Protein and application thereof in intestinal flora magnetic resonance imaging positioning and tracking

Abstract

The invention relates to a protein and application thereof in magnetic resonance imaging positioning and tracking of intestinal flora. The amino acid sequence of the protein comprises a sequence as shown in SEQ ID NO. 1. Specific protein is designed, the protein can be combined with endogenous manganese ions, an MRI signal is effectively enhanced, the protein is expressed in intestinal flora, the endogenous manganese ions can be used for magnetic resonance imaging, high-resolution positioning and dynamic tracking of the intestinal flora are achieved, an exogenous contrast agent can be avoided, side effects or immune response are avoided, and the method is suitable for large-scale popularization and application. And non-invasive, real-time, dynamic and high-resolution imaging can be realized, and spatial distribution and dynamic change information of intestinal flora can be provided.

Description

Technical Field

[0001] The invention belongs to the field of life science technology and relates to a protein and its application in magnetic resonance imaging positioning and tracking of intestinal flora. Background Art

[0002] The intestinal flora plays a vital role in maintaining host health, digestion, immune regulation, and nervous system function. In recent years, with the deepening of research on the intestinal flora, scientists have gradually realized that the imbalance of intestinal microecology is closely related to a variety of diseases (such as inflammatory bowel disease, obesity, diabetes, colorectal cancer, etc.). In order to better understand the function of the intestinal flora and its changes under different pathological conditions, accurate and real-time monitoring of the dynamic distribution and changes of the intestinal flora has become an important research goal.

[0003] Existing methods for detecting intestinal flora mainly include genomic methods (such as 16S rRNA sequencing, metagenomic sequencing), metabolomics methods, and microscopy techniques. Although these methods can provide rich intestinal flora information, they generally have the following problems: (1) Lack of spatial resolution: Traditional genomic and metabolomics methods cannot provide spatial distribution information of flora in the intestine, and cannot monitor the changes of intestinal flora in the intestinal environment in real time, which limits the comprehensive understanding of the dynamic changes of intestinal flora, especially the subtle differences in microbial communities in the intestine; (2) Invasiveness and time consumption: Most current intestinal flora detection methods rely on sampling of intestinal contents (such as fecal samples), which not only takes time, but also has a certain degree of invasiveness in the sampling process. Some methods also require a long experimental cycle and cannot perform real-time dynamic monitoring; (3) Difficulty in obtaining spatial distribution information: In vivo, the spatial distribution of intestinal flora is usually highly complex and heterogeneous, and existing imaging technologies (such as traditional microscopy) are difficult to obtain high-resolution and comprehensive information of intestinal bacterial communities.

[0004] Therefore, there is an urgent need for a new, non-invasive, high-resolution imaging technology that can monitor the spatial distribution of intestinal flora in real time, so as to better understand the function of the intestinal microbiome and its changes in health and disease. Magnetic resonance imaging (MRI), as a non-invasive, radiation-free, high-resolution imaging technology, has been widely used in medical imaging. It generates high-resolution tissue images through the interaction of magnetic fields with water molecules in the body. However, traditional MRI imaging is difficult to use for imaging microorganisms, mainly because the signal of the microbial community in the body is weak and there are not enough specific markers to bind to it.

[0005] In summary, how to develop an effective MRI imaging method with high spatial resolution to accurately locate the distribution of intestinal flora remains a scientific problem that needs to be solved urgently. Summary of the invention

[0006] In view of the deficiencies of the prior art and actual needs, the present invention provides a protein and its application in magnetic resonance imaging positioning and tracking of intestinal flora, so as to develop an effective intestinal flora MRI imaging method with high spatial resolution.

[0007] To achieve this object, the present invention adopts the following technical solutions:

[0008] In a first aspect, the present invention provides a protein, wherein the amino acid sequence of the protein includes the sequence shown in SEQ ID NO.1.

[0009] The present invention designs a protein that can be stably expressed in cells, can bind to endogenous manganese ions, and effectively enhance MRI signals, and is suitable for magnetic resonance imaging of cells.

[0010] SEQ ID NO.1:

[0011] MDYKDHDGDYKDHDIDYKDDDDKVNRRRQRASRAGVVARRATPGDAQANSGRAPARPFQSFVSNGAMLMNKQIVAGIVAGLVSMSSHAQLGQLFQSVKEQVTQAATSQVNQGVRSATDEAVQATSSRTRKAINSVRSPSSAAAATSTSPSAAEETNDATLSEARK.

