylating the mRNA of YTHDF1." Theranostics vol. 11, 63000-3016.1 Jan. 2021, doi: 10.7150 / thno.47354). Interestingly, Chen Juntao et al. found that in the renal IRI model, ALKBH5 knockout mice had milder pathological damage and better renal function after IRI compared with wild-type mice, while the opposite was true for ALKBH5 knock-in mice. In addition, knocking out ALKBH5 in tubular epithelial cells can reduce ischemia-reperfusion (I / R)-induced acute kidney injury (AKI) and fibrosis.That is, for the kidneys, ALKBH5 exacerbated IRI-induced renal injury (Chen, Juntao et al. “Inhibition of ALKBH5 attenuates I / R-induced renal injury in male mice by promoting Ccl28 m6A modification and increasing Treg recruitment.” Nature communications vol. 14, 11161.1Mar. 2023, doi: 10.1038 / s41467-023-36747-y).

[0006] Liver IRI is a major complication after liver surgery, liver transplantation and severe trauma. During the process of liver IRI, a large number of hepatocytes are damaged, accompanied by impaired hepatocyte regeneration, which in turn leads to liver function damage and even liver failure, which is an important cause of serious complications and even death in patients during surgery. However, there are currently no definite and effective preventive measures for liver IRI in clinical practice. Therefore, finding effective targets to reduce hepatocyte death during IRI and promote hepatocyte repair and regeneration is of great scientific significance and clinical value. Summary of the invention

[0007] As an important m6A demethylase, ALKBH5 has a complex mechanism of action in regulating biological physiological functions, tissue and organ regeneration, and functional recovery. The regulatory effects of ALKBH5 on different organs indicate that the various functions of ALKBH5 depend on different downstream targets in a cell type-dependent manner. What kind of regulatory role ALKBH5 can play in different tissues or organs after IRI occurs requires researchers to explore and discover through a series of rigorous scientific experiments.

[0008] Hepatocytes make up the majority of liver mass and provide most of the liver functions related to body homeostasis. Hepatocytes rarely proliferate during the quiescent phase, however, once the liver is exposed to certain specific stimuli, hepatocytes can acquire the proliferative potential to maintain organ function and sometimes restore their original size. Therefore, strategies to fine-tune the status of hepatocytes, such as inhibiting hepatocyte injury and cell death while promoting the reactivation of hepatocyte proliferation after injury, are particularly important.

[0009] The inventors found through experimental research that during the process of liver IRI, the expression of ALKBH5 protein in damaged hepatocytes was significantly reduced, while the m6A content of the overall RNA in hepatocytes increased; overexpression of ALKBH5 in mouse liver tissue mediated by adeno-associated virus (AAV) significantly alleviated liver ischemia-reperfusion injury. Mechanistically, under normal conditions, the m6A "eraser" ALKBH5 downregulates the methylation of the m6A "reader" YTHDF1 to promote the stability of YTHDF1 mRNA, and then YTHDF1 promotes the effective translation of YAP. In contrast, when stimulated by I / R, the reduction of ALKBH5 in hepatocytes is accompanied by a reduction in YTHDF1, resulting in lower levels of YAP content. In other words, the inventors revealed the key role of the ALKBH5–m6A–YTHDF1–YAP axis in the recovery of liver IRI. Specifically: (1) ALKBH5 reduces the m6A modification of YTHDF1 mRNA, thereby promoting the stability of YTHDF1 mRNA and increasing the content of YTHDF1 protein; YTHDF1 specifically recognizes the m6A modification of YAP, thereby promoting the translation efficiency of YAP and increasing the content of YAP protein; increased YAP protein expression promotes hepatocyte proliferation, enhances hepatocyte activity, and inhibits hepatocyte death. (2) The ALKBH5-m6A-YTHDF1-YAP axis plays an important regulatory role in the process of liver ischemia-reperfusion injury, and is expected to be a drug target to alleviate liver ischemia-reperfusion injury.

[0010] In view of this, the present application proposes the following technical solution.

[0011] Use of the ALKBH5 gene or protein in preparing a drug for promoting the repair of liver ischemia-reperfusion injury, or preventing / treating / alleviating liver ischemia-reperfusion injury.

[0012] Use of ALKBH5 agonists in the preparation of drugs for promoting the repair of liver ischemia-reperfusion injury, or preventing / treating / alleviating liver ischemia-reperfusion injury.

[0013] A method for promoting the repair of liver ischemia-reperfusion injury, or a method for preventing / treating / alleviating liver ischemia-reperfusion injury, characterized in that ALKBH5 protein or ALKBH5 agonist is administered to a patient.

[0014] A method for promoting the repair and regeneration of damaged hepatocytes or enhancing the proliferation activity of hepatocytes, characterized by administering an ALKBH5 protein or an ALKBH5 agonist.

[0015] A pharmaceutical composition for promoting the repair of liver ischemia-reperfusion injury, or a pharmaceutical composition for preventing / treating / alleviating liver ischemia-reperfusion injury, or a pharmaceutical composition for promoting the repair and regeneration of liver cell damage, or a pharmaceutical composition for enhancing the proliferation activity of liver cells, characterized in that the pharmaceutical composition contains ALKBH5 protein or ALKBH5 agonist.

[0016] Use of ALKBH5 protein or agonist in combination with YTHDF1 protein or agonist in the preparation of a drug for promoting the repair of liver ischemia-reperfusion injury, or preventing / treating / alleviating liver ischemia-reperfusion injury.

[0017] Use of ALKBH5 protein or agonist in combination with YAP protein or agonist in the preparation of a drug for promoting the repair of liver ischemia-reperfusion injury, or preventing / treating / alleviating liver ischemia-reperfusion injury.

[0018] As a preferred embodiment of the present application, the above-mentioned liver ischemia-reperfusion injury is caused by liver surgery, liver transplantation and severe trauma.

[0019] As a preferred embodiment of the present application, the above-mentioned pharmaceutical composition further includes one or more pharmaceutically acceptable adjuvants, carriers or excipients.

[0020] The inventors have found that YAP is the key downstream target protein of ALKBH5 in protecting liver ischemia-reperfusion injury. ALKBH5 gene or protein, ALKBH5 agonist is indirectly achieved by increasing the YAP protein content in the process of promoting the repair of liver ischemia-reperfusion injury, or preventing / treating / alleviating liver ischemia-reperfusion injury.

[0021] As a preferred embodiment of the present application, the above-mentioned ALKBH5 gene or protein promotes the repair of liver ischemia-reperfusion injury, or prevents / treats / alleviates liver ischemia-reperfusion injury by increasing the content of YAP protein, and the ALKBH5 agonist also promotes the repair of liver ischemia-reperfusion injury by increasing the content of YAP protein.

[0022] The inventors' research shows that ALKBH5 reduces the m6A modification of YTHDF1 mRNA, thereby promoting the stability of YTHDF1 mRNA and increasing the content of YTHDF1 protein; YTHDF1 specifically recognizes the m6A modification of YAP, thereby promoting the translation efficiency of YAP and increasing the content of YAP protein. ALKBH5 reduces hepatocyte damage caused by hypoxia-enriched oxygen by regulating the expression of YTHDF1-YAP.

[0023] Further preferably, the ALKBH5 gene or protein, the ALKBH5 agonist increases the YAP protein content by the following means:

[0024] (1) ALKBH5 gene or protein reduces the m6A modification of YTHDF1 mRNA, thereby promoting the stability of YTHDF1 mRNA and increasing the YTHDF1 protein content;

[0025] (2) YTHDF1 specifically recognizes the m6A modification of YAP, thereby promoting the translation efficiency of YAP and increasing the YAP protein content.

[0026] In the present application, the ALKBH5 gene refers to a gene that can encode the ALKBH5 protein through the processes of transcription and translation, and the expressed ALKBH5 protein can achieve its normal physiological function. The vector carrying the ALKBH5 gene can also encode the ALKBH5 protein, such as a plasmid vector, a phage vector, a viral vector, etc.

[0027] ALKBH5 protein is a member of the alkB protein family and is a nucleic acid oxygenase that depends on ferrous iron and 2-oxoglutarate. ALKBH5 protein can catalyze the demethylation of m6A in RNA. ALKBH5 is an m6A demethylase.

[0028] ALKBH5 agonists refer to substances that can activate or upregulate ALKBH5 gene expression, or enhance ALKBH5 protein activity, or substances that can synergize with ALKBH5 protein in promoting the repair of liver ischemia-reperfusion injury or preventing / treating / alleviating liver ischemia-reperfusion injury.