[0012] It can be understood that based on the protein designed by the present invention, proteins with similar functions obtained by amino acid substitution, deletion or addition by genetic modification means in the art should be within the scope of protection of the present invention. The number of the above-mentioned substituted, deleted or added amino acids can be any value, such as 1, 5, 10, 15 and above, so that the sequence identity of the changed amino acid sequence and its respective corresponding original sequence can be 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more.

[0013] In a second aspect, the present invention provides a nucleic acid molecule encoding the protein described in the first aspect.

[0014] Preferably, the nucleic acid sequence of the nucleic acid molecule includes the sequence shown in SEQ ID NO.2.

[0015] SEQ ID NO.2:

[0016] 5'-ATGGACTACAAAGACCATGACGGTGATTATAAAGATCATGACATCG ACTACAAGGATGACGATGACAAGGTTAACAGGCGGCGGCAAAGAGCCAGTCGGGCTGGTGTAGTCGCACGAAGAGCTACACCCGGTGACGCACAAGCCAACTCAGGTAGAGCTCCCGCCCGGCCATTTCAGTCTTTTGTGTCAAACGGAGCCATGCTGATGAACAAGCAAATTGTGGCTGGGATAGTTGCAGGTCTGGTCAGCATGTCCTCCCACGCACAGCTCGGTC AACTCTTCCAGTCTGTTAAGGAACAGGTCACTCAGGCAGCAACCTCTCAGGTAAATCAAGGAGTAAGGTCCGCTACTGACGAAGCCGTGCAAGCAACATCTAGTCGGACCAGAAAGGCCATTAACAGTGTTAGGTCCCCCTCAAGCGCAGCAGCCGCTACTTCTACAAGCCCTTCTGCTGCCGAGGAGACTAATGACGCTACCCTGAGTGAGGCCCGCAAATAA-3'.

[0018] In a third aspect, the present invention provides a recombinant vector, wherein the recombinant vector contains the nucleic acid molecule described in the second aspect.

[0019] In a fourth aspect, the present invention provides an engineered cell, wherein the engineered cell expresses the protein described in the first aspect.

[0020] Preferably, the starting cells of the engineered cells include intestinal flora cells.

[0021] Preferably, the intestinal flora cells include at least one of Escherichia coli, Bifidobacterium or lactic acid bacteria.

[0022] The engineered cell of the present invention expresses the protein described in the first aspect, and may contain a nucleic acid molecule encoding the protein or a recombinant vector containing the nucleic acid molecule.

[0023] In the present invention, by expressing specific gene-encoded proteins in intestinal flora (such as Escherichia coli), endogenous manganese ions are used to enhance signals in magnetic resonance imaging (MRI), thereby achieving high-resolution positioning and dynamic tracking of intestinal flora.

[0024] It is understood that in actual application, the technical solution of the present invention can be modified and adjusted to a certain extent. For example, the starting cells can use common intestinal flora such as Escherichia coli, but other types of intestinal flora, such as bifidobacteria, lactic acid bacteria, etc., can also be used. By adjusting the design and expression conditions of gene-encoded proteins, accurate positioning and tracking of different flora can be achieved.

[0025] In a fifth aspect, the present invention provides the use of the protein described in the first aspect, the nucleic acid molecule described in the second aspect, the recombinant vector described in the third aspect, or the engineered cell described in the fourth aspect in the preparation of a reagent for magnetic resonance imaging localization and tracking of intestinal flora.

[0026] In the present invention, the protein is used to design an expression system, which can be stably expressed in a complex intestinal environment. The protein binds to endogenous manganese ions (such as manganese elements from the host intestine) in the intestinal flora to form manganese ion aggregates. The endogenous manganese ions are used to enhance the signal in magnetic resonance imaging (MRI), thereby achieving high-resolution positioning and dynamic tracking of the intestinal flora without relying on exogenous contrast agents, thereby avoiding potential interference of external substances on the intestinal flora and ensuring its long-term and effective use for dynamic monitoring.

[0027] In a sixth aspect, the present invention provides a kit for magnetic resonance imaging localization and tracking of intestinal flora, the kit comprising the engineered cells described in the fourth aspect.

[0028] In a seventh aspect, the present invention provides a method for magnetic resonance imaging positioning and tracking of intestinal flora, the method comprising:

[0029] The engineered cells described in the fourth aspect are transplanted into the intestine of the target to be detected, and magnetic resonance imaging is performed.