[0029] YTHDF1 protein is a YTH N6-methyladenosine RNA-binding protein 1, an m6A reader, and a key downstream factor of ALKBH5-mediated YAP expression.

[0030] YTHDF1 agonist refers to a substance that can activate or upregulate YTHDF1 gene expression, or enhance the content or activity of YTHDF1 protein, or a substance that can synergize with YTHDF1 protein in promoting the repair of liver ischemia-reperfusion injury or preventing / treating / alleviating liver ischemia-reperfusion injury.

[0031] YAP protein (Yes-Associated Protein) is the core effector of the Hippo signaling pathway. It is a multifunctional intracellular junction protein and transcriptional co-activator that plays a role in signal transduction and gene transcription regulation in normal body cells.

[0032] YAP agonists refer to substances that can activate or upregulate YAP gene expression, or enhance YAP protein activity, or substances that can synergize with YAP protein in promoting the repair of liver ischemia-reperfusion injury or preventing / treating / alleviating liver ischemia-reperfusion injury.

[0033] This application also proposes the following technical solution.

[0034] Use of the ALKBH5 gene or protein in the preparation of a drug for promoting the repair of liver ischemia-reperfusion injury, or preventing / treating / alleviating liver ischemia-reperfusion injury, wherein the ALKBH5 gene or protein promotes the repair of liver ischemia-reperfusion injury, or prevents / treats / alleviates liver ischemia-reperfusion injury by increasing the content of YTHDF1 protein and / or YAP protein.

[0035] Use of the ALKBH5 gene or protein as a YTHDF1 agonist or a YAP agonist in the preparation of a drug for promoting the repair of liver ischemia-reperfusion injury, or preventing / treating / alleviating liver ischemia-reperfusion injury.

[0036] Use of the ALKBH5 gene or protein in the preparation of a YTHDF1 agonist or a YAP agonist, wherein the ALKBH5 agonist or the YAP agonist is used to promote the repair of liver ischemia-reperfusion injury, or to prevent / treat / alleviate liver ischemia-reperfusion injury.

[0037] Use of an ALKBH5 agonist in the preparation of a drug for promoting the repair of liver ischemia-reperfusion injury, or preventing / treating / alleviating liver ischemia-reperfusion injury, wherein the ALKBH5 agonist promotes the repair of liver ischemia-reperfusion injury, or prevents / treats / alleviates liver ischemia-reperfusion injury by increasing the content of YTHDF1 protein and / or YAP protein.

[0038] Use of ALKBH5 agonists as substances that upregulate the expression of YTHDF1 and / or YAP in the preparation of drugs for promoting the repair of liver ischemia-reperfusion injury, or preventing / treating / alleviating liver ischemia-reperfusion injury.

[0039] Use of an ALKBH5 agonist in the preparation of a drug for upregulating the expression of YTHDF1 and / or YAP, wherein the drug is used to promote the repair of liver ischemia-reperfusion injury, or prevent / treat / alleviate liver ischemia-reperfusion injury.

[0040] Use of YTHDF1 protein or agonist in preparing drugs for promoting the repair of liver ischemia-reperfusion injury, or preventing / treating / alleviating liver ischemia-reperfusion injury.

[0041] Use of YAP protein or agonist in the preparation of drugs for promoting the repair of liver ischemia-reperfusion injury, or preventing / treating / alleviating liver ischemia-reperfusion injury.

[0042] Use of YTHDF1 and / or YAP protein or agonist in the preparation of a drug for promoting the repair of liver ischemia-reperfusion injury, or preventing / treating / alleviating liver ischemia-reperfusion injury.

[0043] The ALKBH5 gene or protein promotes the repair of liver ischemia-reperfusion injury, or prevents / treats / alleviates liver ischemia-reperfusion injury by increasing the content of YTHDF1 protein and / or YAP protein, which means that the administration of ALKBH5 protein or a vector containing the ALKBH5 gene can upregulate the content of YTHDF1 protein and / or YAP protein or enhance the activity of YTHDF1 protein and / or YAP protein, thereby indirectly achieving the purpose of promoting the repair of liver ischemia-reperfusion injury, or preventing / treating / alleviating liver ischemia-reperfusion injury.

[0044] The YTHDF1 agonist refers to a substance that can activate or upregulate YTHDF1 gene expression, or enhance the content or activity of YTHDF1 protein, or a substance that can synergize with YTHDF1 protein in promoting the repair of liver ischemia-reperfusion injury or preventing / treating / alleviating liver ischemia-reperfusion injury.

[0045] The inventors' research shows that ALKBH5 can reduce the m6A modification of YTHDF1 mRNA, thereby promoting the stability of YTHDF1 mRNA and increasing the content of YTHDF1 protein. Therefore, ALKBH5 protein or a vector containing the ALKBH5 gene is an optional YTHDF1 agonist.

[0046] The YAP agonist refers to a substance that can activate or upregulate YAP gene expression, or enhance the content or activity of YAP protein, or a substance that can synergize with YAP protein in promoting the repair of liver ischemia-reperfusion injury or preventing / treating / alleviating liver ischemia-reperfusion injury.

[0047] The inventors' research shows that ALKBH5 can increase the content of YTHDF1 protein, and YTHDF1 specifically recognizes the m6A modification of YAP, thereby promoting the translation efficiency of YAP and increasing the content of YAP protein. Therefore, ALKBH5 protein or a vector containing the ALKBH5 gene is an optional YAP agonist, and YTHDF1 protein or a vector containing the YTHDF1 gene is also an optional YAP agonist. Vectors containing the YTHDF1 gene can also encode YTHDF1 protein, such as plasmid vectors, phage vectors, viral vectors, etc.

[0048] In addition to the YAP agonists mentioned above, the YAP agonist can also be selected from PY-60, GA-017, TT-10, and NIBR-LTSi.

[0049] PY-60 is a specific activator of YAP transcriptional activity targeting annexin A2 (ANXA2). PY-60 directly binds to ANXA2 and antagonizes its normal cellular function of inhibiting YAP activity. The CAS number of PY-60 is 2765218-56-0, and its structural formula is as follows:

[0050]

[0051] GA-017 is a potent and selective inhibitor of LATS1 and LATS2 (large tumor suppressor kinase 1 / 2) with an IC 50 The values ​​are 4.10 and 3.92 nM, respectively. GA-017 is a cell proliferation activator. GA-017 promotes YAP / TAZ activation and nuclear translocation. GA-017 promotes cell growth under 3D culture conditions. The CAS number of GA-017 is 2351906-74-4, and its structural formula is as follows:

[0052]

[0053] TT-10 (TAZ-K) is an activator of YES-associated protein (YAP)-transcription enhancer domain (TEAD) activity. The CAS number of TT-10 is 2230640-94-3, and its structural formula is as follows:

[0054]

[0055] NIBR-LTSi is a selective LATS kinase inhibitor that activates YAP signaling. NIBR-LTSi promotes proliferation, maintains stemness, and prevents differentiation. NIBR-LTSi accelerates liver regeneration after partial and extended hepatectomy. The structural formula of NIBR-LTSi is as follows:

[0056]

[0057] The above-mentioned promotion of liver ischemia-reperfusion injury repair, or prevention / treatment / relief of liver ischemia-reperfusion injury is achieved through the following pathways:

[0058] (1) ALKBH5 gene or protein or agonist reduces the m6A modification of YTHDF1 mRNA, thereby promoting the stability of YTHDF1 mRNA and increasing the YTHDF1 protein content;

[0059] (2) YTHDF1 specifically recognizes the m6A modification of YAP, thereby promoting the translation efficiency of YAP and increasing the YAP protein content.

[0060] The present application also provides the following pharmaceutical compositions.

[0061] A pharmaceutical composition for promoting the repair of liver ischemia-reperfusion injury, or a pharmaceutical composition for preventing / treating / alleviating liver ischemia-reperfusion injury, or a pharmaceutical composition for promoting the repair and regeneration of liver cell damage, or a pharmaceutical composition for enhancing the proliferation activity of liver cells, the pharmaceutical composition comprising:

[0062] ALKBH5 gene or protein, or ALKBH5 agonist; or

[0063] YTHDF1 gene or protein, or YTHDF1 agonist; or

[0064] YAP gene or protein, or YAP agonist; or

[0065] One, two or a combination of three of the above genes or proteins.

[0066] As an embodiment of the present application, the above-mentioned pharmaceutical composition contains ALKBH5 protein or ALKBH5 agonist.

[0067] As an embodiment of the present application, the above-mentioned pharmaceutical composition contains YTHDF1 protein or YTHDF1 agonist.

[0068] As an embodiment of the present application, the above-mentioned pharmaceutical composition contains YAP protein or YAP agonist.

[0069] As an embodiment of the present application, the above-mentioned pharmaceutical composition contains ALKBH5 protein and YTHDF1 protein.

[0070] As an embodiment of the present application, the above-mentioned pharmaceutical composition contains ALKBH5 protein and YTHDF1 agonist.

[0071] As an embodiment of the present application, the above-mentioned pharmaceutical composition contains ALKBH5 protein and YAP protein.

[0072] As an embodiment of the present application, the above-mentioned pharmaceutical composition contains ALKBH5 protein and YAP agonist.

[0073] As an embodiment of the present application, the above-mentioned pharmaceutical composition contains YTHDF1 protein and YAP protein.

[0074] As an embodiment of the present application, the above-mentioned pharmaceutical composition contains YTHDF1 protein and YAP agonist.

[0075] As an embodiment of the present application, the above-mentioned pharmaceutical composition contains ALKBH5 protein, YTHDF1 protein and YAP protein.

[0076] As an embodiment of the present application, the above-mentioned pharmaceutical composition contains ALKBH5 protein, YTHDF1 agonist and YAP protein.

[0077] As an embodiment of the present application, the above-mentioned pharmaceutical composition contains ALKBH5 protein, YTHDF1 agonist and YAP agonist.

[0078] As an embodiment of the present application, the above-mentioned pharmaceutical composition contains an ALKBH5 agonist, a YTHDF1 agonist and a YAP agonist.

[0079] Preferably, in the above-mentioned pharmaceutical composition, the YAP agonist is selected from one or more of ALKBH5 protein or a vector containing the ALKBH5 gene, YTHDF1 protein or a vector containing the YTHDF1 gene, PY-60, GA-017, TT-10, and NIBR-LTSi.

[0080] As a preferred embodiment of the present application, the above-mentioned pharmaceutical composition contains at least one of PY-60, GA-017, TT-10, and NIBR-LTSi.

[0081] As a preferred embodiment of the present application, the above-mentioned pharmaceutical composition contains at least one of PY-60, GA-017, TT-10, NIBR-LTSi, and ALKBH5 protein.

[0082] As a preferred embodiment of the present application, the above-mentioned pharmaceutical composition contains at least one of PY-60, GA-017, TT-10, NIBR-LTSi, and YTHDF1 protein.

[0083] As a preferred embodiment of the present application, the above-mentioned pharmaceutical composition contains at least one of PY-60, GA-017, TT-10, NIBR-LTSi, and YAP protein.

[0084] The pharmaceutical composition described in the present application should also be added with pharmaceutically acceptable adjuvants, carriers or excipients according to the characteristics of medicines, drugs and preparations. The pharmaceutical composition can be any dosage form for clinical use, such as tablets, suppositories, dispersible tablets, enteric-coated tablets, chewable tablets, orodisintegrating tablets, capsules, sugar-coated tablets, granules, dry powders, oral solutions, small needles for injection, freeze-dried powder for injection or large infusions. According to specific dosage forms and modes of administration, the pharmaceutically acceptable adjuvants, carriers or excipients in the pharmaceutical composition can include one or more of the following: diluents, solubilizers, disintegrants, suspending agents, lubricants, adhesives, fillers, flavoring agents, sweeteners, antioxidants, surfactants, preservatives, wrappers and pigments, etc.

[0085] The present application also provides the use of ALKBH5 protein or agonist in combination with YTHDF1 protein or agonist in the preparation of a drug for promoting the repair of liver ischemia-reperfusion injury, or preventing / treating / alleviating liver ischemia-reperfusion injury.

[0086] The present application also provides the use of ALKBH5 protein or agonist in combination with YAP protein or agonist in the preparation of a drug for promoting the repair of liver ischemia-reperfusion injury, or preventing / treating / alleviating liver ischemia-reperfusion injury.

[0087] Preferably, the YAP agonist is selected from ALKBH5 protein or a vector containing the ALKBH5 gene, YTHDF1 protein or a vector containing the YTHDF1 gene, PY-60, GA-017, TT-10, and NIBR-LTSi.

[0088] The liver ischemia-reperfusion injury described in the present application is caused by liver surgery, liver transplantation or severe trauma.

[0089] For any terms not specifically explained or described in this application text, please refer to the textbooks related to medicinal chemistry, organic chemistry, biochemistry, and pharmacology. BRIEF DESCRIPTION OF THE DRAWINGS

[0090] Figure 1 The bar graph is a relative expression level of ALKBH5 mRNA in mouse liver at 1, 6 and 24 hours, where I / R-1h represents the relative expression level of ALKBH5 mRNA in mouse liver 1 hour after IRI, and "*" represents that there is a statistically significant difference between the experimental group and the control group, the same below;

[0091] Figure 2 The immunoblot images of ALKBH5 protein in mouse liver at 1, 6 and 24 hours, wherein IR-6 represents the immunoblot image of ALKBH5 protein in mouse liver at 6 hours after IRI;

[0092] Figure 3 It is a bar graph of the relative expression of m6A methylated mRNA in mouse liver at 1, 6 and 24 hours, where IR-24 represents the relative expression level of m6A methylated mRNA in mouse liver 24 hours after IRI;

[0093] Figure 4 It is a bar graph of the relative mRNA expression of ALKBH5 in hepatocytes undergoing H / R, wherein H1R0 represents the relative mRNA expression of ALKBH5 in hepatocytes treated with hypoxia for 1 hour, and H1R6 represents the relative mRNA expression of ALKBH5 in hepatocytes treated with hypoxia for 1 hour and then reperfused for 6 hours;

[0094] Figure 5The immunoblot images of the relative expression of ALKBH5 protein in hepatocytes undergoing H / R, wherein H1R0 represents the immunoblot image of ALKBH5 protein in hepatocytes treated with hypoxia for 1 hour, and H1R6 represents the immunoblot image of ALKBH5 protein in hepatocytes treated with hypoxia for 1 hour and then reperfused for 6 hours;

[0095] Figure 6 It is a bar graph of the relative expression of m6A methylated mRNA in hepatocytes undergoing H / R, wherein H1R0 represents the relative expression of m6A methylated mRNA in hepatocytes treated with hypoxia for 1 hour, and H1R6 represents the relative expression of m6A methylated mRNA in hepatocytes treated with hypoxia for 1 hour and then reperfused for 6 hours;

[0096] Figure 7 The immunoblot images are of ALKBH5 protein in the liver of AAV8-GFP and AAV8-ALKBH5 mice;

[0097] Figure 8 The scatter plots are of different concentrations of serum liver transaminases in mice with or without I / R injury and injection of AAV8-ALKBH5, where the left figure is a concentration level diagram of alanine aminotransferase (ALT), and the right figure is a concentration level diagram of aspartate aminotransferase (AST);

[0098] Fig. 9 H&E staining images of mice in the control group (sham) and I / R injury group with or without injection of AAV8-ALKBH5;

[0099] Fig.10 The Suzuki score bar graph of the control group (sham) and I / R injury group mice injected with AAV8-ALKBH5 or not;

[0100] Fig.11 TUNEL staining and cell counting bar graphs of mice in the AAV-GFP and AAV8-ALKBH5 groups;

[0101] Fig.12 It is a bar graph of cell counts of TUNEL staining in AAV-GFP and AAV8-ALKBH5 group mice;

[0102] Fig.13 PCNA staining images of mice in the AAV-GFP and AAV8-ALKBH5 groups;

[0103] Fig.14 The bar graphs are cell counts of PCNA staining in AAV-GFP and AAV8-ALKBH5 group mice;

[0104] Fig.15These are the immunoblot images of PCNA and Cyclin D1 proteins in the AAV-GFP and AAV8-ALKBH5 groups;

[0105] Fig.16 It is a bar graph of the relative intensity of PCNA and Cyclin D1 protein expression in AAV-GFP and AAV8-ALKBH5 groups;

[0106] Fig.17 These are the immunoblot images of YAP, Hnf4α, Smad3, and Tgf-β1 proteins in the AAV-GFP and AAV8-ALKBH5 groups;

[0107] Fig.18 It is a bar graph of the relative intensity of YAP, Hnf4α, Smad3, and Tgf-β1 protein expression in the AAV-GFP and AAV8-ALKBH5 groups;

[0108] Fig.19 It is a bar graph of the mRNA level detection of ALKBH5, YAP, BIRC5, SPP1, MYC, β-catenin, Axin1, and Notch1 in normal human liver cells (L02) and L02 cells treated with H / R under the condition of whether ALKBH5 is overexpressed, wherein Control represents normal human liver cells, i.e., L02 cells, H / R represents L02 cells treated with H / R, "*" represents statistically significant difference, and "ns" represents statistically no significant difference;