[0030] The present invention designs a novel magnetic resonance localization method for intestinal flora. By expressing specific proteins in common intestinal flora, it enables them to present high signals in magnetic resonance T1-weighted imaging, thereby achieving precise localization of intestinal flora. It can not only provide high-resolution spatial distribution information, but also has the advantages of non-invasive and real-time monitoring, and is expected to play an important role in the research and clinical application of intestinal flora.

[0031] It can be understood that the intestinal flora magnetic resonance imaging positioning and tracking method of the present invention can be used for disease diagnosis as well as for basic research for non-disease diagnosis purposes (such as microecological research).

[0032] Preferably, the method of magnetic resonance imaging comprises T1-weighted imaging.

[0033] It can be understood that the target to be detected in the present invention can be an experimental animal model (such as mice and rats), and can also be extended to the intestinal flora imaging of the human body in clinical practice, and has application prospects in multiple fields such as microecological research, disease diagnosis, and personalized treatment.

[0034] Compared with the prior art, the present invention has at least the following beneficial effects:

[0035] The present invention designs a specific protein that can bind to endogenous manganese ions and effectively enhance MRI signals. The specific protein is further expressed in the intestinal flora through genetic engineering means, and magnetic resonance imaging is performed using endogenous manganese ions to achieve high-resolution positioning and dynamic tracking of the intestinal flora. The use of exogenous contrast agents can be avoided, and there is no side effect or immune response. Non-invasive, real-time dynamic, high-resolution imaging can be performed, providing spatial distribution and dynamic change information of the intestinal flora. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] Figure 1 Provide technical route for magnetic resonance imaging to locate intestinal flora.

[0037] Figure 2 This is the expression verification result of the target protein in Escherichia coli.

[0038] Figure 3 These are the results of the Escherichia coli magnetic resonance T1 imaging verification, where Figure A is the colony image and Figure B is the magnetic resonance T1 weighted imaging.

[0039] Figure 4 MRI imaging results after Escherichia coli was transplanted into the mouse intestine. DETAILED DESCRIPTION

[0040] The technical solution of the present invention is further described below in conjunction with the accompanying drawings and through specific implementation methods. However, the following examples are only simplified examples of the present invention and do not represent or limit the scope of protection of the present invention. The scope of protection of the present invention shall be subject to the claims.

[0041] If no specific techniques or conditions are specified in the examples, the techniques or conditions described in the literature in the field or the product instructions are used. If no manufacturer is specified for the reagents or instruments used, they are all conventional products that can be purchased through regular channels.

[0042] The present invention designs a new method for magnetic resonance localization and tracking of intestinal flora. It uses genetic engineering technology to express specific proteins in common intestinal flora (such as Escherichia coli, etc.), and uses endogenous manganese ions to enhance magnetic resonance T1-weighted imaging signals, thereby achieving accurate localization, dynamic monitoring and spatial distribution tracking of intestinal flora. The specific technical solution includes the following key links (technical roadmap as shown in the figure) Figure 1 shown):

[0043] 1. Genetic engineering construction and expression: The present invention first introduces a specific marker gene into the target intestinal flora (such as Escherichia coli, Bifidobacterium, lactic acid bacteria, etc.) through genetic engineering technology. The protein has the ability to bind to endogenous manganese ions and can effectively introduce manganese ions into the bacterial cells, thereby enhancing the MRI T1-weighted imaging signal.

[0044] 2. Utilization of endogenous manganese ions: Genetically engineered proteins bind to endogenous manganese ions (such as manganese from the host's intestines) in the intestinal flora to form manganese ion aggregates, thereby enhancing the magnetic resonance imaging signal of the intestinal flora. Manganese ions, as an endogenous contrast agent, can produce high signals in MRI T1-weighted imaging, allowing the intestinal flora to be clearly imaged.

[0045] 3. Accurate positioning and tracking of intestinal flora: Through magnetic resonance imaging (MRI), combined with the distribution of endogenous manganese ions in the intestinal flora, the distribution of intestinal flora in space can be monitored in real time, providing high-resolution spatial distribution information and tracking the dynamic changes of intestinal flora at different time points, breaking through the limitation of traditional methods that cannot obtain the spatial distribution and dynamic changes of intestinal flora. The process includes:

[0046] (1) Transplantation of engineered bacteria: The engineered bacteria expressing the target protein are verified in vitro and transplanted into the animal intestines through oral administration or intestinal injection. The transplanted engineered bacteria will colonize in the intestines and become the tracking target, providing a basis for subsequent imaging; (2) Cultivation and maintenance of animal intestinal flora: The transplanted engineered bacteria will continue to grow in the animal intestines and coexist with the original flora; (3) MRI scanning: After the transplantation is completed, the animal is scanned using MRI equipment, and T1-weighted imaging technology is used to obtain magnetic resonance images of the animal intestines to display the spatial distribution of the markers. High-resolution imaging can accurately track the location and dynamic changes of the intestinal flora.

[0047] In the specific embodiment of the present invention, Escherichia coli was used as an example to construct an engineered bacterium, and the technical solution of the present invention was further verified in the intestine of mice.

[0048] Example 1

[0049] In this example, an engineered Escherichia coli expressing a manganese ion binding protein was constructed and verified.

[0050] (1) Strain construction

[0051] Target strains: Select common intestinal flora bacteria, such as Escherichia coli (E. coli), Bifidobacterium or Lactobacillus, which can grow in the intestinal environment and express exogenous genes.

[0052] The amino acid sequence of the gene can be designed according to SEQ ID NO.1, and the expression and manganese ion binding ability can also be optimized by amino acid modification or mutation.

[0053] The gene sequence also needs to be added with a suitable tag sequence, such as a 6×His tag, for purification after protein expression.

[0054] (2) Transformation of Escherichia coli host cells

[0055] The constructed recombinant vector is transformed into E. coli host cells. Common transformation methods include chemical transformation or electroporation.

[0056] The transformed E. coli are cultured on a medium containing corresponding antibiotics to select successfully transformed cells.

[0057] Screening of positive clones: Through antibiotic screening and PCR verification, clones that have been successfully transformed and contain the target gene are screened.

[0058] (3) Expression of recombinant protein

[0059] The selected positive clones are transferred to a medium containing an appropriate inducer (such as IPTG) to induce the expression of the target protein.

[0060] The expressed protein is dissolved, purified, and other treatments are performed. Common protein purification methods include affinity chromatography, ion exchange chromatography, and gel filtration.

[0061] Confirm the expression of the protein and verify the expressed recombinant protein by SDS-PAGE and Western Blot.

[0062] (4) Expression verification

[0063] The expression of target protein was detected by Western blot.

[0064] 1) Sample preparation

[0065] Culture cells: Select E. coli expressing the target protein (positive clones transformed and induced to express). Culture the bacteria to the logarithmic growth phase (OD 600 The induction condition is generally 4-6 hours at 37°C. The specific time and temperature can be optimized according to the characteristics of the protein.

[0066] 2) Lyse cells: Use protein lysis buffer (such as RIPA lysis buffer or PBS containing protease inhibitors) to lyse cells. Lyse cells by ultrasonic disruption or freeze-thaw method to extract total cell protein. Cell debris can be removed by centrifugation (12,000×g, 10 minutes), and the supernatant can be collected as a protein extract.

[0067] 3) Protein quantification: Use BCA protein quantification kit or Bradford method to determine protein concentration to ensure that the amount of protein loaded in each sample is consistent.

[0068] 2) SDS-PAGE electrophoresis

[0069] Prepare an SDS-PAGE gel. Typically, a 12% or 15% polyacrylamide gel is used, which is suitable for most molecular weight proteins.

[0070] The samples (containing sample buffer) were heated to 95°C together with molecular weight markers for 5 minutes to ensure sufficient protein denaturation.

[0071] The pre-treated samples (usually 20-40 μg per sample) were loaded into the gel wells.

[0072] Proteins are separated using SDS-PAGE electrophoresis, usually at 120 V until the dye front approaches the bottom of the gel.

[0073] 3) Transfer

[0074] After electrophoresis, the proteins on the gel are transferred to a PVDF membrane or a nitrocellulose membrane. The transfer is usually performed by wet transfer (or semi-dry transfer) in a transfer buffer with a voltage set to 100V for 1-1.5 hours.

[0075] After transfer, Ponceau S staining was used to check the transfer efficiency and the quality of the proteins on the membrane.

[0076] 4) Blocking and antibody incubation

[0077] Blocking: Block the membrane with 5% skim milk powder or BSA (phosphate buffer containing 1% BSA) at room temperature for 1 hour to prevent nonspecific binding.

[0078] Primary antibody incubation: Add primary antibody against the target protein (such as specific antibody against the target protein, dilution ratio of 1:1000 to 1:5000), incubate overnight at 4°C to ensure sufficient binding.