[0109] Fig. 20 The immunoblot images of protein expression of ALKBH5, YAP, BIRC5, SPP1, MYC, β-catenin, Axin1, and Notch1 in normal human liver cells (L02) and L02 cells treated with H / R, in the case of overexpression of ALKBH5 or not, where Control represents normal human liver cells, i.e., L02 cells, and H / R represents L02 cells treated with H / R;

[0110] Fig.21 for Fig. 20 The relative intensity bar graph of the expression level of each protein in the , where "*" indicates a statistically significant difference, and "ns" indicates no statistically significant difference;

[0111] Fig. 22 The scatter plot is the percentage level of m6A methylation of YAP in L02 cells of OE-NC and OE-ALKBH5;

[0112] Fig.23 The scatter plot is the percentage level of m6A methylation of YTHDF1 in L02 cells of OE-NC and OE-ALKBH5;

[0113] Fig.24 It is a bar graph of YTHDF1 mRNA expression levels in the ALKBH5 knockdown (si-ALKBH5) group and the normal (Si-NC) group;

[0114] Fig.25 Western blot images of YTHDF1 protein expression levels in the ALKBH5 knockdown (si-ALKBH5) group and the normal (Si-NC) group;

[0115] Fig.26 It is a bar graph showing the relative intensity of YTHDF1 protein expression in the ALKBH5 knockdown (si-ALKBH5) group and the normal (Si-NC) group;

[0116] Fig. 27 It is a line graph of YTHDF1 mRNA expression levels in normal hepatocytes (Si-NC), ALKBH5 knockdown (si-ALKBH5) hepatocytes, and ALKBH5 overexpression (OE-ALKBH5) hepatocytes at 0h, 3h, and 6h;

[0117] Fig.28 The immunoblot images are of YTHDF1 protein expression in normal hepatocytes (Si-NC) and ALKBH5 knockdown (si-ALKBH5) hepatocytes treated with actinomycin D (Act D);

[0118] Fig.29 It is a bar graph showing the relative intensity of YTHDF1 protein expression in normal hepatocytes (Si-NC) and ALKBH5 knockdown (si-ALKBH5) hepatocytes treated with actinomycin D (Act D);

[0119] Fig.30 is the interaction diagram between YAP and YTHDF1 in H / R-treated hepatocytes;

[0120] Fig.31 Cell proliferation bar graphs of negative control hepatocytes (si-NC), YTHDF1 knockout (si-YTHDF1) hepatocytes, and YTHDF1 knockout (si-YTHDF1) hepatocytes overexpressing ALKBH5 (OE-ALKBH5);

[0121] Fig.32 It is a bar graph of apoptosis rate of hepatocytes in si-NC, si-YTHDF1 and si-YTHDF1+OE-ALKBH5 groups after H / R injury;

[0122] Fig.33The line graphs are of the cell viability of hepatocytes in the si-NC, si-YTHDF1 and si-YTHDF1+OE-ALKBH5 groups at 1h, 3h and 6h after H / R injury;

[0123] Fig.34 The bar graphs are the mRNA expression levels of cell proliferation markers (PCNA, Ki-67, MCMP) and cell death markers (cytochrome c, BAX) in hepatocytes of the si-NC, si-YTHDF1, and si-YTHDF1+OE-ALKBH5 groups;

[0124] Fig.35 The immunoblot images are of the protein expressions of cell proliferation markers (PCNA, Ki-67, MCMP) and cell death markers (cytochrome c, BAX, Caspase3) in hepatocytes of the si-NC, si-YTHDF1, and si-YTHDF1+OE-ALKBH5 groups;

[0125] Fig.36 It is a bar graph showing the relative intensity of the protein expression of cell proliferation markers (PCNA, Ki-67, MCMP) and cell death markers (cytochrome c, BAX, Caspase3) in hepatocytes of the si-NC, si-YTHDF1 and si-YTHDF1+OE-ALKBH5 groups;

[0126] Fig.37 It is a bar graph of cell proliferation of negative control hepatocytes (Si-NC), YAP knockout (Si-YAP) hepatocytes, ALKBH5 overexpression (OE-ALKBH5) hepatocytes and ALKBH5 overexpression (OE-ALKBH5) YTHDF1 knockout (si-YTHDF1) hepatocytes after H / R injury;

[0127] Fig.38 It is a bar graph of apoptosis rate of Si-NC, Si-YAP, OE-ALKBH5 and Si-YAP+OE-ALKBH5 hepatocytes after H / R injury;

[0128] Fig.39 It is the line graph of cell viability of Si-NC, Si-YAP, OE-ALKBH5 and Si-YAP+OE-ALKBH5 hepatocytes at 1h, 3h and 6h after H / R injury;

[0129] Fig.40 The bar graphs are the mRNA expression levels of cell proliferation markers (PCNA, Ki-67, MCMP) and cell death markers (cytochrome c, BAX) in Si-NC, Si-YAP, OE-ALKBH5 and Si-YAP+OE-ALKBH5 hepatocytes;

[0130] Fig.41 Western blot images of the protein expressions of cell proliferation markers (PCNA, Ki-67, MCMP) and cell death markers (cytochrome c, BAX, Caspase3) in Si-NC, Si-YAP, OE-ALKBH5 and Si-YAP+OE-ALKBH5 hepatocytes;

[0131] Fig.42 It is a bar graph showing the relative intensity of protein expression of cell proliferation markers (PCNA, Ki-67, MCMP) and cell death markers (cytochrome c, BAX, Caspase3) in Si-NC, Si-YAP, OE-ALKBH5 and Si-YAP+OE-ALKBH5 hepatocytes;

[0132] Fig.43 Schematic diagram of the mechanism of action of the ALKBH5–m6A–YTHDF1–YAP axis in normal liver and liver I / R injury. The left figure is a schematic diagram of the mechanism in normal liver, and the right figure is a schematic diagram of the mechanism in liver I / R injury. DETAILED DESCRIPTION

[0133] The present invention is described below with reference to specific examples. It will be appreciated by those skilled in the art that these examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention in any way.

[0134] The experimental methods in the following examples are conventional methods unless otherwise specified. The experimental raw materials, reagent materials, strains, cells, detection kits, etc. used in the following examples are commercially available products unless otherwise specified.

[0135] The experimental materials and methods are as follows.

[0136] animal:

[0137] Male C57BL / 6 mice (6-8 weeks) were used as wild-type and background mice in this study. All animals were housed in a specific pathogen-free environment (controlled temperature, 23 ± 2°C; 12-h light / dark photoperiod). Food and water were available ad libitum. To overexpress ALKBH5 in the liver, adeno-associated virus (AAV) 8 vectors carrying GFP interference (AAV-GFP as negative control) or (AAV-ALKBH5) were injected into mice via the tail vein (2 × 10 in 100 μl saline). 12 Viral genome). I / R injury model was performed 4 weeks after virus injection. For detailed methods, see reference 1. All animal experimental procedures were approved by the Animal Ethics Committee of Wuhan Embryonic Cell Model Biological Center.

[0138] Mouse liver ischemia-reperfusion (I / R) injury model:

[0139] A 70% I / R injury model was established in the mouse liver (Reference 2). Briefly, the mouse abdomen was opened after anesthesia, and the blood vessels supplying the left and middle lobes of the liver (ischemic lobes) were isolated and clamped with vascular clamps. After 1 hour of ischemia, reperfusion of the ischemic lobe was started by removing the vascular clamps. Mice in the sham operation group underwent the same surgical procedure without vascular occlusion. After reperfusion at the designated time points, liver and blood samples of the mice were collected for subsequent analysis.

[0140] Mouse liver function measurement:

[0141] To assess the severity of liver injury, serum alanine aminotransferase (ALT) and aspartate aminotransferase (AST) levels were measured using an automatic biochemical analyzer (ADVIA2400; Siemens, USA) according to the manufacturer's instructions. (Reference 3)

[0142] Histological analysis:

[0143] Liver paraffin sections (5 μm) were stained with hematoxylin and eosin (H&E). The stained sections were then photographed and the necrotic area was quantitatively assessed. The severity of liver injury was graded by analyzing the necrotic area according to the Suzuki criteria as previously described

[33] .

[0144] Liver paraffin sections (5 μm) were stained with hematoxylin and eosin (H&E). The stained sections were then photographed and the necrotic area was quantitatively assessed. The severity of liver injury was graded by analyzing the necrotic area according to the Suzuki standard. For specific methods, see Reference 3.

[0145] Immunofluorescence and TUNEL staining:

[0146] Paraffin-embedded liver sections were stained with immunofluorescence, and the experimental method was described in reference 2. Briefly, liver sections were first incubated with 10% bovine serum albumin at 37°C for 1 hour. The sections were then incubated with the designated primary antibodies overnight at 4°C, followed by incubation with goat anti-rabbit IgG (#A-11011, Thermo) as a secondary antibody for 1 hour. Proliferating cells were observed using mouse anti-PCNA (#2586, CST) as the primary antibody. TUNEL staining was performed to assess apoptotic cells according to the manufacturer's instructions (Apoptosis Fluorescence Detection Kit, #S7111, Millipore Cell). The number of positive cells in liver sections was assessed by counting the labeled cells in 10 high-power fields (HPFs) / section (40×). Cell nuclei were stained with DAPI (#S36939, Invitrogen).

[0147] Cell Culture and Hepatocyte Hypoxia / Reoxygenation (H / R) Model:

[0148] Human hepatocyte cell line L02 cells were purchased from the Type Culture Collection of the Chinese Academy of Sciences (Shanghai, China) and maintained in a normal incubator (37°C, 5% CO2) in DMEM containing 10% fetal bovine serum (FBS, catalog number 10099141; Thermo). To establish the in vitro H / R model, cells were perfused with hypoxia for 1 h (1% O2, 5% CO2, and 94% N2), while the cell culture medium was replaced with serum-free DMEM / F12 medium. Subsequently, the cell culture medium was aspirated in the reoxygenation group and replaced with fresh, warm normal maintenance medium, and the culture dish was returned to the incubator room under normal conditions. The culture medium and cells were collected for further analysis.

[0149] qPCR detection:

[0150] The qPCR detection method is described in reference 1. In brief, total RNA (Total RNA) was extracted from frozen liver tissue or cultured cell samples using TRIzol reagent (15596-026, Invitrogen). 2 μg RNA was reverse transcribed into cDNA using a cDNA synthesis kit (#048986866001, Roche). Real-time fluorescence quantitative PCR was performed using SYBR green (#04887352001, Roche) to detect the expression level of the target gene. The mRNA expression level of the target gene was normalized to GAPDH. The primer pairs used in this study are shown in Table 1.

[0151] Table 1: Primer pairs

[0152] Gene Upstream primer 5'-3' Downstream primer 5'-3' YAP GTTGGGAGCTGTTTCTCCTG GCCATGTTGTTGTCTGATCG MYC TTCGGGTAGTGGAAAACCAG CAGCAGCTCGAATTTCTTCC SPP1 TGAAACGAGTCAGCTGGATG TGAAATTCATGGCTGTGGAA Notch1 ACTGTGAGGACCTGGTGG TTGTAGGTGTTGGGGAGGTC AXIN1 TGAAGTGGGCTGAGTCACTG CTTTCGGTAGATGGCTCTCG β-Catenin GGAGCCCTTCACATCCTAGC TGCAGCTTCCTTGTCCTGAG BIRC5 GAACTGGCCCTTCTTGGAG TCCGCAGTTTCCTCAAATTC YTHDF1 ACCTCACCACCTACGGACAG GGGTCTGCTGACCTTGAGAC ALBKH5 CGCAAGGCAGACCCTGAT CGGTTCTCTTCCTTGTCCATCT Ki-67 AATTCAGACTCCATGTGCCTGAG CTTGACACACACACATTGTCCTCAGC Bax TGCAGAGGATGATTGCTGAC GATCAGCTCGGGCACTTTAG PCNA GAAGCACCAAACCAGGAGAA TCACTCCGTCTTTTGCACAG Cytochrome CCAGCTACCATGTCCCAGAT TATGCCAGCTTCCGACTCTT β-Actin TGGACTTCGAGCAAGAGATG GAAGGAAGGCTGGAAGAGTG

[0153] Western Blot (WB):

[0154] The expression level of the target protein in liver tissue or cell samples was detected by immunoblotting, as described in reference 1. Briefly, the extracted protein samples (50 μg) were separated on a 10% SDS-PAGE gel and transferred to a PVDF membrane. After blocking with 5% skim milk, the membranes were incubated with the primary antibody at 4°C overnight, and then incubated with the corresponding secondary antibody at room temperature for 1 h. The expression level of the target protein was normalized to GAPDH or β-actin. The antibodies used in this study are shown in Table 2.

[0155] Table 2: Antibodies

[0156] Antibody serial number factory Dilution multiple ALKBH5 16837-1-AP Proteintech 1:1000 GAPDH 60004-1-Ig Proteintech 1:1000 β-Actin ab213262 Abcam 1:10000 PCNA #13110 CST 1:2000 CyclinD1 ab16663 Abcam 1:1000 Bcl-2 ab194583 Abcam 1:500 BAX #2772 CST 1:1000 YAP A1002 ABclonal 1:2000 p-YAP(S127) ab76252 Abcam 1:2000 Smad3 sc-101154 Santa 1:1000 Tgf-β1 ab215715 Abcam 1:2000 BIRC5 10508-1-AP Proteintech 1:1000 SPP1 22952-1-AP Proteintech 1:1000 MYC 67447-1-Ig Proteintech 1:5000 β-catenin 66379-1-Ig Proteintech 1:1000 Axin1 68093-1-Ig Proteintech 1:1000 Notch1 A22674 ABclonal 1:1000 Tubulin 11224-1-AP Proteintech 1 / 3000 Histone-3 A13824 ABclonal 1 / 500 YTHDF1 17479-1-AP Proteintech 1:1000 Ki67 27309-1-AP Proteintech 1:1000 PCNA 24036-1-AP Proteintech 1:2000 cleavedCaspase3 19677-1-AP Proteintech 1:500 Cytochrome 10993-1-AP Proteintech 1:1000 BAX 50599-2-lg Proteintech 1:2000

[0157] m6A detection:

[0158] The overall m6A level in total RNA was measured using the m6A RNA methylation quantification kit (#ab185912, Abcam). Briefly, messenger RNA (mRNA) was isolated from cells and coated on the detection wells for 90 min. Each well was washed and the capture antibody, detection antibody, and enhancer antibody were added. The color development solution was then added. The m6A level was quantified using a microplate reader at a wavelength of 450 nm.

[0159] RNA immunoprecipitation (RIP)-qPCR:

[0160] For details of the RIP experimental method, please refer to reference 4. Anti-YTHDF1 antibodies or IgG negative controls were used. For m6A-specific RIP-qPCR, the Magna RIP kit (Millipore, Cat#17-700) and anti-m6A antibodies were used to detect m6A modification of genes. In brief, cells were lysed with RIP lysis buffer, and then samples mixed with the indicated antibodies were immunoprecipitated with A / G magnetic beads. After rotating overnight at 4°C, the beads were washed to remove unbound substances. RNA was then extracted and purified according to the manufacturer's instructions. Finally, the purified RNA was analyzed by qPCR.

[0161] Cell viability assay:

[0162] Cell viability was detected using a cell counting kit-8 (CCK-8, Solarbio, China) according to the manufacturer's detection protocol. After H / R treatment for a specified time, the cultured cells were added with 10% CCK8 reagent and incubated for 60 min. The optical density (OD) value at a wavelength of 450 nm was measured using an ELISA reader (ST-360, TECHNOGENETICS SPA, China).

[0163] Carboxyfluorescein diacetate succinimidyl ester (CFSE) proliferation assay:

[0164] The CFSE-based proliferation assay is described in reference 5. In brief, cultured cells were labeled with CFSE (Cat#C1031, Shanghai Bio-Tech Biotech Co., Ltd.) for 10 minutes at 37°C. After H / R treatment for the specified time, cells were washed twice with warm PBS, separated and counted. Cell proliferation was then immediately detected by flow cytometry.

[0165] Flow cytometry:

[0166] For details of flow cytometry analysis, see reference 3. Briefly, after H / R treatment for the specified time, cells were stained with 10 μL FITC-labeled Annexin V (DLM, China) and 5 μL propidium iodide (PI; DLM, China) at room temperature and in the dark for 15 min. The stained cells were analyzed using a flow cytometer (CytoFLEX S, Beckman Coulter, USA).

[0167] Plasmid transfection:

[0168] The plasmids used in this study to regulate gene expression were constructed by Genecefe (Jiangsu, China), including siRNA targeting YAP, ALKBH5, and YTHDF1, as well as a plasmid carrying ALKBH5. Cells were transfected with 500 ng of plasmid using lipofectamine 2000 Reagent (Thermo, USA) according to the manufacturer's instructions. The primer sequences for siRNAs or ALKBH5 overexpression constructs are shown in Table 3.