[0079] Washing: Wash the membrane three times with TBST (TBS + 0.1% Tween-20), each wash for 5-10 minutes to remove unbound primary antibody.

[0080] 5) Secondary antibody incubation

[0081] Add HRP (horseradish peroxidase) labeled secondary antibody matching the primary antibody and incubate for 1 hour at room temperature.

[0082] Washing: Wash the membrane three times with TBST to remove unbound secondary antibody.

[0083] 6) Protein detection

[0084] Use a chemiluminescent substrate (such as ECL kit) to react with HRP to generate a chemiluminescent signal.

[0085] 7) Result analysis

[0086] The results are as follows Figure 2 As shown, the results indicate that the engineered Escherichia coli expressing the target protein was successfully constructed.

[0087] (5) MRI Escherichia coli verification

[0088] The magnetic resonance signal of the engineered E. coli was verified by in vitro experiments. The engineered E. coli was cultured on a culture plate and subjected to MRI scanning.

[0089] 1) Pipette 0.2 μg of the constructed target plasmid and empty control plasmid, mix thoroughly, add to 100 μL of competent cells, and place on ice for 30 minutes.

[0090] 1) Heat shock the competent cells in a 42°C water bath for 90 seconds, then place on ice again for 5-10 minutes.

[0091] 2) Add 600 μL of LB medium without resistance, incubate at 37°C, shake the bacteria, and recover the culture for 1 hour.

[0092] 3) Centrifuge at 1200×g, slowly aspirate the supernatant, leaving about 100 μL, and mix by slowly pipetting.

[0093] 4) Add 30 μL of X-gal and 3 μL of IPTG to the competent medium and mix thoroughly, then spread evenly on a bacterial plate with resistance and culture inverted at 37°C overnight.

[0094] 5) After culturing for about 16-20 hours, when the single colonies are clear and non-overlapping, the bacteria plate is carefully covered with the 1% Agrose gel prepared in advance to form a sandwich structure, and bubbles are removed as much as possible without destroying the colony morphology, and then MRI scanning is performed as required. The MRI scanning parameters are: T1 weighted fast spin-echo sequence was used, echo time (TR / TE) = 700 / 14.3ms; FOV 60mm × 60mm, base resolution 240, voxel size 0.25*0.25mm, and a slice thickness of 1.5mm.

[0095] T1-weighted imaging was used to verify whether the target protein could enhance the MRI signal of Escherichia coli. Figure 3 As described above, Figure A is a colony image, in which white colonies are colonies expressing the target protein, and black colonies are control colonies; Figure B is the result of magnetic resonance T1 weighted imaging, in which the colonies expressing the target protein are high signals on magnetic resonance T1 weighted imaging. The image clearly shows the expression of the target protein in Escherichia coli and its signal intensity in MRI, providing an experimental basis for subsequent in vivo verification in mice.

[0096] Example 2

[0097] This example uses engineered E. coli transplantation and mouse intestinal magnetic resonance imaging for verification.

[0098] The engineered E. coli that has been verified in vitro was transplanted into the intestines of mice to achieve in vivo localization and tracking of the intestinal flora. Subsequently, the mice were scanned using magnetic resonance imaging (MRI) technology to verify the effectiveness of this method in the mouse intestine. Through T1-weighted imaging technology, magnetic resonance images of the intestine can be obtained, thereby accurately tracking the spatial distribution and dynamic changes of the intestinal flora.

[0099] The specific experimental process includes:

[0100] 1. Cultivation of engineered E. coli

[0101] The successfully constructed engineered E. coli strain (the strain expressing the target protein) is inoculated into LB liquid medium containing appropriate antibiotics (for example, ampicillin or kanamycin is added to ensure that only bacteria carrying the recombinant plasmid can grow).

[0102] The bacterial solution was cultured in a shaking incubator at 37°C until OD 600 The value reaches 0.6-0.8, at which time the bacteria are in the logarithmic growth phase and are suitable for transplantation.

[0103] The bacterial culture medium was removed, the bacteria were centrifuged and precipitated, and then resuspended with PBS buffer to adjust the bacterial concentration to an appropriate level (eg, 10^8-10^9 CFU / mL).

[0104] 2. Preparation of Mice

[0105] Select healthy mice (e.g., 6-8 week old C57BL / 6 mice or Balb / c mice) and perform appropriate feeding management and fasting (usually 4 hours fasting to reduce disturbance of intestinal contents) before transplantation. Use aseptic techniques to handle all experimental materials and ensure that the mice are under anesthesia. Common anesthetics such as ketamine / difluanoids can be used for anesthesia.