[0169] Table 3: Primer sequences

[0170]

[0171] Statistical analysis:

[0172] All data are presented as mean ± standard deviation. Comparisons between two groups were performed using a two-tailed t-test (unpaired). For multiple comparisons, one-way analysis of variance (ANOVA) was performed using GraphPad Prism software, followed by the least square difference (LSD) test (assuming equal variances) or Tamhane's T2 test (not assuming equal variances). Differences were considered significant when P value < 0.05.

[0173] Literature 1: Wang PX, Ji YX, Zhang XJ, Zhao LP, Yan ZZ, Zhang P, et al. TargetingCASP8 and FADD-like apoptosis regulator ameliorates nonalcoholicsteatohepatitis in mice and nonhuman primates. Nat Med2017; 23:439-449.

[0174] Literature 2: Wang PX, Zhang R, Huang L, Zhu LH, Jiang DS, Chen HZ, etal. Interferon regulatory factor 9 is a key mediator of hepatic ischemia / reperfusion injury. J Hepatol 2015; 62:111-120.

[0175] Document 3: Hu J, Zhu XH, Zhang XJ, Wang PX, Zhang R, Zhang P, et al. TargetingTRAF3 signaling protects against hepatic ischemia / reperfusions injury. JHepatol 2016;64:146-159.

[0176] Literature 4: Han Z, Wang

[0177] Literature 5: Cui CP, Zhang DJ, Shi BX, Du SJ, Wu DL, Wei P, et al. Isolation and functional identification of a novel human hepatic growth factor: hepatopoietinCn. Hepatology 2008; 47:986-995.

[0178] Example 1 Study on the expression of ALKBH5 in hepatocytes after liver ischemia-reperfusion injury (liver IRI)

[0179] To investigate the potential role of ALKBH5 in hepatic IRI, an in vivo mouse model and an in vitro hepatocyte H / R model were established.

[0180] In vitro hepatocyte H / R model: 1 hour of hypoxia followed by 6 hours of reperfusion.

[0181] At 1, 6, and 24 h after IRI, the mRNA and protein expression levels of ALKBH5 in mouse liver were detected using the above method, and the level of m6A methylated mRNA was also detected. The experimental results are shown in Figures 1 to 3 As shown (the "*" in the figure indicates that there is a statistically significant difference between the experimental group and the control group, the same below), Figure 1 The bar graph shows the relative expression of ALKBH5 mRNA in mouse liver at 1, 6 and 24 hours. Figure 2 The immunoblot images of ALKBH5 protein in mouse liver at 1, 6 and 24 hours. Figure 3 The bar graph shows the relative expression of m6A methylated mRNA in mouse liver at 1, 6 and 24 hours. The experimental results show that the expression levels of ALKBH5 mRNA and protein in mouse liver decreased at 1, 6 and 24 hours after IRI ( Figure 1 and Figure 2 ), in contrast to the gradual increase in m6A accumulation ( Figure 3 ).

[0182] When the hepatocytes were subjected to H / R (hypoxia for 1 hour followed by reperfusion for 6 hours), the mRNA and protein expression levels of ALKBH5 in the hepatocytes were detected, and the level of m6A methylated mRNA was also detected. The experimental results are shown in Figures 4 to 6 As shown, Figure 4 This is a bar graph showing the relative mRNA expression of ALKBH5 when hepatocytes undergo H / R. Figure 5 This is the immunoblot image of the relative expression of ALKBH5 protein when hepatocytes undergo H / R. Figure 6 The bar graph shows the relative expression of m6A methylated mRNA in hepatocytes undergoing H / R. The experimental results show that ALKBH5 is upregulated in hepatocytes treated with hypoxia for 1 hour. When hepatocytes undergo H / R (hypoxia for 1 hour and then reperfusion for 6 hours), the mRNA and protein levels of ALKBH5 are significantly reduced compared with the control group ( Figure 4 and Figure 5 ), the level of m6A methylated mRNA in hepatocytes was downregulated after hypoxia treatment and upregulated after 6 h of reperfusion ( Figure 6 ).

[0183] These results suggest that ALKBH5-mediated m6A demethylation may contribute to the repair of hepatic IRI.

[0184] Example 2 Effect of AAV-mediated ALKBH5 overexpression in mouse liver tissue on liver IRI in order to further explore the potential role of ALKBH5 in the progression of liver IRI, ALKBH5 was specifically overexpressed in mouse liver using adeno-associated virus carrying ALKBH5 (AAV8-ALKBH5). Mice injected with AAV8 green fluorescent protein (GFP) were used as controls.

[0185] Western blotting

[0186] Western blot analysis confirmed the overexpression of ALKBH5 protein in the liver of mice injected with AAV8-ALKBH5. Figure 7 As shown, Figure 7 These are immunoblot images of ALKBH5 protein in the liver of AAV8-GFP and AAV8-ALKBH5 mice.

[0187] Serum liver transaminase test

[0188] The expression levels of serum liver transaminases in mice were further detected. The experimental groups were 4 mice in the control group and 6 mice in the I / R injury group. All mice were injected with AAV8-GFP and AAV8-ALKBH5, respectively. The concentrations of alanine aminotransferase (ALT) and aspartate aminotransferase (AST) were detected in each mouse. Figure 8 As shown, Figure 8 The figure is a scatter plot of different concentration levels of serum liver transaminases in mice with or without I / R injury and injection of AAV8-ALKBH5, where the left figure is a graph of the concentration level of alanine aminotransferase (ALT), and the right figure is a graph of the concentration level of aspartate aminotransferase (AST). The experiment showed that compared with the control (sham) mice with GFP, mice injected with AAV8-ALKBH5 showed significantly improved liver function after I / R injury, such as reduced serum liver transaminases (ALT and AST).

[0189] H&E staining experiment

[0190] Tissue damage was further assessed using H&E staining.

[0191] H&E staining uses hematoxylin and eosin to stain tissues. Hematoxylin is alkaline and can stain the chromatin in the cell nucleus and the nucleic acid in the cytoplasm into blue or purple, while eosin is acidic and can stain the proteins in the cytoplasm and extracellular matrix into red or pink. This staining method can make the cell structure and composition in the tissue sample clearly visible, thus helping pathologists and histologists to make diagnoses and research.

[0192] The results of H&E staining of mice in the control group (sham) and I / R injury group are shown in Fig. 9 The Suzuki score of liver injury in mice was as shown in Fig.10 As shown in the results, the Suzuki score of liver injury in AAV8-Alkbh5 mice was always lower than that in the GFP control group. The experimental results further demonstrated that mice injected with AAV8-ALKBH5 showed significantly improved liver function after I / R injury.

[0193] TUNEL staining and PCNA staining experiments

[0194] During apoptosis, double-strand breaks or single-strand breaks in chromosome DNA produce a large number of sticky 3'-OH ends. Under the action of terminal deoxyribonucleotide transferase (TdT), the derivatives formed by deoxyribonucleotides and fluorescein, peroxidase, alkaline phosphatase or biotin can be labeled to the 3'-end of DNA, so that apoptotic cells can be detected. This type of method is called terminal-deoxynucleotidyl transferase mediated nick end labeling (TUNEL). Since normal or proliferating cells have almost no DNA breaks, no 3'-OH is formed and they can rarely be stained.

[0195] PCNA (proliferating cell nuclear antigen) is a protein with a molecular weight of 36kDa. It is synthesized and present in the nucleus. It plays an important role in the initiation of cell proliferation and is a good indicator of the cell proliferation state. When the cell is in a quiescent state, the PCNA content is very low. When the cell enters the proliferation cycle, its expression increases significantly. Therefore, PCNA is a good indicator of the cell proliferation state. Through the conjugation reaction of EdU (5-Ethynyl-2'-deoxyuridine, a thymidine nucleoside analog) and Apollo fluorescent dye, the dye can be labeled to the proliferating cells inserted with EdU, thereby quickly detecting the cell DNA replication activity.

[0196] TUNEL staining and PCNA staining experiments were performed on the AAV-GFP group mice and the AAV8-ALKBH5 group mice, and a bar graph of relative HPF cell counts was drawn. Fig.11 As shown, the bar graph of the cell counting experiment results corresponding to TUNEL staining is shown in Fig.12 As shown; PCNA staining is shown Fig.13 The bar graph of the cell counting experiment results corresponding to PCNA staining is shown in Fig.14 shown.

[0197] TUNEL staining of liver tissue after I / R injury showed that the number of apoptotic cells in the AAV8-Alkbh5 group was significantly lower than that in the GFP control group ( Fig.11 / 12). In contrast, the number of proliferating cell nuclear antigen (PCNA)-positive cells increased in livers with ALKBH5 overexpression ( Fig.13 / 14), the above experiments showed that cell apoptosis during liver I / R injury is directly involved in liver injury and impairs liver function, and ALKBH5 promotes cell proliferation in the liver under I / R stimulation.

[0198] Western blotting experiments simultaneously detected the protein expression levels of PCNA protein, cyclin D1 (Cyclin D1), anti-apoptotic protein B-cell lymphoma protein 2 (Bcl-2), pro-apoptotic Bcl-2-associated X protein (Bax), and the expression levels of several key proteins required for liver regeneration after injury (YAP, Hnf4α, Smad3, Tgf-β1). The immunoblotting pictures of PCNA, Cyclin D1 and other proteins are shown in Figure 2. Fig.15 The relative intensity of each protein expression is shown in the bar graph. Fig.16 As shown; the immunoblotting pictures of YAP, Hnf4α, Smad3, Tgf-β1 and other proteins are shown Fig.17 As shown, the relative intensity of each protein expression (Relative intensity) bar graph is as follows Fig.18 shown.

[0199] The above experimental results showed that ALKBH5 overexpression increased the protein expression of PCNA and cyclin D1, indicating that more hepatocytes re-entered the cell cycle and began to proliferate after injury. In addition, compared with the GFP control group, the expression of the anti-apoptotic protein B-cell lymphoma protein 2 (Bcl-2) increased in the liver of AAV8-Alkbh5 mice after I / R injury, while the expression of the pro-apoptotic Bcl-2-associated X protein (Bax) decreased ( Fig.15 / 16). For several key proteins required for liver regeneration after injury, Yes-associated protein (YAP) and hepatocyte nuclear factor (Hnf) 4α were upregulated in ALKBH5-overexpressing livers compared with the GFP control group, while the protein levels of Smad3 and Tgf-β1 were not affected by ALKBH5 overexpression.

[0200] In summary, the above experimental results indicate that ALKBH5 has a protective effect on liver I / R injury and can significantly reduce liver ischemia-reperfusion injury, which may be attributed to its role in promoting proliferation and inhibiting cell death.

[0201] Example 3 Effect of ALKBH5 on YAP protein expression in hepatocytes

[0202] To further explore whether overexpression of ALKBH5 affects the expression of YAP in cultured hepatocytes, qPCR and immunoblotting were used to detect the mRNA levels and protein expression levels of ALKBH5, YAP, YAP target genes (BIRC5, SPP1 and MYC), Wnt / β-catenin (β-catenin and Axin1) and Notch pathway (Notch1) in normal human hepatocytes (L02) and L02 cells treated with H / R in the case of ALKBH5 overexpression (OE-NC, OE-ALKBH5). The bar graph of the mRNA level detection of ALKBH5, YAP, BIRC5, SPP1, MYC, β-catenin, Axin1 and Notch1 in normal human hepatocytes (L02) and L02 cells treated with H / R in the case of ALKBH5 overexpression (OE-NC, OE-ALKBH5) is shown in the figure. Fig.19 The protein expression immunoblot images are shown in Fig. 20 The corresponding relative intensity bar graphs of the protein expression levels are shown in Fig.21 As shown in the figure, “*” indicates a statistically significant difference, and “ns” indicates no statistically significant difference.

[0203] The results showed that forced overexpression of ALKBH5 had no effect on the expression of YAP mRNA, while YAP protein expression continued to increase. In addition, in cultured normal human hepatocytes (L02), ALKBH5 overexpression increased the mRNA and protein expression of YAP target genes (BIRC5, SPP1, and MYC). In addition, among the expression levels of several signaling molecules related to the regulation of hepatocyte proliferation and liver injury, in contrast, in H / R-treated L02 cells, the expression of core components of the Wnt / β-catenin (β-catenin and Axin1) and Notch pathways (Notch1) was not affected by ALKBH5 overexpression.

[0204] The above experimental results show that under H / R stimulation, the expression of YAP protein in hepatocytes is controlled by ALKBH5, and ALKBH5 promotes the protein expression of YAP in hepatocytes.

[0205] Example 4 Effect of ALKBH5 on the stability of YTHDF1 in hepatocytes

[0206] To determine the molecular mechanism of ALKBH5 in regulating YAP expression, the inventors further explored the effect of ALKBH5 overexpression on the m6A modification of YAP in H / R-treated L02 cells.

[0207] The m6A methylation levels of YAP and YTHDF1 in L02 cells of OE-NC and OE-ALKBH5 were detected. The experimental results are shown as follows: Fig. 22 , Fig.23 shown. Fig. 22 The results showed that significant m6A methylation of YAP mRNA was observed in the control group, which was not affected by ALKBH5 overexpression. Fig.23 , the m6A-specific qPCR analysis results of YTHDF1 showed that the m6A methylation level in YTHDF1 was significantly decreased in the ALKBH5 overexpression group.

[0208] The expression level of ALKBH5 was knocked down in hepatocytes, and the expression level of YTHDF1 mRNA and protein was detected. The experimental results are as follows Fig.24 , Fig.25 and Fig.26 The experimental results showed that ALKBH5 knockdown (si-ALKBH5) reduced the expression of YTHDF1 mRNA and protein.

[0209] Since m6A modification mainly regulates gene expression by affecting the stability of mRNA, the inventors measured the half-life of YTHDF1 mRNA in cultured hepatocytes after transfection with plasmids expressing ALKBH5 or targeted siRNA. The experiment detected the expression levels of YTHDF1 mRNA at 0h, 3h, and 6h in normal hepatocytes (Si-NC), ALKBH5 knockdown (si-ALKBH5) hepatocytes, and hepatocytes transfected with plasmids expressing ALKBH5 or targeted siRNA (OE-ALKBH5), and a line graph of YTHDF1 mRNA expression levels was drawn, as shown in Figure 2. Fig. 27 The experimental results showed that the half-life of YTHDF1 mRNA was significantly decreased in response to ALKBH5 knockdown, but increased in response to ALKBG5 overexpression.

[0210] The inventors further treated normal hepatocytes (Si-NC) and ALKBH5 knockdown (si-ALKBH5) hepatocytes with actinomycin D (Act D, which can inhibit RNA synthesis and interfere with the transcription process of mRNA in cells) and used immunoblotting to detect the expression of YTHDF1 protein. The immunoblot images are shown in FIG. Fig.28 As shown, the relative intensity bar graph of protein expression is as follows Fig.29 The experimental results showed that in cultured hepatocytes, the protein expression of YTHDF1 was consistently reduced by knocking down ALKBH5.

[0211] At the same time, the inventors revealed the interaction between YAP and YTHDF1 in H / R-treated hepatocytes by RIP-qPCR analysis, e.g. Fig.30 shown.

[0212] The above experimental results indicate that ALKBH5 regulates the stability of YTHDF1 through m6A demethylation in hepatocytes.

[0213] Example 5 ALKBH5 reduces hepatocyte damage caused by hypoxia-enrichment by regulating the expression of YTHDF1-YAP

[0214] In this example, the inventors investigated the role of YTHDF1 in regulating the recovery of hepatocytes from H / R-induced injury.

[0215] YTHDF1 siRNA (si-YTHDF1) was transfected into cultured hepatocytes to construct YTHDF1 knockout hepatocytes (si-YTHDF1).

[0216] The experimental groups were normal negative control hepatocytes (si-NC), YTHDF1 knockout (si-YTHDF1) hepatocytes, and ALKBH5 overexpression (OE-ALKBH5) YTHDF1 knockout (si-YTHDF1) hepatocytes. CFSE-stained flow cytometry analysis was used to obtain a bar graph of cell proliferation percentage, as shown in Figure 2. Fig.31 The experimental results showed that YTHDF1 knockdown (si-YTHDF1) significantly inhibited the proliferation of hepatocytes compared with cells transfected with negative control siRNA (si-NC), even in the presence of ALKBH5 overexpression (OE-ALKBH5).

[0217] After the hepatocytes in the above groups were injured by H / R, the apoptotic rate of each group was determined by flow cytometry. Fig.32 The experimental results showed that compared with the si-NC control group, the si-YTHDF1-infected cells showed a significantly increased apoptosis rate in response to H / R injury.

[0218] The experiment used CCK8 kit to simultaneously detect the cell viability of the above-mentioned grouped hepatocytes at 1h, 3h, and 6h after H / R injury. The experimental results are as follows Fig.33 The experimental results showed that compared with the si-NC control group, si-YTHDF1 significantly reduced cell viability after H / R stimulation.