[0106] 3. Transplantation of Engineered E. coli

[0107] The prepared engineered E. coli suspension is transplanted into the mouse by intestinal perfusion. A sterile gastric tube or a dedicated bacterial perfusion needle can be used to directly perfuse the bacterial solution into the mouse stomach or intestine. For intestinal colonization, direct injection into the mouse cecum or colon can be selected.

[0108] The number of bacteria transplanted into each mouse is about 10^8-10^9 CFU. During the transplantation process, the sterility of the injection liquid must be ensured and injected slowly to avoid excessive stimulation.

[0109] 4. Recovery and Observation

[0110] After the colony transplant is completed, place the mouse in a warm recovery box until the anesthesia wears off. Observe the mouse's behavioral response, appetite, fecal discharge, etc. to ensure that the transplanted bacteria can stably colonize the intestine. Observe the mice regularly in the hours or days after the transplant to confirm the colonization of the engineered E. coli.

[0111] The results are as follows Figure 4 As shown, the experimental group was transplanted with E. coli expressing the target protein, and the control group was transplanted with empty control E. coli. Figure 4 The MRI imaging results after Escherichia coli transplantation in the mouse intestine were demonstrated, clearly showing the spatial distribution of the intestinal flora and its signal enhancement effect in T1-weighted imaging, providing an effective basis for the positioning and dynamic tracking of the intestinal flora.

[0112] In summary, the present invention provides a method for magnetic resonance localization and tracking of intestinal flora based on endogenous manganese ions, wherein a specific protein encoding gene is introduced into the target intestinal flora, and the protein has the ability to bind to endogenous manganese ions, and can effectively introduce manganese ions into the flora cells, enhance the MRI T1-weighted imaging signal, and transplant the flora expressing the specific protein into the intestine, so that it can be stably expressed in a complex intestinal environment. Through magnetic resonance imaging (MRI), combined with the distribution of endogenous manganese ions in the intestinal flora, the distribution of the intestinal flora in space can be monitored in real time, high-resolution spatial distribution information can be provided, and the dynamic changes of the intestinal flora can be tracked at different time points, breaking through the limitation that the traditional method cannot obtain the spatial distribution and dynamic changes of the intestinal flora, and at the same time avoiding the biocompatibility and safety problems caused by the traditional method relying on exogenous contrast agents.

[0113] The applicant declares that the above is only a specific implementation mode of the present invention, but the protection scope of the present invention is not limited thereto. Those skilled in the art should understand that any changes or substitutions that can be easily thought of by those skilled in the art within the technical scope disclosed by the present invention shall fall within the protection scope and disclosure scope of the present invention.

Claims

1. A protein, characterized in that The amino acid sequence of the protein includes the sequence shown in SEQ ID NO.

1.

2. A nucleic acid molecule, characterized in that The nucleic acid molecule encodes the protein of claim 1.

3. The nucleic acid molecule according to claim 2, characterized in that The nucleic acid sequence of the nucleic acid molecule includes the sequence shown in SEQ ID NO.

2.

4. A recombinant vector, characterized in that: The recombinant vector contains the nucleic acid molecule according to claim 2 or 3.

5. An engineered cell, characterized in that: The engineered cells express the protein of claim 1.

6. The engineered cell according to claim 5, characterized in that The starting cells of the engineered cells include intestinal flora cells; Preferably, the intestinal flora cells include at least one of Escherichia coli, Bifidobacterium or lactic acid bacteria.

7. Use of the protein according to claim 1, the nucleic acid molecule according to claim 2 or 3, the recombinant vector according to claim 4 or the engineered cell according to claim 5 or 6 in the preparation of a reagent for magnetic resonance imaging localization and tracking of intestinal flora.

8. A kit for magnetic resonance imaging positioning and tracking of intestinal flora, characterized in that: The kit comprises the engineered cells according to claim 5 or 6.

9. A method for locating and tracking intestinal flora by magnetic resonance imaging, characterized in that: The method comprises: The engineered cells according to claim 5 or 6 are transplanted into the intestine of the target to be detected, and magnetic resonance imaging is performed.

10. The method for locating and tracking intestinal flora by magnetic resonance imaging according to claim 9, characterized in that: Magnetic resonance imaging methods include T1-weighted imaging.

Images