[0219] The inventors further used qPCR and Western blot analysis to detect the expression of specific markers related to cell death or cell proliferation in the above grouped hepatocytes. Cell proliferation markers include PCNA, Ki-67 and MCMP, and cell death markers include cytochrome c (Cytochrome c or Cyto c), BAX and Caspase3. The results of the mRNA level detection of each marker are shown in Fig.34 As shown, the protein immunoblot images of each marker are as follows Fig.35 As shown in the figure, the relative intensity of protein expression (Relativeintensity) is as follows Fig.36 As shown. The experimental results showed that compared with the si-NC control group, the expression of cell proliferation markers (PCNA, Ki-67, MCMP) in the si-YTHDF1 group was reduced, and the expression of cell death markers (cytochrome c, BAX, Caspase3) was increased, both at the mRNA level and the protein level. Moreover, compared with the si-NC control group, YTHDF1 knockdown significantly inhibited YAP protein expression, even in the presence of ALKBH5 overexpression (si-YTHDF1+OE-ALKBH5).

[0220] These experimental results indicate that YTHDF1 is a key mediator regulating YAP expression, which promotes the recovery of hepatocytes from H / R-induced injury.

[0221] Example 6 YAP is a key downstream target protein of ALKBH5 in protecting liver from ischemia-reperfusion injury

[0222] To verify that the protective effect of ALKBH5 against H / R injury of hepatocytes depends on the expression of YAP, the inventors transfected hepatocytes with YAP siRNA to construct YAP knockout hepatocytes (Si-YAP), and co-transfected hepatocytes with YAP siRNA and ALKBH5-overexpression plasmid (OE-ALKBH5) to construct ALKBH5-overexpressing YAP knockout hepatocytes (Si-YAP+OE-ALKBH5).

[0223] The experimental groups were normal negative control hepatocytes (Si-NC), YAP knockout hepatocytes (Si-YAP), ALKBH5 overexpressing hepatocytes (OE-ALKBH5) and ALKBH5 overexpressing YAP knockout hepatocytes (Si-YAP+OE-ALKBH5). After H / R stimulation, CFSE-stained flow cytometry analysis was performed to obtain the cell proliferation percentage bar graph and the apoptotic rate bar graph of each group, as shown in Figure 2. Fig.37 and Fig.38The results showed that YAP knockdown inhibited the proliferation of hepatocytes after stimulation with H / R, independent of ALKBH5 overexpression, and YAP knockdown offset the anti-apoptotic effect of ALKBH5 overexpression on hepatocytes challenged with H / R.

[0224] The experiment used CCK8 kit to simultaneously detect the cell viability of the above-mentioned grouped hepatocytes at 1h, 3h, and 6h after H / R injury. The experimental results are as follows Fig.39 The experimental results showed that YAP knockout (Si-YAP) significantly reduced cell viability compared with the Si-NC control group. At the same time, OE-ALKBH5 significantly increased cell viability, which was attenuated by YAP knockdown.

[0225] The inventors further used qPCR and Western blot analysis to detect the expression of specific markers related to cell death or cell proliferation in the above grouped hepatocytes, as shown in Example 5. The results of the mRNA level detection of each marker are shown in Fig.40 As shown, the protein immunoblot images of each marker are as follows Fig.41 As shown in the figure, the relative intensity of protein expression (Relative intensity) is as follows Fig.42 As shown. The experimental results showed that compared with the si-NC control group, the levels of cell proliferation markers (PCNA, Ki-67, MCMP) in the si-YAP group were reduced, and the levels of cell death markers (cytochrome c, Bax, Caspase3) were increased. In addition, the regulatory effect of ALKBH5 on the expression levels of these downstream factors was also weakened by YAP knockdown (Si-YAP+OE-ALKBH5), but was not related to the level of YTHDF1.

[0226] The above experimental results indicate that the expression of YAP is responsible for the response of ALKBH5 to H / R injury in hepatocyte proliferation and apoptosis.

[0227] In Examples 1-6, the inventors discovered the function of ALKBH5 as a protective agent against I / R-induced liver injury. The inventors found that the expression of ALKBH5 in hepatocytes was reduced, accompanied by severe damage to I / R-induced liver injury. AAV-mediated overexpression of ALKBH5 increased hepatocyte proliferation capacity, reduced cell death, and restored liver function after I / R injury. Mechanistically, under normal conditions, the m6A "eraser" ALKBH5 downregulates the methylation of the m6A "reader" YTHDF1 to promote the stability of YTHDF1 mRNA, and then YTHDF1 promotes the efficient translation of YAP. In contrast, when stimulated by I / R, the reduction of ALKBH5 in hepatocytes is accompanied by a reduction in YTHDF1, resulting in lower levels of YAP content. The above mechanism is as follows Fig.43In summary, the above experiments revealed the key role of the ALKBH5–m6A–YTHDF1–YAP axis in liver I / R injury.

[0228] The specific embodiments described above further illustrate the objectives, technical solutions and beneficial effects of the present invention in detail. It should be understood that the above are only specific embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of this application should be included in the protection scope of this application.

Claims

1. Use of ALKBH5 gene or protein in the preparation of a drug for promoting the repair of liver ischemia-reperfusion injury, or preventing / treating / alleviating liver ischemia-reperfusion injury, wherein: The ALKBH5 gene or protein promotes the repair of liver ischemia-reperfusion injury, or prevents / treats / alleviates liver ischemia-reperfusion injury by increasing the content of YTHDF1 protein and / or YAP protein.

2. Use of ALKBH5 gene or protein as a YTHDF1 agonist or YAP agonist in the preparation of drugs for promoting the repair of liver ischemia-reperfusion injury, or preventing / treating / alleviating liver ischemia-reperfusion injury.

3. Use of ALKBH5 gene or protein in the preparation of YTHDF1 agonist or YAP agonist, wherein: The ALKBH5 agonist or YAP agonist is used to promote the repair of liver ischemia-reperfusion injury, or prevent / treat / alleviate liver ischemia-reperfusion injury.

4. Use of an ALKBH5 agonist in the preparation of a drug for promoting the repair of liver ischemia-reperfusion injury, or preventing / treating / alleviating liver ischemia-reperfusion injury, wherein: The ALKBH5 agonist promotes the repair of liver ischemia-reperfusion injury, or prevents / treats / alleviates liver ischemia-reperfusion injury by increasing the content of YTHDF1 protein and / or YAP protein.

5. Use of ALKBH5 agonists as substances that upregulate the expression of YTHDF1 and / or YAP in the preparation of drugs for promoting the repair of liver ischemia-reperfusion injury, or preventing / treating / alleviating liver ischemia-reperfusion injury.

6. Use of an ALKBH5 agonist in the preparation of a drug for upregulating the expression of YTHDF1 and / or YAP, wherein: The drug is used for promoting the repair of liver ischemia-reperfusion injury, or preventing / treating / alleviating liver ischemia-reperfusion injury.

7. The use according to any one of claims 1 to 6, wherein The promotion of liver ischemia-reperfusion injury repair, or prevention / treatment / alleviation of liver ischemia-reperfusion injury is achieved through the following pathways: (1) ALKBH5 gene or protein or agonist reduces the m6A modification of YTHDF1 mRNA, thereby promoting the stability of YTHDF1 mRNA and increasing the YTHDF1 protein content; (2) YTHDF1 specifically recognizes the m6A modification of YAP, thereby promoting the translation efficiency of YAP and increasing the YAP protein content.

8. A pharmaceutical composition for promoting the repair of liver ischemia-reperfusion injury, or a pharmaceutical composition for preventing / treating / alleviating liver ischemia-reperfusion injury, or a pharmaceutical composition for promoting the repair and regeneration of liver cell damage, or a pharmaceutical composition for enhancing the proliferation activity of liver cells, characterized in that: The pharmaceutical composition contains: ALKBH5 gene or protein, or ALKBH5 agonist; or YTHDF1 gene or protein, or YTHDF1 agonist; or YAP gene or protein, or YAP agonist; or One, two or a combination of three of the above genes or proteins.

9. Use of ALKBH5 protein or agonist in combination with YTHDF1 and / or YAP protein or agonist in the preparation of a drug for promoting the repair of liver ischemia-reperfusion injury, or preventing / treating / alleviating liver ischemia-reperfusion injury.

10. Use of YTHDF1 and / or YAP protein or agonist in the preparation of a drug for promoting the repair of liver ischemia-reperfusion injury, or preventing / treating / alleviating liver ischemia-reperfusion injury.

Images